Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

C/EBPα induces Ebf1 gene expression in common lymphoid progenitors

  • Theresa Barberi,

    Roles Conceptualization, Formal analysis, Investigation, Writing – review & editing

    Affiliation Division of Pediatric Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America

    ⨯
  • Cheng Cui,

    Roles Investigation, Writing – review & editing

    Affiliations Division of Pediatric Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America, Department of Physiology, China Medical University, Shenyang, China

    ⨯
  • Alan D. Friedman

    Roles Conceptualization, Formal analysis, Funding acquisition, Investigation, Supervision, Writing – original draft

    afriedm2@jhmi.edu

    Affiliation Division of Pediatric Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America

    ⨯

Abstract

C/EBPα is required for formation of granulocyte-monocyte progenitors (GMP) and also participates in B lymphopoiesis. The common lymphoid progenitor (CLP) and preproB populations but not proB cells express Cebpa, and pan-hematopoietic deletion of the +37 kb Cebpa enhancer using Mx1-Cre leads not only to reduced GMP but also to 2-fold reduced marrow preproB and >15-fold reduced proB and preB cells. We now show that IL7Rα-Cre-mediated deletion of the +37 kb Cebpa enhancer, which occurs in 89% of Ly6D+ and 65% of upstream Ly6D- CLP, leads to a 2-fold reduction of both preproB and proB cells, and a 3-fold reduction in preB cells, with no impact on GMP numbers. These data support a direct role for C/EBPα during B lineage development, with reduced enhancer deletion in Ly6D- CLP mediated by IL7Rα-Cre diminishing the effect on B lymphopoiesis compared to that seen with Mx1-Cre. Amongst mRNAs encoding key transcriptional regulators that initiate B lymphoid specification (PU.1, E2A, IKAROS, EBF1, FOXO1, and BACH2), only Ebf1 levels are altered in CLP upon Mx1-Cre-mediated Cebpa enhancer deletion, with Ebf1 reduced ~40-fold in Flt3+Sca-1intc-kitintIL7Rα+ CLP. In addition, Cebpa and Ebf1 RNAs were 4- and 14-fold higher in hCD4+ versus hCD4- CLP from Cebpa-hCD4 transgenic mice. Histone modification ChIP-Seq data for CLP indicate the presence of active, intronic Ebf1 enhancers located 270 and 280 kb upstream of the transcription start sites. We identified a cis element in this region that strongly binds C/EBPα using the electrophoretic mobility shift assay. Mutation of this C/EBPα-binding site in an Ebf1 enhancer-TK-luciferase reporter leads to a 4-fold reduction in C/EBPα-mediated trans-activation. These findings support a model of B lymphopoiesis in which induction of Ebf1 by C/EBPα in a subset of CLP contributes to initiation of B lymphopoiesis.

Citation: Barberi T, Cui C, Friedman AD (2020) C/EBPα induces Ebf1 gene expression in common lymphoid progenitors. PLoS ONE 15(12): e0244161. https://doi.org/10.1371/journal.pone.0244161

Editor: Louise Purton, St. Vincent's Institute, AUSTRALIA

Received: August 20, 2020; Accepted: December 3, 2020; Published: December 17, 2020

Copyright: © 2020 Barberi et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: This work was support by National Institutes of Health grants R01 HL130034 to ADF and P30 CA006973 (www.nih.gov) and the Giant Food Children's Cancer Research Fund (www.giantfood.com). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

CCAAT/enhancer binding protein α (C/EBPα) is a basic region-leucine zipper transcription factor expressed prominently in hepatocytes, adipocytes, pulmonary type II pneumocytes, and hematopoietic myeloid cells [1–3]. C/EBPα is required for the formation of the granulocyte-monocyte progenitor (GMP) in adult bone marrow and thus also for the generation of mature neutrophils, monocytes, and eosinophils [4, 5].

In addition to its central role in myelopoiesis, C/EBPα contributes to early B lymphoid development. The murine Cebpa gene contains a 450 bp enhancer, located at +37 kb, that is active specifically in hematopoietic cells [6–8]. In particular, cytomegalovirus (CMV)-Cre-mediated deletion of the Cebpa +37 kb enhancer leads to 28-fold reduced marrow Cebpa mRNA without affecting expression in liver, adipose, or lung, and the corresponding, highly conserved, human +42 kb enhancer contains activating histone marks in hematopoietic myeloid cells but not in other tissues [9, 10]. Unlike deletion of the Cebpa open-reading frame, which generally leads to death prior to one month of age due bacterial infection consequent to severe neutropenia, the inducible Mx1-Cre-mediated deletion of the hematopoietic-specific +37 kb enhancer allows maintenance of peripheral neutrophil counts at a level compatible with survival for at least 18 months [5]. Upon Mx1-Cre-mediated deletion of the +37 kb Cebpa enhancer, Cebpa mRNA is 14-fold reduced in GMP and 8-fold decreased in the common lymphoid progenitor (CLP) population, with 4-fold fewer B-lymphoid colonies forming in cultures with IL-7, 2-fold reduced marrow preproB cells, and >15-fold reduction of marrow proB, early preB, and preB cells [9, 11]. In contrast, splenic and thymic T cell numbers are unaffected by Cebpa enhancer deletion [11].

The mechanism whereby C/EBPα contributes to B lymphopoiesis remains uncertain. In one model of hematopoiesis, Flt3-CD34- long-term and Flt3-CD34+ short-term hematopoietic stem cells give rise to Flt3+CD34+ lymphoid-primed multipotent progenitors (LMPP), which in turn generate GMP and CLP, the latter having B and T lymphoid, natural killer (NK), and dendritic cell (DC) potential. Onset of interleukin-7 receptor α (IL7Rα) expression with diminution of Sca-1 and c-kit broadly defines the Lineage-negative (Lin-)Sca-1intc-kitintIL7Rα+Flt3+ CLP population, from which preproB and then proB cells develop [12]. CLP can be further divided into an Ly6D- multipotent subset and an Ly6D+ unipotent subset, the latter mainly generating B cells in vivo [13]. During normal B cell development, IKAROS and PU.1 induce E2A/TCF3 expression, which in turn activates the genes encoding EBF1 and FOXO1; EBF1 and FOXO1 then generate a positive-feedback loop and stimulate PAX5 expression to initiate proB cell formation followed by downstream B lineage development [14–19]. E2A also induces BACH2, which stimulates FOXO1 expression to favor B lymphopoiesis while inhibiting myelopoiesis [20]. IKAROS (encoded by Izkf1) and PU.1 are required in LMPP to initiate lymphoid development, E2A is required for progression beyond the Ly6D- CLP stage, and EBF1 and FOXO1 are first expressed above minimal levels and specify B lymphopoiesis in Ly6D+ CLP [13–17].

We previously found that Cebpa +37 kb enhancer deletion using Mb1-Cre, which is initially expressed at the proB stage, does not affect B lineage development [11]. We now find that deletion of the Cebpa enhancer with IL7Rα-Cre, but not Rag1-Cre, impairs B lymphopoiesis without inducing the reduction of GMP or expansion of LMPP seen with pan-hematopoietic, Mx1-Cre-mediated enhancer deletion [9], providing support for a direct role for C/EBPα at an early stage of B cell development. IL7Rα-Cre deleted the STOP codon in a ROSA26-loxP-STOP-loxP-YFP (R26-LSL-YFP) allele in 89% of Ly6D+ CLP, but only in 65% of Ly6D- CLP, and Rag1-Cre is less active in these populations. The reduced activity of IL7Rα-Cre in Ly6D- CLP, together with a lag in enhancer excision, may account for the more modest effect on B lymphopoiesis of IL7Rα-Cre- compared with Mx1-Cre-mediated Cebpa enhancer deletion.

Examination of our prior microarray data reveals that Cebpa and Ebf1 mRNA levels are each reduced 4-fold in preproB cells upon Mx1-Cre-mediated Cebpa +37 kb enhancer deletion, whereas Izkf1, E2A, Foxo1, and Bach2 levels are unchanged. We now further find that Cebpa enhancer deletion essentially eliminates Ebf1 expression in CLP, whereas Pu.1, Izkf1, E2A, Foxo1, and Bach2 levels are unaffected. In addition, RNA analysis of CLP sorted from Cebpa +37 kb enhancer/promoter-hCD4 transgenic reporter mice reveals 4-fold increased Cebpa and 14-fold increased Ebf1 expression in the hCD4+ compared with the hCD4- population. Through analysis of available ChIP-Seq data, we have identified an evolutionarily conserved Ebf1 +270/280 kb genomic region that contains activating H3K4me1 and H3K27Ac histone marks, indicative of potential Ebf1 enhancers, as well as several sites that match or nearly match the C/EBPα DNA-binding consensus within evolutionarily conserved sub-domains of this region. An oligonucleotide containing one of these consensus sites binds C/EBPα strongly in the gel shift assay, and mutation of this site leads to 4-fold reduced C/EBPα-mediated trans-activation of an Ebf1 enhancer-luciferase reporter. Together, our findings support a model wherein C/EBPα induces Ebf1 expression in CLP to facilitate B lymphopoiesis.

Materials and methods

Ethics statement

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol (M019M10) was approved by the Johns Hopkins University Animal Care and Use Committee. All efforts were made to minimize suffering. As procedures caused only momentary, slight pain analgesics and anesthesia were not required. Euthanasia prior to marrow removal was by carbon dioxide asphyxiation, followed by cervical dislocation.

Murine models

Cebpa Enh(f/f) and Enh(f/f);Mx1-Cre mice, having loxP sites surrounding the +37 kb Cebpa enhancer, were described previously [9]. Enhancer deletion was induced in Enh(f/f);Mx1-Cre mice by intra-peritoneal injection of 300 μg of pIpC (Invivogen) every other day for three doses. Rag1-Cre, IL7Rα-Cre, and R26-LSL-YFP mice (Jackson Laboratory, #006148) were previously described [21–23]. Cebpa Enh/Prom-hCD4 mice possess a transgene linking the +37 kb Cebpa enhancer to the Cebpa promoter and a human CD4 (hCD4) reporter [7]. All alleles were on the C57BL/6 background. Mice were housed in ventilated cages with a 12 hr light/dark cycle, maximum five mice per cage, and were provided acidified water and autoclaved Envigo 2018SX feed. Male and female 12- to 24-week old mice were utilized.

Flow cytometry

Marrow was obtained by crushing femurs, tibia, and hips in phosphate-buffered saline (PBS) with 3% heat-inactivated fetal bovine serum (HI-FBS) using a mortar and pestle, then passage through a 40 μm cell strainer, followed by red blood cell lysis with ammonium chloride and enumeration of total mononuclear cells using a hemocytometer. After antibody staining, cell analysis or cell sorting were accomplished using an LSRFortessa analyzer or the FACSAria II sorter (BD Biosciences). Antibodies were from BD Biosciences unless otherwise indicated. For enumeration of B cell precursors, marrow was subjected to lineage-depletion by staining with biotin-anti-Lineage Cocktail (with anti-Gr1, -CD11b, -Ter119, and -CD3 but without anti-B220), biotin-anti-IgM (II/41, Invitrogen), and biotin-anti-NK1.1 (PK136, Invitrogen), followed by incubation with anti-biotin microbeads and passage through LD columns (Miltenyi). Resulting Lin- cells were stained with anti-B220-APC (RA3-6B2, Biolegend), anti-CD43-BV786 or -PE (S7), anti-CD93-BV650, anti-BP-1-PE (Biolegend) or -FITC (6C3, Invitrogen), anti-CD24-BUV496 or -PE-Cy7, and anti-CD19-BV421. LMPP and CLP were identified using Lineage Cocktail (with anti-B220)-FITC (Biolegend), -BV421 (Biolegend), or -PerCP-Cy5.5, anti-Sca-1-PE-Cy7 (D7, Invitrogen), anti-c-kit-APC (2B8), anti-CD127-BV650 (A7R34, Biolegend), anti-Flt3-PE (A2F10.1), and anti-Ly6D-eF450 (49-4H, Invitrogen). YFP was detected in the FITC channel. Human CD4 was detected using anti-hCD4-BV785 (RPA-T4, Biolegend). Marrow was lineage-depleted prior to further staining and sorting for LMPP and CLP.

RNA analysis

RNA from hematopoietic cells was prepared using NucleoSpin RNA II, with use of RNase-free DNase (Machery-Nagel). First strand cDNA was prepared using ImProm-II reverse transcriptase (Promega) and oligodT primer at 42°C for 1 hr. Quantitative PCR was carried out in triplicate using 5–25 ng of each cDNA using Radiant LoRox SYBR Green supermix (Alkali Scientific). Cebpa, Ebf1, Pu.1, Pax5, Izkf1, E2A, Foxo1, Bach2, and ribosomal subunit mS16 internal control primers were:

Cebpa-F: 5’-TGGACAAGAACAGCAACGAG,

Cebpa-R: 5’-TCACTGGTCAACTCCAGCAC,

Ebf1-F: 5’-GGATACGGACAGAACAGGATTTC,

Ebf1-R: 5’-GGCACATTTCAGGGTTCTTGTC,

Pu.1-F: 5’- CCTTCGTGGGCAGCGATGGA,

Pu.1-R: 5’- TGTAGCTGCGGGGGCTGCAC,

Pax5-F: 5’-CTCTGACATCTTCACCACCAC,

Pax5-R: 5’-GTTGGCTTTCATGTCATCCAGG,

Izkf1-F: 5’-ATACAGAGAGCAACGCGGAG,

Izkf1-R: 5’-CGCTGCTCCTCCTTGAGAG,

E2A-F: 5’-TGATGTTCCCGCTACCTGTG,

E2A-R: 5’-CTTCGCTGTATGTCCGGCTA,

Foxo1-F: 5’-TCAAGGATAAGGGCGACAGC,

Foxo1-R: 5’-GCTCTTCTCCGGGGTGATTT,

Bach2-F: 5’-CCAAGTCCGACCCCAGATTA,

Bach2-R: 5’-GAAGTTTAACCTCCTGGCCC,

mS16-F: 5’-CTTGGAGGCTTCATCCACAT, and

mS16-R: 5’-ATATTCGGGTCCGTGTGAAG.

Gel shift and chromatin immunoprecipitation assays

293T cells (ATCC, CRL-3216) were transiently transfected with 4μg CMV or 4 μg CMV-C/EBPα in 100 mm dishes using 15 μL Lipofectamine 2000 (Invitrogen). Nuclear extracts were prepared two days later and gel shift assay performed using 1 ng of radio-labelled probe and 6 μg of nuclear extract, as described [24]. Oligonucleotide probes containing 5′-GATC or 5’-TCGA overhangs were radio-labeled to similar specific activity using Klenow enzyme and α-P32-dCTP. Sense strands of the probes used, with binding sites underlined, were as follows:

Ebf1-α1: 5’-GATCCTGATAATGGAGGAAGAAATAAGCTAGCGG,

Ebf1-α2: 5’-GATCCAGTTTGCCTTTGAGTAATGTCGTCAATTTG,

Ebf1-α3: 5’-GATCGTTATTGTTAAAAGTTGGGCAAGGTTGAAATGC, and

NE-C/EBP: 5’-TCGAGGCCAGGATGGGGCAATACAACCCG.

Chromatin immunoprecipitation (ChIP) was conducted using 10 μL (1:50) rabbit monoclonal anti-C/EBPα antibody (Cell Signaling, #8178S) or normal rabbit immune globulin G (IgG, Cell Signaling #3900S) as described [25], with the use of the following genomic DNA PCR primer pairs:

Ebf1- α1F: 5’-CCCAGAAGTAAGGTGTACCAAGT,

Ebf1- α1R: 5’-CCAGCCTCCAGAGCAAAATC,

Ebf1- α2F: 5’-AGAGGCTCTTGCTATTTGAGCC,

Ebf1- α2R: 5’-ACTCAAGCCAAGTAACTCACCC,

Ebf1- α3F: 5’-GCGAGTTATTTGCAAAAGCGAA,

Ebf1- α3R: 5’-AGCTTTTGTACAAGCAGTTGGG,

PU.1enhF: 5’-CTGGTGGCAAGAGCGTTTC, and

PU.1enhR: 5’-CCACATCGGCAGCAGCAAG.

Cell culture and transient transfection

The TK-Luc reporter, containing a minimal herpes simplex virus thymidine kinase (TK) promoter, was generated by ligating a double-stranded oligonucleotide between the NotI and HindIII sites of pREP4. The sequence of the sense strand, with TATAA box and RNA start sites underlined, is:

5’-TTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAG. 350 bp murine Ebf1 genomic segments containing wild-type or mutant C/EBPα consensus site α3 were synthesized (Blue Heron) and ligated upstream between the KpnI and NotI sites in plasmid TK-Luc to generate Ebf1-TK-Luc and mutant mEbf1-TK-Luc. 293T cells were cultured in Dulbecco’s modified Eagle medium with 10% FBS. 105 cells/well were plated in 24 well dishes followed the next day by transient transfection using Lipofectamine 2000 with 75 ng of luciferase reporter plasmid, 10 ng CMV or CMV-C/EBPα, and 0.4 ng CMV-βGal. Total cell extracts were subjected to luciferase and β-galactosidase assays two days later, as described [8]. 32Dcl3 murine myeloid cells [26] were cultured in Iscove’s modified Dulbecco medium with 10% HI-FBS and 1 ng/mL murine interleukin-3 (Peprotech).

Data analysis

Means and standard deviations (SD) are shown. The Student t test was used for statistical comparisons. Publicly available ChIP-Seq data were analyzed in the vicinity of the Ebf1 gene for histone marks and C/EBPα binding (GSE60103 and GSE58362); publicly available CLP RNA-Seq data was analyzed for Ebf1 and Cebpa expression (GSE92540); and our previous flow cytometry data (https://pubmed.ncbi.nlm.nih.gov/30061199/) was further analyzed for CLP sub-population numbers, as cited in the corresponding figure legends. The original image underlying gel shift results is provided (S1 Fig).

Results

Deletion of the Cebpa +37 kb enhancer using IL7Rα-Cre but not Rag1-Cre impairs B lineage development

Cebpa Enh(f/f);Mx1-Cre mice exposed to pIpC have defects in both the myeloid and B lymphoid lineages, with expansion of upstream LMPPs. To further support a direct role for C/EBPα during B lymphopoiesis, we sought to specifically delete the +37 Cebpa enhancer in early B lineage progenitors. Rag1-Cre deletes the floxed stop codon in a R26-LSL-RFP allele in 3% of LMPP and 60% of CLP [21]. IL7Rα-Cre deletes the stop codon in R26-LSL-YFP in 10% of LMPP and 88% of CLP [22]. We bred these transgenes with Cebpa Enh(f/f) mice to generate Enh(f/f);IL7Rα-Cre and Enh(f/f);Rag1-Cre mice and evaluated their bone marrow GMP, LMPP, Ly6D- and Ly6D+ CLP, preproB, proB, early preB and preB populations using flow cytometry (Fig 1A). Enh(f/f);Mx1-Cre mice exhibit several alterations: 2-fold reduced GMP and 6-fold increased LMPP [9]; >15-fold reduced proB, early preB, and preB cells, and 2-fold reduced preproB cells [11]; and 5-fold increased Lin-Sca-1intc-kitintIL7Rα+Flt3- cells without alteration in Ly6D- or Ly6D+ CLP (S2 Fig). As expected, Enh(f/f);IL7Rα-Cre mice had no significant change in marrow GMP or LMPP numbers; however, they did possess 2.5-fold reduced Ly6D+ CLP and a trend towards 2-fold reduced Ly6D- CLP. Additionally, there was a 3.4-fold reduction in preB cells with a trend towards reduced preproB (1.7-fold) and proB cells (2.3-fold). In contrast, enhancer deletion using Rag1-Cre had minimal effects on these marrow populations.

thumbnail
Download:
Fig 1. Cebpa +37 kb enhancer deletion using IL7Rα-Cre but not Rag1-Cre impairs B lymphopoiesis.

A) Flow cytometry was used to enumerate GMP, LMPP, Ly6D- and Ly6D+ CLP, preproB, proB, early preB, and preB cells in bone marrow isolated from bilateral leg and hip bones from Cebpa +37 kb Enh(f/f), Enh(f/f);IL7Rα-Cre, and Enh(f/f);Rag1-Cre mice (mean and SD from five determinations). B) Flow cytometry was used to determine the proportion of LMPP, Ly6D- and Ly6D+ CLP, preproB, and proB cells from Enh(f/f);IL7Rα-Cre;R26-LSL-YFP or Enh(f/f);Rag1-Cre;R26-LSL-YFP mice that express YFP (mean and SD from three determinations). * p<0.05, ** p<0.01, *** p<0.001.

https://doi.org/10.1371/journal.pone.0244161.g001

To gain insight into the different effects on B lineage development resulting from Cebpa enhancer deletion in Enh(f/f);IL7Rα-Cre versus Enh(f/f);Rag1-Cre mice, we generated Enh(f/f);IL7Rα-Cre;R26-LSL-YFP and Enh(f/f);Rag1-Cre;R26-LSL-YFP mice and evaluated yellow fluorescence protein (YFP) expression as an indicator of Cre activity. Marrow was stained and analyzed for LMPP, Ly6D- CLP, Ly6D+ CLP, preproB, and proB cells (Fig 1B), with representative flow cytometry plots shown (S3 Fig). Of note, preproB cells in our prior [11] and current analyses were depleted of NK cells but were not depleted of plasmacytoid dendritic cells, which express little Cebpa [27]. Consistent with prior findings, YFP was evident in less than 5% of LMPP in both models, and was expressed in a higher proportion of CLP from IL7Rα-Cre compared with Rag1-Cre mice. In both Enh(f/f);IL7Rα-Cre;R26-LSL-YFP and Enh(f/f);Rag1-Cre;R26-LSL-YFP mice, Ly6D was expressed, on average, in 74% of CLP. Rag1-Cre led to YFP expression in 27% of Ly6D- and 61% of Ly6D+ CLP, whereas IL7Rα-Cre induced YFP expression in 65% of Ly6D- and 89% of Ly6D+ CLP, on average. Both induced YFP in ~100% of proB cells, but IL7Rα-Cre led to YFP expression in 94% of the preproB population, compared with only 24% using Rag1-Cre. These data extend prior findings to show that IL7Rα-Cre is more active than Rag1-Cre in both Ly6D+ and Ly6D- CLP; furthermore, we also find that IL7Rα-Cre only induces YFP in two-thirds of the Ly6D- CLP subset, potentially reflecting both the point of onset of IL7Rα expression and delayed kinetics of floxed allele deletion. These findings may account, at least in part, for the quantitatively different B lineage alterations seen in Enh(f/f);Mx1-Cre, Enh(f/f);IL7Rα-Cre, and Enh(f/f);Rag1-Cre mice.

Deletion of the Cebpa +37 kb enhancer using Mx1-Cre leads to markedly reduced Ebf1 expression in CLP

Our prior global gene expression analysis of preproB cells from Cebpa Enh(f/f) versus Cebpa Enh(f/f);Mx1-Cre mice, which were administered pIpC four weeks prior to RNA isolation, reveals 4-fold reduction in both Cebpa and Ebf1 mRNA expression, on average, with no change in Flt3, IL7Rα, E2A, Izkf1, Foxo1, Bach2, Irf4, or Irf8 [11]. Pu.1 was not detected on the array due to its low level at this stage of B cell development. The mean fluorescence intensity of surface Flt3 and IL7Rα, as evaluated by flow cytometry, was not reduced in CLP as a result of Mx1-Cre mediated enhancer deletion [9].

We evaluated RNA expression of Ebf1 and additional B-lineage transcription factors in sorted CLP (experiments 1 and 2) and LMPP (experiment 2) from Cebpa Enh(f/f) and Enh(f/f);Mx1-Cre mice exposed 4 weeks earlier to pIpC. Enh(f/f);Mx1-Cre rather than Enh(f/f);IL7Rα-Cre mice were chosen for these analyses due to our finding that IL7Rα-Cre does not delete the enhancer in the entire CLP population. Consistent with prior findings, Cebpa was reduced 9-fold in CLP. In both experiments, each pooling CLP subsets or LMPP from several mice, deletion of the Cebpa +37 kb enhancer by Mx1-Cre led to a striking loss of Ebf1 expression. In particular, Ebf1 was reduced 25- or 50-fold in CLP. In contrast, levels of Pu.1, Izkf1, E2A, Foxo1, and Bach2 were unchanged in CLP (Fig 2). Pax5 mRNA was reduced 7-fold in CLP, reflecting regulation of its cognate gene by EBF1. Of note, levels of Pax5 in CLP prior to enhancer deletion were substantially lower (Ct value 29.4) compared to the other five RNAs analyzed (Ct values 22.2–26.5), consistent with its known induction and prominent role later in B cell development. Ebf1 and Pax5 expression was not detected in LMPP from Enh(f/f) mice, and Cebpa enhancer deletion did not affect LMPP expression of Izkf1, E2A, Foxo1, Bach2, or Pu.1 (Fig 2 and S4 Fig). These data suggest that amongst several key B-lineage regulators, the gene encoding Ebf1 specifically requires C/EBPα for induction, with ~10-fold reduced Cebpa leading to ~40-fold reduced Ebf1 mRNA in CLP.

thumbnail
Download:
Fig 2. Deletion of the Cebpa +37 kb enhancer using Mx1-Cre leads to marked reduction of Ebf1 mRNA in CLP.

In Experiment 1, CLP sorted from three Enh(f/f) or Enh(f/f);Mx1-Cre mice were pooled and then analyzed by qRT-PCR for expression of Cebpa, Ebf1, or Pu.1/Spi-1. In Experiment 2, LMPP and CLP sorted from four Enh(f/f) or Enh(f/f);Mx1-Cre mice were pooled and then analyzed by qRT-PCR for expression of Ebf1, Pax5, Izkf1, E2A/Tcf3, Foxo1, and Bach2.

https://doi.org/10.1371/journal.pone.0244161.g002

C/EBPα binds and activates the Ebf1 gene via a conserved +280 kb enhancer element

We previously evaluated Cebpa Enh/Prom-hCD4 mice, in which the +37 Cebpa enhancer is linked to an 850 bp Cebpa promoter segment to direct expression of a human CD4 transgene, and observed that hCD4 is expressed in approximately one-half of CLP [7]. We sorted Lin-Sca-1intc-kitintIL7Rα+ CLP from Cebpa Enh/Prom-hCD4 mice into hCD4+ and hCD4- populations and pooled cells from three mice to determine Cebpa and Ebf1 RNA expression (Fig 3). Flt3 expression was not used during CLP isolation due to the paucity of Lin-Sca-1intc-kitintIL7Rα+Flt3+ hCD4+ and hCD4- cells. Cebpa mRNA levels were 4-fold higher and Ebf1 mRNA levels were 14-fold higher in hCD4+ compared with hCD4- CLP, supporting the idea that C/EBPα directly activates the Ebf1 gene in a subset of CLP.

thumbnail
Download:
Fig 3. Cebpa and Ebf1 mRNA are both increased in hCD4+ versus hCD4- CLP from Cebpa +37 kb Enh/Prom-hCD4 transgenic mice.

A) Lin-Sca-1intc-kitintIL7Rα+ CLP from Cebpa Enh/Prom-hCD4 mice were sorted into hCD4+ and hCD4- subsets. Representative flow cytometry analysis prior to sorting is shown. B) Sorted hCD4+ and hCD4- CLP from three mice were pooled and then analyzed qRT-PCR for expression of Cebpa and Ebf1.

https://doi.org/10.1371/journal.pone.0244161.g003

We next analyzed available ChIP-Seq data [28, 29] for histone marks at the murine Ebf1 locus in Flt3+ CLP and GMP, and also for C/EBPα binding in GMP (Fig 4). The murine Ebf1 gene is expressed from two promoters [30], as confirmed by the H3K4me3 profile. Presence of both H3K4me1 and H3K27Ac spanning exons 7–9 in CLP indicates existence of active Ebf1 enhancers centered at approximately +270 kb and +280 kb. In GMP, H3K4me1 marks are still evident at reduced levels in the Ebf1 enhancer region, and H3K27Ac is absent, suggesting somewhat accessible but inactive chromatin. Three C/EBPα ChIP-Seq peaks are seen in GMP in this region (α1, α2, and α3), and the underlying genomic regions contain blocks of sequence conserved in the human EBF1 gene, perhaps providing a clue as to relevant C/EBPα-binding sites in CLP.

thumbnail
Download:
Fig 4. H3K4me3, H3K4me1, and H3K27Ac histone marks at the Ebf1 locus in CLP and GMP and C/EBPα binding within the Ebf1 gene in GMP.

ChIP-Seq data [28, 29] was visualized with IVG2.0 software (Broad Institute). The region between exon 7 and exon 9 is expanded for a subset of these data. The locations of the two Ebf1 promoters (P1, P2), potential +270 kb and +280 kb Ebf1 enhancers (yellow bars), C/EBPα binding peaks in GMP (α1, α2, and α3), and regions between exon 7 and exon 9 conserved between the murine and human Ebf1 loci (black bars) are indicated.

https://doi.org/10.1371/journal.pone.0244161.g004

We identified DNA elements in each of these regions that match or nearly match the C/EBPα consensus site and are 100% conserved in the human EBF1 locus. These sites, in the context of 30–33 bp double-stranded enhancer sequences, were radio-labeled to similar specific activity and subjected to gel shift assay using nuclear extract from 293T cells transiently transfected with CMV-C/EBPα (Fig 5A, left). C/EBPα interacted with the α3 site strongly and the α2 site very weakly. We also performed a competition assay in which a consensus C/EBPα site from the neutrophil elastase (NE) promoter was radio-labelled and subject to gel shift assay with C/EBPα combined with either no competitor or a 25-fold excess of unlabeled NE, α1, α2, or α3 probes (Fig 5A, right). The NE and α3 oligonucleotides competed strongly with the NE probe, the α2 site competed weakly, and the α1 site did not compete for C/EBPα binding.

thumbnail
Download:
Fig 5. C/EBPα binds a consensus site within the +280 kb Ebf1 enhancer region.

A) Double-stranded oligonucleotides containing sites within the α1, α2, and α3 regions that are conserved in the human EBF1 gene and match or nearly match the C/EBPα consensus binding site were radio-labelled and subjected to gel shift assay using nuclear extracts from 293T cells transiently transfected with CMV-C/EBPα (left). A C/EBPα-binding site from the NE promoter was radio-labelled and subjected to gel shift assay in the absence of competitor or in the presence of 25-fold excess unlabeled NE-C/EBP, Ebf1-α1, Ebf1-α2, or Ebf1-α3 competitor oligonucleotides (right). The location of the gel shift species containing C/EBPα is shown, as is the C/EBPα consensus sequence and the sequence of the predicted α1, α2, and α3 binding sites. B) 5 x 105 preproB cells flow-sorted from five wild-type mice were subjected to ChIP for C/EBPα binding in the vicinity of the Ebf1 +270/280 kb enhancer α1, α2, and α3 peaks, as quantified by dividing fold-enrichment of genomic DNA obtained with rabbit anti-C/EBPα monoclonal antibody versus normal rabbit IgG (left). 106 32Dcl3 myeloid cells per reaction were analyzed similarly for binding of C/EBPα at the Pu.1 -14 kb enhancer (right).

https://doi.org/10.1371/journal.pone.0244161.g005

To evaluate binding of endogenous C/EBPα in the vicinity of the α1, α2, and α3 sites, we performed ChIP. As preproB are more abundant than CLP and express C/EBPα, we flow sorted this population from five wild-type mice and obtained 106 cells, which we divided evenly between C/EBPα antibody and normal rabbit IgG. As a positive control we conducted ChIP for C/EBPα interaction with the Pu.1 -14 kb enhancer [31] using 106 32Dcl3 murine myeloid cells per reaction (Fig 5B). Binding of C/EBPα at the endogenous α2 and α3 sites in preproB cells was detected, with binding highest at the α3 site. Presence of cells in the preproB population that express little C/EBPα, including plasmacytoid dendritic cells [27, 32], may reduce evident affinity.

Alignment of the nucleotide sequence of the 350 bp Ebf1 +280 kb enhancer region that contains the α3 C/EBPα-binding site with the corresponding region from the human EBF1 gene reveals that these DNA regions are 78% identical (Fig 6A). The 350 bp murine enhancer segment, or a variant containing point mutations in the α3 site, were positioned upstream of a minimal herpes simplex virus TK promoter, consisting only of a TATAA box and transcription start site, and these were placed upstream the luciferase cDNA, as diagramed (Fig 6B, top). TK-Luc, Ebf1-TK-Luc, and mEbf1-TK-Luc reporters were transiently transfected into 293T cells with CMV or CMV-C/EBPα plasmids; CMV-βGal served as an internal control. Two days later, cell extracts were assayed for luciferase and β-galactosidase activity. C/EBPα activated the Ebf1-TK-Luc reporter 8-fold and the mutant mEbf1-TK-Luc reporter 2-fold, on average, compared to its activation of TK-Luc (Fig 6B). These data support the conclusion that C/EBPα binds and activates the Ebf1 gene, at least in part via the α3 site located in its +280 kb enhancer region.

thumbnail
Download:
Fig 6. C/EBPα activates an Ebf1 +280 kb enhancer region via a conserved C/EBPα-binding site.

A) The sequence of a conserved region within the murine (M) Ebf1 gene containing the α3 C/EBPα-binding site is aligned with the corresponding region from the human (H) EBF1 gene. The location of the conserved α3 site is shown. B) The TK-LUC, Ebf1-TK-Luc, and mEbf1-TK-Luc reporters are diagrammed. The sequence of the mutant α3 site, with altered bases underlined, present in the mEbf1-TK-Luc reporter is shown (top). 293T cells were transfected with luciferase reporter plasmids, CMV or CMV-C/EBPα, and CMV-βGal in 24 well plates. Two days later, cell extracts were subjected to luciferase and β-galactosidase assays. Reporter activity was calculated as luciferase/βGal activity, and activation by C/EBPα was calculated by dividing activity obtained with CMV-C/EBPα by that obtained with CMV. Activation of Ebf1-TK-Luc and mEbf1-TK-Luc by C/EBPα, relative to activation of TK-Luc, is shown (mean and SD from six determinations).

https://doi.org/10.1371/journal.pone.0244161.g006

Discussion

We previously found that pan-hematopoietic deletion of the +37 kb Cebpa enhancer leads to a profound reduction (greater than 15-fold) in proB, early preB and preB cells, whereas deletion of the enhancer using Mb1-Cre at the proB stage has no effect [11]. We now find that deletion of the Cebpa enhancer at the CLP stage of B lymphopoiesis using IL7Rα-Cre leads to ~2-fold reduction in preproB and proB cells and ~3-fold reduction in preB cells, along with 2.4-fold reduced Ly6D+ CLP, without inducing the reduced GMP and increased LMPP evident in Enh(f/f);Mx1-Cre mice exposed to pIpC. We demonstrated that IL7Rα-Cre deletes the stop codon in R26-LSL-YFP to enable YFP expression in 65% of multi-potent Ly6D- CLP and in 89% of largely B-lineage-restricted Ly6D+ CLP. The kinetics of enhancer deletion by IL7Rα-Cre in CLP, which in one setting required two days to reach maximal effect [22], may allow C/EBPα to induce key target genes prior to Cebpa enhancer deletion in a subset B lineage progenitors, reducing the consequence for downstream B lymphocyte precursor formation. Furthermore, constitutive enhancer deletion by IL7Rα-Cre beginning even before birth may engender compensatory mechanisms not operative four weeks after Mx1-Cre-mediated enhancer deletion in adult mice. Nevertheless, the B lineage defect observed in Cebpa Enh(f/f);IL7Rα-Cre mice confirms our prior findings obtained using Cebpa Enh(f/f);Mx1-Cre and localizes a key point of B lineage regulation by C/EBPα to the CLP stage. IL7Rα-Cre-mediated enhancer deletion also demonstrates that the observed defects in B cell development are not simply an indirect consequence of the reduced GMP or expanded LMPP seen in Enh(f/f);Mx1-Cre mice. Notably, decreased numbers of marrow proB, early preB, and pre B cells were not evident upon Cebpa enhancer deletion using Rag1-Cre mice, likely reflecting the reduced propensity for R26-LSL-YFP activation by Rag1-Cre compared with IL7Rα-Cre in CLP.

Analysis of our previous microarray gene expression data reveals 4-fold reduced Ebf1 in preproB cells consequent to Cebpa enhancer deletion, without changes in the expression of RNAs encoding several other transcription factors that mediate B lymphopoiesis. We have now extended this observation by demonstrating a striking, 25- to 50-fold reduction of Ebf1 in CLP upon Cebpa enhancer deletion, without effects on Pu.1, Izkf1, E2A, Foxo1, or Bach2. The level of Pax5, a key downstream target of Ebf1 during B lymphopoiesis [19], was reduced, although its low-level expression in CLP may render the apparent degree of reduction inaccurate. Lack of Foxo1 reduction despite prior evidence for an EBF1:FOXO1 positive feedback loop [17] indicates that other transcription factors besides EBF1, e.g. E2A or Bach2 [20, 33], are sufficient to induce and maintain Foxo1 expression in CLP. Rag1 requires whereas IL7Rα precedes EBF1 expression [34, 35], consistent with our finding that deletion of the +37 kb Cebpa enhancer using IL7Rα-Cre, but not Rag1-Cre, induces a deficiency in downstream B lineage progenitors. Our finding that CLP that express a +37 kb Cebpa enhancer/promoter-hCD4 reporter are enriched for both Cebpa and Ebf1 mRNAs, by 4- and 14-fold respectively, further supports the idea that C/EBPα induces EBF1 expression in CLP to contribute to B lymphopoiesis.

The Ebf1 gene has two promoters separated by 4.4 kb, with the distal promoter activated by STAT5, E2A, and EBF1 and the proximal promoter by ETS1, PAX5, and PU.1 [30]. These promoter regions do not contain DNA elements predicted to bind C/EBPα. We therefore examined available histone mark ChIP-Seq data and identified regions centered at +270 kb and +280 kb that have a pattern of H3K4me1 and H3K27Ac marks in CLP consistent with the presence of active enhancers. These putative intronic Ebf1 enhancers contain blocks of sequence conserved between the murine and human loci, and we identified a conserved DNA element within one of these regions that binds C/EBPα strongly in gel shift assay. In addition, endogenous C/EBPα in preproB cells binds this region, and mutation of this cis element in the context of an Ebf1 luciferase reporter reduces trans-activation by C/EBPα 4-fold. These data support the conclusion that C/EBPα directly induces Ebf1 gene expression.

EBF1 binds palindromic DNA sites as a homodimer via a zinc knuckle domain [36, 37]. Mice lacking EBF1 retain preproB but have a profound proB cell deficiency, with B220+ B cells lacking immunoglobulin gene rearrangements and expression of multiple proB genes, including Pax5, Mb1, Rag1, and Rag2, with normal IL7Rα levels and no defects in non-hematopoietic tissues that express EBF1 [35]. Exogenous expression of EBF1 in hematopoietic stem and progenitor cells directs B cell development in vivo at the expense of T, myeloid, dendritic, and NK cell formation [38]. Mice lacking E2A display a similar block in proB formation, and transduction of E2A-null fetal liver hematopoietic progenitors with Ebf1 but not Pax5 rescues in vitro B cell generation [39]. Ebf1 also rescues B lymphopoiesis in Pu.1-deficient fetal liver progenitors [40], further supporting its role as a master regulator of B cell development. In addition, EBF1 suppresses Cebpa and Tcf7 expression within progenitors committed to B lymphopoiesis, preventing their induction of myeloid or T lineage genes [41, 42].

Recent findings indicate that GFRA2 surface expression subdivides Ly6D+ CLP into a GFRA2- population without B cell potential and a GFRA2+ population having B and T cell potential, with formation of the GFRA2+ subset dependent on EBF1 [43]. Quantitative evaluation of RNA-seq data from this study indicates that Cebpa levels decrease 70-fold (p = 0.08) comparing Ly6D- with Ly6D+GFRA2+ CLP, whereas Ebf1 levels increase 5.9-fold (p<0.001) as Ly6D- CLP progress to Ly6D+GFRA2- CLP, and then a further 5.8-fold (p<0.001) as this population progresses to Ly6D+GFRA2+ CLP (Fig 7A), indicating that Cebpa expression precedes Ebf1 induction in these CLP populations and then decreases.

thumbnail
Download:
Fig 7. Cebpa and Ebf1 expression in CLP subsets and a model for the role of C/EBPα in B lineage development.

A) Average RNA-seq reads per million mapped reads [43] from Ly6D- (n = 6), Ly6D+GFRA2- (n = 4), and Ly6D+GFRA2+ (n = 3) CLP, with the mean values for Ebf1 and Cebpa in Ly6D- CLP set to 1.0, are shown. One Ebf1 outlier value in Ly6D- CLP was excluded. Standard deviations are shown as +/- values. B) PU.1, IKAROS, and C/EBPα act in LMPP to prime Ebf1 and other B lineage genes and, with FL, direct formation and expansion of Ly6D- CLP, which retain T, NK, DC, and B lineage potential. E2A and IL-7 then direct formation and expansion of Ly6D+ CLP, wherein C/EBPα directly induces Ebf1 gene expression. EBF1 activates FOXO1 and PAX5 to direct proB formation and downstream B lineage development while repressing Cebpa expression to suppress myelopoiesis. Under the influence of myeloid cytokines, C/EBPα levels increase in LMPP and together with PU.1 directs GMP formation and myeloid lineage development. High levels of C/EBPα may also inhibit Pax5 expression to suppress B lymphopoiesis in committed myeloid progenitors.

https://doi.org/10.1371/journal.pone.0244161.g007

Single-cell (sc) RNAseq analysis of the Lin-c-kit+ subset of murine marrow reveals a continuum of progenitor cell states that cluster into populations that include quiescent stem cells and unilineage progenitors, as well as a substantial number of cells that express both lymphoid and myeloid markers (e.g Flt3 and Mpo); scRNASeq analysis of human marrow progenitors reveals a similar bipotent lymphoid-myeloid subset [44, 45]. While our data indicate that C/EBPα acts, at least in part, in CLP to induce Ebf1, C/EBPα may play an additional role in earlier bipotent or multipotent progenitors, e.g. to prime Ebf1 for activation by other regulators. Based on our results and prior findings we propose a model for the role of C/EBPα in B lymphopoiesis (Fig 7B). In this model, C/EBPα, PU.1, and IKAROS prime Ebf1 and additional B lineage genes in LMPP for later activation and induce progression to the Ly6D- CLP stage. E2A and IL-7 then generate Ly6D+ CLP wherein C/EBPα together with PU.1 and E2A induce Ebf1 gene transcription. EBF1 then enters into a positive feedback loop with FOXO1 and PAX5 to generate proB cells. While Flt3 ligand (FL) and IL-7 signaling may contribute to commitment decisions, e.g. via STAT5 activation, recent findings indicate that they may largely provide proliferative and survival signals [46]. Under the influence of myeloid cytokines, C/EBPα levels increase in LMPP and enter into a positive feedback loop with PU.1 to specify GMP formation [8, 30, 47]. Finally, high levels of C/EBPα may suppress PAX5 to inhibit B lymphopoiesis in committed myeloid progenitors as expression of exogenous C/EBPα in CLP induces their myeloid conversion, with marked PAX5 down-modulation [48].

Supporting information

S1 Fig. Original autoradiograph image used to generate Fig 5A.

https://doi.org/10.1371/journal.pone.0244161.s001

(PDF)

S2 Fig. Flt3+ CLP numbers do not change in response to Mx1-Cre-mediated Cebpa +37 kb enhancer deletion.

Data obtained from Enh(f/f) and Enh(f/f);Mx-Cre mice exposed four weeks earlier to pIpC [11] was re-evaluated for the number of Ly6D- CLP, Ly6D+ CLP, and Lin-Sca-1intc-kitintIL7Rα+Flt3- cells (designated as Flt3- CLP) in bone marrow from bilateral leg and hip bones (mean and SD from three determinations).

https://doi.org/10.1371/journal.pone.0244161.s002

(TIF)

S3 Fig.

YFP expression in marrow subsets from Enh(f/f);IL7Rα-Cre;R26-LSL-YFP and Enh(f/f);Rag1-Cre;R26-LSL-YFP mice. A) Representative flow cytometry to identify LMPP and CLP subsets from an Enh(f/f);IL7Rα-Cre;R26-LSL-YFP mouse. B) Representative flow cytometry to identify preproB, proB, early preB, and preB marrow cells from an Enh(f/f);IL7Rα-Cre;R26-LSL-YFP mouse. C) Representative flow cytometry evaluating YFP expression in these marrow subsets from Enh(f/f);IL7Rα-Cre;R26-LSL-YFP and Enh(f/f);Rag1-Cre;R26-LSL-YFP mice.

https://doi.org/10.1371/journal.pone.0244161.s003

(TIF)

S4 Fig. Cebpa +37 kb enhancer deletion using Mx1-Cre does not affect Pu.1 levels in LMPP.

LMPP from Experiment 2, as described in Fig 2, were analyzed using qRT-PCR for Pu.1 expression.

https://doi.org/10.1371/journal.pone.0244161.s004

(TIF)

Acknowledgments

We thank Terence Rabbitts for Rag1-Cre mice and Hans-Reimer Rodewald for IL7Rα-Cre mice.

References

  1. 1. Birkenmeier EH, Gwynn B, Howard S, Jerry J, Gordon JI, Landschulz WH, et al. Tissue-specific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding protein. Genes Dev. 1989; 3: 1146–1156. pmid:2792758
  2. 2. Scott LM, Civin CI, Rorth P, Friedman AD. A novel temporal pattern of three C/EBP family members in differentiating myelomonocytic cells. Blood 1992; 80: 1725–1735. pmid:1391942
  3. 3. Flodby P, Barlow C, Kylefjord H, Ahrlund-Richter L, Xanthopoulos KG. Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein. J. Biol. Chem. 1996; 271: 24753–24760. pmid:8798745
  4. 4. Zhang DE, Zhang P, Wang N-D, Hetherington CJ, Darlington GJ, Tenen DG. Absence of G-CSF signaling and neutrophil development in CCAAT enhancer binding protein α-deficient mice. Proc. Natl. Acad. Sci. USA 1997; 94: 569–574. pmid:9012825
  5. 5. Zhang P, Iwasaki-Arai J, Iwasaki H, Fenyus ML, Dayaram T, Owens BM, et al. Enhancement of hematopoietic stem cell repopulating capacity and self-renewal in the absence of the transcription factor C/EBPα. Immunity 2004; 21: 853–863. pmid:15589173
  6. 6. Guo H, Ma O, Speck NA, Friedman AD. 2012. Runx1 deletion or dominant inhibition reduces Cebpa transcription via conserved promoter and distal enhancer sites to favor monopoiesis over granulopoiesis. Blood 2012; 119: 4408–4418. pmid:22451420
  7. 7. Guo H, Ma O, Friedman AD. The Cebpa +37 kb enhancer directs transgene expression to myeloid progenitors and to long-term hematopoietic stem cells. J. Leuk. Biol. 2014; 96: 419–426.
  8. 8. Cooper S, Guo H, Friedman AD. The +37 kb Cebpa enhancer is critical for Cebpa myeloid gene expression and contains functional sites that bind SCL, GATA2, C/EBPα, PU.1, and additional Ets factors. PLoS One 2015; 10: e0126385. pmid:25938608
  9. 9. Guo H, Cooper C, Friedman AD. In vivo deletion of the Cebpa +37 kb enhancer markedly reduces Cebpa mRNA in myeloid progenitors but not in non-hematopoietic tissues to impair granulopoiesis. PLoS One 2016; 11: e0150809. pmid:26937964
  10. 10. Avellino R, Havermans M, Erpelinck C, Sanders MA, Hoogenboezem R, van de Werken HJ, et al. An autonomous CEBPA enhancer specific for myeloid-lineage priming and neutrophilic differentiation. Blood 2016; 127: 2991–3003. pmid:26966090
  11. 11. Guo H, Barberi T, Suresh R, Friedman AD. Progression from the common lymphoid progenitor to B/myeloid preproB and proB precursors during B lymphopoiesis requires C/EBPα. J. Immunol. 2018; 201: 1692–1704. pmid:30061199
  12. 12. Adolfsson J, Månsson R, Buza-Vidas N, Hultquist A, Liuba K, Jensen CT, et al. Identification of Flt3+ lympho-myeloid stem cells lacking erythro-megakaryocytic potential a revised road map for adult blood lineage commitment. Cell 2005; 121: 295–306. pmid:15851035
  13. 13. Inlay MA, Bhattacharya D, Sahoo D, Serwold T, Seita J, Karsunky H, et al. Ly6d marks the earliest stage of B-cell specification and identifies the branchpoint between B-cell and T-cell development. Genes Dev. 2009; 23: 2376–2381. pmid:19833765
  14. 14. Pang SHM, de Graaf CA, Huntington ND, Carotta S, Wu L, Nutt SL. PU.1 is required for the developmental progression of multipotent progenitors to common lymphoid progenitors. Front. Immunol. 2018; 9: 1264. pmid:29942304
  15. 15. Yoshida T, Ng SYM, Zuniga-Pflucker JC, Georgopoulos. Early hematopoietic lineage restrictions directed by Ikaros. Nat. Immunol. 2006; 7: 382–391. pmid:16518393
  16. 16. Dias S, Mansson R, Gurbuxani S, Sigvardsson M, Kee BL. E2A proteins promote development of lymphoid-primed multipotent progenitors. Immunity 2008; 29: 217–227. pmid:18674933
  17. 17. Mansson R, Welinder E, Ahsberg J, Lin YC, Benner C, Glass CK, et al. Positive intergenic feedback circuitry, involving EBF1 and FOXO1, orchestrates B-cell fate. Proc. Natl. Acad. Sci. USA 2012; 109: 21028–21033. pmid:23213261
  18. 18. Vilagos B, Hoffmann M, Souabni A, Sun Q, Werner B, Medvedovic J, et al. Essential role of EBF1 in the generation and function of distinct mature B cell types. J. Exp. Med. 2012; 209: 775–792. pmid:22473956
  19. 19. Decker T, Pasca di Magliano M, McManus T, Sun Q, Bonifer C, Tagoh H, et al. Stepwise activation of enhancer and promoter regions of the B cell commitment gene Pax5 in early lymphopoiesis. Immunity 2009; 30: 508–520. pmid:19345119
  20. 20. Itoh-Nakadai A, Matsumoto M, Kato H, Sasaki J, Uehara Y, Sato Y, et al. A Bach2-Cebp gene regulatory network for the commitment of multipotent hematopoietic progenitors. Cell Rep. 2017; 18: 2401–2414. pmid:28273455
  21. 21. Welner RS, Esplin BL, Garrett KP, Pelayo R, Luche H, Fehling HJ, et al. Asynchronous RAG-1 expression during B lymphopoiesis. J. Immunol. 2009; 183: 7768–7777. pmid:20007571
  22. 22. Schlenner SM, Madan V, Busch K, Tietz A, Läufle C, Costa C, et al. Fate mapping reveals separate origins of T cells and myeloid lineages in the thymus. Immunity 2010; 32: 426–436. pmid:20303297
  23. 23. Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, et al. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus BMC Dev. Biol. 2001; 1: 4. pmid:11299042
  24. 24. Oelgeschlager M, Nuchprayoon I, Luscher B, Friedman AD. C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol. Cell. Biol. 1996; 16: 4717–4725. pmid:8756629
  25. 25. Paz-Priel I, Ghosal AK, Kowalski J, Friedman AD. C/EBPα or C/EBPα oncoproteins regulate the intrinsic and extrinsic apoptotic pathways by direct interaction with NF-κB p50 bound to the bcl-2 and FLIP gene promoters. Leukemia 2009; 23: 365–374. pmid:18987666
  26. 26. Valtieri M, Tweardy DJ, Caracciolo D, Johnson K, Mavilio F, Altmann S, et al. Cytokine-dependent granulocytic differentiation. Regulation of proliferative and differentiative responses in a murine progenitor cell line. J Immunol. 1987; 138: 3829–3835. pmid:2438328
  27. 27. Welner RS, Bararia D, Amabile G, Czibere A, Benoukraf T, Bach C, et al. C/EBPα is required for development of dendritic cell progenitors. Blood 2013; 121: 4073–4081. pmid:23547051
  28. 28. Lara-Astiaso D, Weiner A, Lorenzo-Vivas E, Zaretsky I, Jaitin DA, David E, et al. Chromatin state dynamics during blood formation. Science 2014; 345: 943–949. pmid:25103404
  29. 29. Collins C, Wang J, Miao H, Bronstein J, Nawer H, Xu T, et al. C/EBPα is an essential collaborator in Hoxa9/Meis1-mediated leukemogenesis. Proc. Natl. Acad. Sci. USA 2014; 111: 9899–9904. pmid:24958854
  30. 30. Roessler S, Gyort I, Imhof S, Spivakov M, Williams RR, Busslinger M, et al. Distinct promoters mediate the regulation of Ebf1 gene expression by interleukin-7 and Pax5. Mol. Cell. Biol. 2007; 27: 579–594. pmid:17101802
  31. 31. Yeamans C, Wang D, Paz-Priel I, Torbett BE, Tenen DG, Friedman AD. C/EBPα binds and activates the PU.1 distal enhancer to induce monocyte lineage commitment. Blood 2007; 110; 3136–3142. pmid:17671233
  32. 32. Medina KL, Tangen SN, Seaburg LM, Thapa P, Gwin KA, Shapiro VS. Separation of plasmacytoid dendritic cells from B-cell-biased lymphoid progenitor (BLP) and pre-pro B cells using PDCA-1. PLoS One 2013; 8: e78408. pmid:24205225
  33. 33. Lin YC, Jhunjhunwala S, Benner C, Heinz S, Welinder E, Mansson R, et al. A global network of transcription factors, involving E2A, EBF1, and Foxo1, that orchestrates B cell fate. Nat. Immunol. 2010; 11: 635–643. pmid:20543837
  34. 34. Tsapogas P, Zandi S, Ahsberg J, Zetterblad J, Welinder E, Jonsson JI, et al. IL-7 mediates Ebf-1-dependent lineage restriction in early lymphoid progenitors. Blood 2011; 118: 1283–1290. pmid:21652681
  35. 35. Lin H, Grosschedl R. Failure of B-cell differentiation in mice lacking the transcription factor Ebf1. Nature 1995; 376:263–267. pmid:7542362
  36. 36. Hagman J, Belanger C, Travis A, Turck CW, Grosschedl R. Cloning and functional characterization of early B-cell factor, a regulator of lymphocyte-specific gene expression. Genes Dev. 1993; 7: 760–773. pmid:8491377
  37. 37. Hagman J, Ramirez J, Lukin K. B lymphocyte lineage specification, commitment and epigenetic control of transcription by early B cell factor 1. Curr. Topics Microbiol. Immunol. 2012; 356: 17–38. pmid:21735360
  38. 38. Zhang Z, Cotta CV, Stephan RP, deGuzman CG, Klug CA. Enforced expression of EBF in hematopoietic stem cells restricts lymphopoiesis to the B cell lineage. EMBO J. 2003; 22: 4759–4769. pmid:12970188
  39. 39. Seet CS, Brumbaugh RL, Kee BL. Early B cell factor promotes B lymphopoiesis with reduced interleukin 7 responsiveness in the absence of E2A. J. Exp. Med. 2004; 199: 1689–1700. pmid:15210745
  40. 40. Medina KL, Pongubala JM, Reddy KL, Lancki DW, R. Dekoter R, Kieslinger M, et al. Assembling a gene regulatory network for specification of the B cell fate. 2004; Dev. Cell 7: 607–617. pmid:15469848
  41. 41. Pongubala JMR, Northrup DL, Lancki DW, Medina KL, Treiber T, Bertolino E et al. Transcription factor EBF restricts alternative lineage options and promotes B cell fate commitment independently of Pax5. Nat. Immunol. 2008; 9: 203–215. pmid:18176567
  42. 42. Nechanitzky R, Akbas D, Scherer S, Gyory I, Hoyler T, Ramamoorthy S, et al. Transcription factor EBF1 is essential for the maintenance of B cell identity and prevention of alternative fates in committed cells. Nat. Immunol. 2013; 14: 867–875. pmid:23812095
  43. 43. Jensen CT, Ahsberg J, Sommarin MNE, Strid T, Somasundaram R, Okuyama K, et al. Dissection of progenitor compartments resolves developmental trajectories in B-lymphopoiesis. J. Exp. Med. 2018; 215: 1947–1963. pmid:29899037
  44. 44. Giladi A, Paul F, Herzog Y, Lubling Y, Weiner A, Yofe I, et al. Single-cell characterization of haematopoietic progenitors and their trajectories in homeostasis and perturbed haematopoiesis. Nat. Cell. Biol. 2018; 20: 836–846. pmid:29915358
  45. 45. Karamitros D, Stoilova B, Aboukhalil Z, Hamey F, Reinisch A, Samitsch M, et al. Single-cell analysis reveals the continuum of human lympho-myeloid progenitor cells. Nat. Immunol. 2018; 19: 85–97. pmid:29167569
  46. 46. von Muenchow L, Alberti-Servera L, Klein F, Capoferri G, Finke D, Ceredig R, et al. Permissive roles of cytokines interleukin-7 and Flt3 ligand in mouse B-cell lineage commitment. Proc. Natl. Acad. Sci.USA 2016; 113: E8122–E8130. pmid:27911806
  47. 47. Jack GD, Zhang L, Friedman AD. M-CSF elevates c-Fos and phospho-C/EBPα(S21) via ERK whereas G-CSF stimulates SHP2 phosphorylation in marrow progenitors to contribute to myeloid lineage specification. Blood 2009; 114: 2172–2180. pmid:19587381
  48. 48. Hsu CL, King-Fleischman AG, Lai AY, Matsumoto Y, Weissman IL, Kondo M. Antagonistic effect of CCAAT enhancer-binding protein-α and Pax5 in myeloid or lymphoid lineage choice in common lymphoid progenitors. Proc. Natl. Acad. Sci. USA 2006; 103: 672–677. pmid:16407117