http://orcid.org/0000-0001-6844-6330
Figures
Abstract
In the past decade, two leptospirosis outbreaks occurred among strawberry harvesters in Germany, with 13, and 45 reported cases respectively. In both outbreaks, common voles (Microtus arvalis) infected with Leptospira kischneri serovar Grippotyphosa were identified as the most likely outbreak source. In an univariate analysis, eating unwashed strawberries was identified as one of the risk factors associated with Leptospira infection. The aim of this study was to evaluate the survival time of L. kirschneri serovar Grippotyphosa on strawberries under varying conditions. Strawberries were spiked with 5x109 of both a laboratory reference strain (strain Moskva V) and an outbreak field strain (94-6/2007) of L. kirschneri serovar Grippotyphosa sequence type 110. Survival times were investigated in a fully crossed design with three incubation times (2h, 4h, 6h and 8h) and three temperatures (15°C, 21°C and 25°C) with three replicated for each condition. A wash protocol was developed and recovered Leptospira were determined by qPCR, dark field microscopy and culturing. Viable L. kirschneri of both the reference strain and the field strain were identified in all samples at 25°C and an incubation time of 2h, but only 1/9 (11%) and 4/9 (44%) of the samples incubated at 15°C were positive, respectively. Both reference and field strain were viable only in 2/9 (22%) at 25° after 6h. After an 8h incubation, viable Leptospira could not be identified on the surface of the strawberries or within the fruit for any of the tested conditions. Based on these results, the exposure risk of consumers to viable Leptospira spp. through the consumption of strawberries bought at the retail level is most likely very low. However, there is a potential risk of Leptospira infection by consumption of strawberries on pick-your-own farms.
Citation: Tekemen D, Franz M, Bier NS, Richter M, Nöckler K, Luge E, et al. (2020) Survival time of Leptospira kirschneri on strawberries. PLoS ONE 15(8): e0237466. https://doi.org/10.1371/journal.pone.0237466
Editor: Adler R. Dillman, University of California Riverside, UNITED STATES
Received: April 24, 2020; Accepted: July 27, 2020; Published: August 13, 2020
Copyright: © 2020 Tekemen et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: This work is part of the project ‘Strengthening public health by understanding the epidemiology of rodent-borne diseases’ (RoBoPub) and was funded by the German Federal Ministry of Education and Research (BMBF) (01KI1721B). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Leptospirosis is a zoonotic disease, which occurs worldwide in both humans and animals [1, 2]. Pathogenic leptospires colonize the kidneys of animal hosts and are shed with the urine. Humans and animals are mostly infected through urine contaminated water or soil which come in contact with abrasions or cuts in the skin or mucous membranes [3]. The bacteria are able to cause a wide spectrum of variable clinical symptoms ranging from subclinical cases to life-threatening disease [4]. Depending on the infectious dose, the infecting serovar, the patient’s immune status and medical care given, case fatality rates in patients can reach > 50% [5].
Although the disease is considered rare in developed countries, low but persisting rates of autochthonous illness and case fatalities exist, with a suspected high underreporting rate [2, 6]. Historically, outbreaks of leptospirosis in Europe were associated with agricultural exposure [7]. In the past decades, recreational (e.g. water sports) and residential (e.g. gardening) related risk factors have increasingly gained importance and large outbreaks due to agricultural exposures have mostly disappeared. Yet recently, two agriculture-related leptospirosis outbreaks in 2007 and 2014 were documented among strawberry harvesters in Germany, with 13 and 45 reported cases, respectively [8, 9]. In both outbreaks, common voles (Microtus arvalis) infected with Leptospira kischneri serovar Grippotyphosa ST110 were identified as the most likely outbreak source. In an outbreak investigation, harvesting in the rain, contact with mud and rodents, the presence of hand lesions and consumption of unwashed strawberries were associated with an increased risk of infection [8].
The risk of infection after contact with any environmental source depends on the ability of Leptospira bacteria to survive and persist in the environment [10]. The described outbreak investigation led to the question if Leptospira spp. can survive long enough on strawberries to pose a public health risk. Therefore, the aim of this study was to evaluate the survival times of L. kirschneri serovar Grippotyphosa on strawberries under varying temperature conditions.
Materials and methods
Bacterial strains and cultivation
Both a laboratory (strain Moskva V) and a field strain (94-6/2007) of L. kirschneri serovar Grippotyphosa sequence type 110 were used in this study. The field strain 94-6/2007 was isolated during a leptospirosis outbreak among strawberry harvesters in 2007 from a common vole (Microtus arvalis) trapped on the strawberry fields of the affected strawberry farm. During dissection of the animal the entire kidney was collected for isolation of Leptospira spp. The kidney was minced using a scalpel, transferred to liquid Ellinghausen McCullough Johnson Harris medium (EMJH, DifcoTM, Michigan, USA) supplemented with 0.1% 5-fluorouracil (5Fu, w/v) and 2% rabbit serum (v/v), incubated aerobically at 29 ± 1° C and examined under a dark-field microscope for the presence of Leptospira over a period of 4 weeks weeks. Strain identity was confirmed by secY sequencing [11] and multi locus sequence typing according to scheme 1 [12].
For the spiking experiments, the strains were grown in 100 ml EMJH medium at 29 ± 1°C for seven days to reach a concentration of approximately 109 cells/ml. For harvesting, the cell suspensions were centrifuged at 10,000 x g for 40 minutes at room temperature and the cell pellets were resuspended in 1 ml of filtered rainwater (0.2 μm, cellulose acetate). Rainwater was chosen for bacterial dilution, as it is a natural water source. Cells were counted in a cell counting chamber (Thoma, depth 0.02 mm) and the suspensions were adjusted to 5x1010 cells/ml with rainwater.
Preparation of strawberries for spiking
For each experiment, fresh strawberries (Fragaria x ananassa ‘Sonata’, grown in Rövershagen, Germany) were obtained from local retailers on farmers markets in Steglitz, Lankwitz and Wedding, Berlin. After elimination of the carpels using scissors, the strawberries were washed under flowing distilled water, treated with UV light for 30 minutes to eliminate other microorganisms and left to dry. During the drying period, strawberries were turned every 10 minutes.
Spiking and incubation of Leptospira on strawberries
Each strawberry was spiked with a total of 5x109 bacteria by pipetting 100 μl of the cell suspension (5x1010 cells/ml) on 10 different spots of the strawberry surface. Spiked strawberries were incubated at different incubation times (2h, 4h, 6h and 8h) at 15°C, 20°C or 25°C. The selected temperatures are based on the average minimum and maximum summer temperatures in Germany.
To guarantee a constant humidity during incubation, a small container with water was left in the incubator and the humidity was monitored constantly using a data logger (LOG32, ED, European Distribution Company, Grezzago, Italy). On each spiking day, 12 strawberries were spiked and incubated with one temperature: three strawberries were examined after two hours, three after four hours, three after six hours and the final three after eight hours. On the following days, the same procedure was repeated with further incubation temperatures.
To verify that the leptospires do not actively enter the strawberries, the fruits were spiked in triplicate (5x109 cells), homogenized after an eight-hour incubation time according to protocol B and the resulting suspension was tested for viable Leptospira by culture (see below).
Development of a protocol for the efficient removal of Leptospira from the strawberry surface
In order to verify that the spiked bacteria could be retrieved from the strawberries during the survival experiments, two protocols (A and B) were compared and evaluated.
Protocol A: Spiked strawberries were carefully transferred into 300 ml Erlenmeyer flasks with 100 ml freshly prepared EMJH medium supplemented with 0.1% 5Fu (w/v) and incubated on an orbital shaker at 100 rpm for 10 minutes to remove the bacteria from the strawberries.
Protocol B: The spiked strawberries were carefully transferred in Interscience filter-bags XR 400 (400 ml max. blending volume, 280 microns filter porosity), with 100 ml freshly prepared EMJH medium supplemented with 0.1% 5Fu (w/v) and homogenized using the BagMixer® 400 P (Interscience, Paris, France) for 1 minute with a speed of 7 strokes per second.
In the resulting suspensions of both protocols a maximum concentration of 5x107 bacteria/ml was expected. For comparison of both protocols, the recovery rate was determined by quantifying the number of Leptospira using direct microscopy with a cell counting chamber and qPCR as endpoint.
To estimate the maximum possible recovery, 5x109 bacteria were transferred in triplicates directly into the medium in either the stomacher bags or the Erlenmeyer flasks without any strawberries, respectively. These reference samples were examined directly after spiking by direct microscopy and qPCR. The recovery rate for each protocol was calculated as ratio between the number of detected Leptospira in the sample and the reference sample.
Detection of Leptospira spp.
DNA extraction and qPCR.
To estimate the recovery rate of the bacteria from protocol A or B, 1 ml of the resulting suspensions were centrifuged at 10,000 x g for 40 min and DNA was extracted from the pellet using the DNeasy Blood and KitQIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. For detection of leptospiral DNA, qPCR targeting a partial sequence (242 bp) of the lipl32 gene was used, which encodes a 32-kDa leptospiral major outer membrane lipoprotein [13]. The qPCR reaction was set up using the PerfeCTa qPCR ToughMix UNG L-ROX Mastermix (QuantaBio, Beverly, USA), 0.5 μM of primer lipL32-45F (AAGCATTACCGCTTGTGGTG) [14] and lipL32-286Rb (GAACTCCCATTTCAGCGAT) [15] 0,1μM of a sequence-specific TaqMan probe (FAM-5´-AA AGC CAG GAC AAG CGC CG-3´-BHQ) [14] and 5 μL template DNA). Thermal cycling was carried out with the 7500 real-time PCR system (Applied Biosystems, USA). The following amplification protocol was performed: a pre-incubation step at 50°C for 2 min, initial denaturation at 95°C for 10 min, followed by 45 cycles of amplification at 95°C for 15 s and 60°C for 60 s. For bacterial quantification, a standard curve utilising a 10-fold serial dilution of leptospiral DNA (L. interrogans Serovar icterohaemorrhagiae strain RGA, 106–101 genome equivalents/PCR) was generated by plotting the quantification cycles (Cq) of the serial dilution against the log of the template concentration. The corresponding regression line was used to determine the concentration of unknown samples from their Cq-values.
After spiking the strawberries with 5x109 cells/ml, a maximum number of 4,2x106 genome equivalents (GE) were expected in the qPCR reaction.
Quantification by dark field microscopy.
Viable bacteria were counted using dark field microscopy and a cell counting chamber (Thoma, depth 0.02 mm). 20 small squares in a row were counted and the number of cells/μl was determined using the formula: counted cells x dilution factor x 1000μl/ depth of a cell (0.02 mm) x square of a cell (0.0025 mm2) x number of counted cells.
Detection of viable Leptospira kirschneri by dark field microscopy and culture.
For both strains a qualitative assessment was performed where a trial was determined as positive, when a single motile Leptospira was detected in the washing solution by dark field microscopy. Quantification of motile bacteria was only assessed with the Leptospira reference strain. In this case, the median number of motile bacteria was calculated if more than one replicate sample per time point and temperature contained live bacteria. The ratio between the median number of viable bacteria in the sample and a reference (5x109 Leptospira spiked in triplicate into the Erlenmeyer flasks without any strawberries and examined directly by direct microscopy) was determined.
Additionally, cultures were prepared for both strains by inoculating 4 ml EMJH medium supplemented with 0.1% 5Fu (w/v) with 0.4 ml of the recovered suspensions. Cultures were examined using dark field microscopy after 24 hours and thereafter every 7 days for 4 weeks to detect motile bacteria. After four weeks, most cultures were overgrown by accompanying bacterial flora and could not be further examined.
Statistical analysis
To determine how variations in temperature, strain and incubation time affected the survival of the pathogens, a generalized linear mixed model with a binomial error distribution was used. Survival as a binary variable was included as response. As fixed effects the following predictors were included: temperature and incubation time as continuous variables and strain as a categorical variable. In addition, the trial number and the replicate number of each trial were included as nested random effects. The analysis was conducted in the statistical software R [16] using the package lme4 [17].
Results
Evaluation of bacterial recovery protocols A and B
Washing the strawberries in flasks (protocol A) showed the highest recovery of 3.1x106 GE/ml (94% compared to the reference sample) by quantification using qPCR and 4.6x107 cells/ml (99%) using microscopy (Fig 1). In contrast, using the homogenization protocol B, a recovery of only 8.6x105 GE/ml (51%) was estimated by qPCR and 1.6x107 cells/ml (36%) by cell counting (Fig 1). In addition to the lower recovery rates, which could be due to inhibitory factors found in the homogenized fruits, the visual examination under the microscope was more challenging after homogenization due to strawberry residues in the samples.
Recovery of Leptospira kirschneri from strawberries using the washing protocol (protocol A) and the homogenization protocol (protocol B) after spiking 5x109 leptospires on the strawberry surface. Examination of bacterial recovery with qPCR (A) and by microscopy (B). The recovery rate was calculated as the ratio between the number of detected bacteria in the sample and the reference sample. The black line shows the expected number of genome equivalents 4,2x106 genome equivalents (GE) (A) or 5x107 bacteria/ml (B) in the final sample.
Based on these results, protocol A was chosen for all further experiments in the present study.
Quantification of viable Leptospira kirschneri
At 15°C only one replicate was countable after two hours incubation time, indicating a 4% survival (2x106 bacteria/ml) in comparison to the reference sample (4.8x107 bacteria/ml). In contrast, on average 8% (2.8x106 bacteria/ml, 6/9 replicates positive) and on average 25% (1.2x107 bacteria/ml, 9/9 replicates positive) of Leptospira survived at 21°C (reference sample 4.8x107 cells/ml) and 25°C (reference sample 4.6x107 cells/ml), respectively.
Survival of Leptospira kirschneri on strawberries
All replicates showing viable Leptospira during microscopy yielded positive cultures, but viable bacteria were only detected by direct microscopy in 22/35 (63%) of culture positive samples. Due to the higher sensitivity of the culture method, all statistical analyses were based on the results of this method. We did not find any indication for a statistically significant difference between both strains (z = 0, p = 1). However, the leptospiral survival significantly decreased with increasing incubation time (z = -7.01, p<0.001) and significantly increased with increasing temperature (z = 4.10, p<0.001) (Fig 2). The highest survival of 100% was observed for the conditions of 2h incubation time with 21 and 25°C for both strains. The lowest survival of 0% was observed for all conditions of 8h incubation time.
Ratios in the cells depict the number of culture positive replicates per total number of replicates.
Discussion
Currently, there is a very limited knowledge about the persistence of pathogenic leptospires in the environment [10]. Yet, the pathogen's ability to survive and remain infectious is critical to determine the risk of transmission to a host. The emergence of leptospirosis cases related to fieldwork on strawberry farms, and the fact that consumption of strawberries was considered a potential risk factor in an univariate regression analysis, prompted us to examine the survival of Leptospira on strawberries under controlled laboratory conditions.
Our findings indicate that the pathogenic strain L. kirschneri serovar Grippotyphosa cannot survive on strawberries for extended periods-of-time. Although bacterial survival increased with higher incubation temperatures, the pathogens only survived on the strawberries for a less than 8 hours, independent of temperature. The current study was performed under the assumption that strawberries dry during picking, packaging and transport. As described by Karaseva et al., [18] survival of Leptospira spp. in soil is positively correlated with the moisture of the soil [18]. This indicates that the reduction of moisture in any environment reduces leptospiral survival times and thus the risk of human infection.
Leptospiral survival studies have thus far only been performed for environmental matrices such as water, soil and mud. Once the pathogens are excreted into the environment, a multitude of factors such as pathogen species, temperature, pH-value, moisture, humidity, UV light, salt and mineral concentrations and the presence of other microorganisms affect survival [10, 19–21]. In soil, the reported survival times span from a few hours to 193 days [22–28]. In tap water, distilled water, sea- and river water different Leptospira species survived between a few hours and 20 months [21, 28–32]. In this study we could show that leptospiral survival significantly increased with increasing incubation temperatures. This corroborates the study from Fontaine et al., [32], who demonstrated that leptospiral survival is temperature dependent as the survival time increased from 130 days at 4°C to 263 days at 20°C and to 316 days at 30°C in fresh water [32].
The association of this disease with rain, temperature and extreme weather events is well established and mirrored in the frequency of leptospirosis outbreaks [10]. The majority of agricultural associated leptospirosis outbreaks in Central Europe were associated with temperatures > 18°C, heavy rains and water puddles on the fields [8, 9, 33–35].
Leptospirosis remains a multifactorial disease where reservoir animal abundance (mostly rodents), Leptospira prevalence in the reservoir host and human behaviour (e.g. use of personal protective equipment, covering of lesions) have a marked effect on human exposure risk [36]. Further, the transmission from host to host depends largely on the survival time of the pathogens in the environment [28, 31].
Typically, Leptospira infection occurs when the bacteria penetrate the body through mucosal membranes or skin cuts and enter the bloodstream of the host. Yet, an oral intake of pathogens through e.g. swallowing water is thought to be an important route of entry [37]. A very limited number of studies have implicated oral transmission of Leptospira [38, 39], and there are currently no published studies that used the oral or intranasal inoculation route to establish infection [10]. To our knowledge this is one of the first studies looking at Leptospira spp. as a possible food contaminate.
Under the assumption, that strawberries are usually not eaten directly from the field but are transported to retail level for a certain time period under dry conditions, the results obtained here indicate that the consumption of strawberries marketed at retail or market level poses a very low risk of human infection with Leptospira kischneri. The risk could be further reduced by washing the fruits prior to consumption to facilitate the removal of any bacteria from the surface.
The question remains if strawberries consumed directly during harvest, by either field workers or consumers on pick-your-own fields carry a higher risk. Here, leptospiral survival on strawberries is most probably sufficiently long to pose a risk of human infection, as shown in our study. The effect of increased moisture and varying temperatures, either due to wetter and more humid weather conditions or transport conditions, on the survival of the pathogen on strawberries remains to be verified.
Acknowledgments
We thank Cornelia Göllner and Peter Bahn for their excellent work in the laboratory.
References
- 1. Vijayachari P, Sugunan AP, Shriram AN. Leptospirosis: an emerging global public health problem. J Biosci. 2008;33(4):557–69. pmid:19208981
- 2. Costa F, Hagan JE, Calcagno J, Kane M, Torgerson P, Martinez-Silveira MS, et al. Global Morbidity and Mortality of Leptospirosis: A Systematic Review. PLoS Negl Trop Dis. 2015;9(9):e0003898. pmid:26379143
- 3. Dupouey J, Faucher B, Edouard S, Richet H, Kodjo A, Drancourt M, et al. Human leptospirosis: an emerging risk in Europe? Comp Immunol Microbiol Infect Dis. 2014;37(2):77–83. pmid:24388481
- 4. Fernandes LG, de Morais ZM, Vasconcellos SA, Nascimento AL. Leptospira interrogans reduces fibrin clot formation by modulating human thrombin activity via exosite I. Pathog Dis. 2015;73(4).
- 5. Torgerson PR, Hagan JE, Costa F, Calcagno J, Kane M, Martinez-Silveira MS, et al. Global Burden of Leptospirosis: Estimated in Terms of Disability Adjusted Life Years. PLoS Negl Trop Dis. 2015;9(10):e0004122. pmid:26431366
- 6. Brockmann SO, Ulrich L, Piechotowski I, Wagner-Wiening C, Nockler K, Mayer-Scholl A, et al. Risk factors for human Leptospira seropositivity in South Germany. Springerplus. 2016;5(1):1796. pmid:27803844
- 7. Jansen A, Schoneberg I, Frank C, Alpers K, Schneider T, Stark K. Leptospirosis in Germany, 1962–2003. Emerg Infect Dis. 2005;11(7):1048–54. pmid:16022779
- 8. Desai S, van Treeck U, Lierz M, Espelage W, Zota L, Sarbu A, et al. Resurgence of field fever in a temperate country: an epidemic of leptospirosis among seasonal strawberry harvesters in Germany in 2007. Clin Infect Dis. 2009;48(6):691–7. pmid:19193108
- 9. Dreesman J, Hamschmidt L, Toikkanen S, Runge M, Lüsse B, Freise J, et al. Leptospirose-Ausbruch bei Saisonarbeitern in der Erdbeerernte in Niedersachsen, 2014. Das Gesundheitswesen. 2016;78(04).
- 10. Barragan V, Olivas S, Keim P, Pearson T. Critical Knowledge Gaps in Our Understanding of Environmental Cycling and Transmission of Leptospira spp. Appl Environ Microbiol. 2017;83(19).
- 11. Victoria B, Ahmed A, Zuerner RL, Ahmed N, Bulach DM, Quinteiro J, et al. Conservation of the S10-spc-alpha locus within otherwise highly plastic genomes provides phylogenetic insight into the genus Leptospira. PLoS One. 2008;3(7):e2752. pmid:18648538
- 12. Boonsilp S, Thaipadungpanit J, Amornchai P, Wuthiekanun V, Bailey MS, Holden MT, et al. A single multilocus sequence typing (MLST) scheme for seven pathogenic Leptospira species. PLoS Negl Trop Dis. 2013;7(1):e1954. pmid:23359622
- 13. Stoddard RA. Detection of pathogenic Leptospira spp. through real-time PCR (qPCR) targeting the LipL32 gene. Methods Mol Biol. 2013;943:257–66. pmid:23104295
- 14. Stoddard RA, Gee JE, Wilkins PP, McCaustland K, Hoffmaster AR. Detection of pathogenic Leptospira spp. through TaqMan polymerase chain reaction targeting the LipL32 gene. Diagn Microbiol Infect Dis. 2009;64(3):247–55. pmid:19395218
- 15. Bourhy P, Bremont S, Zinini F, Giry C, Picardeau M. Comparison of Real-Time PCR Assays for Detection of Pathogenic Leptospira spp. in Blood and Identification of Variations in Target Sequences. Journal of Clinical Microbiology. 2011;49(6):2154–60. pmid:21471336
- 16.
R Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2019.
- 17. Bates D, Maechler M, Bolker B, Walker S. Fitting Linear Mixed-Effects Models Using lme4. Journal of Statistical Software. 2015; 67(1):1–48.
- 18. Karaseva EV, Chernukha YG, Piskunova LA. Results of studying the time of survival of pathogenic leptospira under natural conditions. J Hyg Epidemiol Microbiol Immunol. 1973;17(3):339–45. pmid:4795565
- 19. Barragan VA, Mejia ME, Travez A, Zapata S, Hartskeerl RA, Haake DA, et al. Interactions of leptospira with environmental bacteria from surface water. Curr Microbiol. 2011;62(6):1802–6. pmid:21479795
- 20. Thibeaux R, Geroult S, Benezech C, Chabaud S, Soupe-Gilbert ME, Girault D, et al. Seeking the environmental source of Leptospirosis reveals durable bacterial viability in river soils. PLoS Negl Trop Dis. 2017;11(2):e0005414. pmid:28241042
- 21. Trueba G, Zapata S, Madrid K, Cullen P, Haake D. Cell aggregation: a mechanism of pathogenic Leptospira to survive in fresh water. Int Microbiol. 2004;7(1):35–40. pmid:15179605
- 22. Okazaki W, Ringen LM. Some effects of various environmental conditions on the survival of Leptospira pomona. Am J Vet Res. 1957;18(66):219–23. pmid:13394849
- 23. Smith DJ, Self HR. Observations on the survival of Leptospira australis A in soil and water. J Hyg (Lond). 1955;53(4):436–44. pmid:13278528
- 24. Hellstrom JS, Marshall RB. Survival of Leptospira interrogans serovar pomona in an acidic soil under simulated New Zealand field conditions. Res Vet Sci. 1978;25(1):29–33. pmid:30123
- 25. Saito M, Miyahara S, Villanueva SY, Aramaki N, Ikejiri M, Kobayashi Y, et al. PCR and culture identification of pathogenic Leptospira spp. from coastal soil in Leyte, Philippines, after a storm surge during Super Typhoon Haiyan (Yolanda). Appl Environ Microbiol. 2014;80(22):6926–32. pmid:25172869
- 26. Saito M, Villanueva SY, Chakraborty A, Miyahara S, Segawa T, Asoh T, et al. Comparative analysis of Leptospira strains isolated from environmental soil and water in the Philippines and Japan. Appl Environ Microbiol. 2013;79(2):601–9. pmid:23144130
- 27. Kirschner L, Maguire T. Survival of Leptospira outside their hosts. N Z Med J. 1957;56(314):385–91. pmid:13465012
- 28. Casanovas-Massana A, Pedra GG, Wunder EA Jr, Diggle PJ, Begon M, Ko AI. Quantification of Leptospira interrogans Survival in Soil and Water Microcosms. Appl Environ Microbiol. 2018;84(13).
- 29. Chang SL, Buckingham M, Taylor MP. Studies on Leptospira icterohaemorrhagiae; survival in water and sewage; destruction in water by halogen compounds, synthetic detergents, and heat. J Infect Dis. 1948;82(3):256–66. pmid:18864110
- 30. Smith CE, Turner LH. The effect of pH on the survival of leptospires in water. Bull World Health Organ. 1961;24(1):35–43. pmid:20604084
- 31. Khairani-Bejo SA, Bahaman R, Zamri-Saad M, Mutalib AR. The Survival of Leptospira interrogans Serovar Hardjo in the Malaysian Environment Journal of Animal and Veterinary Advances. 2004;3 (2): 66–9.
- 32. Andre-Fontaine G, Aviat F, Thorin C. Waterborne Leptospirosis: Survival and Preservation of the Virulence of Pathogenic Leptospira spp. in Fresh Water. Curr Microbiol. 2015;71(1):136–42. pmid:26003629
- 33. Nau LH, Emirhar D, Obiegala A, Mylius M, Runge M, Jacob J, et al. [Leptospirosis in Germany: current knowledge on pathogen species, reservoir hosts, and disease in humans and animals]. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz. 2019;62(12):1510–21. pmid:31745576
- 34. Hermannsen J. [A swamp fever epidemic in the west coast region of Schleswig-Holstein]. Dtsch Med Wochenschr. 1954;79(7):245–6. pmid:13150849
- 35. Popp L. The epidemiology of field fever in the foothills of Lower Saxony. Arch Hyg Bakteriol. 1960;144:345–74. pmid:14434169
- 36. Goarant C. Leptospirosis: risk factors and management challenges in developing countries. Res Rep Trop Med. 2016;7:49–62. pmid:30050339
- 37. Haake DA, Levett PN. Leptospirosis in humans. Current topics in microbiology and immunology. 2015;387:65–97. pmid:25388133
- 38. Reilly JR, Hanson LE, Ferris DH. Experimentally induced predator chain transmission of Leptospira grippotyphosa from rodents to wild marsupialia and carnivora. Am J Vet Res. 1970;31(8):1443–8. pmid:5449900
- 39. Bolin CA, Koellner P. Human-to-human transmission of Leptospira interrogans by milk. J Infect Dis. 1988;158(1):246–7. pmid:3392418