Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

  • Maryam Hajikarimlou,

    Roles Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Houman Moteshareie,

    Roles Formal analysis, Investigation

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Katayoun Omidi,

    Roles Methodology, Writing – review & editing

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Mohsen Hooshyar,

    Roles Conceptualization, Formal analysis

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Sarah Shaikho,

    Roles Methodology

    Affiliation Molecular Biomedicine Program, Children’s Hospital of Eastern Ontario Research Institute, Ottawa, Ontario, Canada

  • Tom Kazmirchuk,

    Roles Data curation, Investigation

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Daniel Burnside,

    Roles Validation, Writing – review & editing

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Sarah Takallou,

    Roles Data curation, Formal analysis

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Narges Zare,

    Roles Data curation, Validation

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Sasi Kumar Jagadeesan,

    Roles Data curation

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Nathalie Puchacz,

    Roles Data curation

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Mohan Babu,

    Roles Supervision, Writing – review & editing

    Affiliation Department of Biochemistry, Research and Innovation Centre, University of Regina, Regina, Canada

  • Myron Smith,

    Roles Investigation, Supervision, Writing – review & editing

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • Martin Holcik,

    Roles Investigation, Supervision, Writing – review & editing

    Affiliation Department of Health Sciences, Carleton University, Ottawa, Ontario, Canada

  • Bahram Samanfar,

    Roles Formal analysis, Supervision, Writing – review & editing

    Affiliations Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada, Agriculture and Agri-Food Canada, Ottawa Research and Development Centre (ORDC), Ottawa, Ontario, Canada

  •  [ ... ],
  • Ashkan Golshani

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Project administration, Supervision, Validation, Writing – original draft, Writing – review & editing

    Ashkan.Golshani@carleton.ca

    Affiliation Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, Ontario, Canada

  • [ view all ]
  • [ view less ]

Abstract

Lithium Chloride (LiCl) toxicity, mode of action and cellular responses have been the subject of active investigations over the past decades. In yeast, LiCl treatment is reported to reduce the activity and alters the expression of PGM2, a gene that encodes a phosphoglucomutase involved in sugar metabolism. Reduced activity of phosphoglucomutase in the presence of galactose causes an accumulation of intermediate metabolites of galactose metabolism leading to a number of phenotypes including growth defect. In the current study, we identify two understudied yeast genes, YTA6 and YPR096C that when deleted, cell sensitivity to LiCl is increased when galactose is used as a carbon source. The 5’-UTR of PGM2 mRNA is structured. Using this region, we show that YTA6 and YPR096C influence the translation of PGM2 mRNA.

Introduction

Dysregulation of signaling pathways in the brain is thought to be the main cause of bipolar disorder (BD) [1]. Lithium chloride (LiCl) has remained an important treatment option for BD for decades [2,3]. It has been prescribed to prevent both new depressive and manic episodes and is known to be the only compound to have anti-suicidal effects in BD patients [4].

When LiCl is used as a therapeutic agent, it is generally accepted that in the short term, it influences Protein Kinase C (PKC) and glycogen synthesis kinase-3 (GSK-3) signal transduction pathways. Long term exposure to LiCl modifies the expression of different genes/pathways including PI/PKC signaling cascade, leading to alterations in the synaptic function of the nerve cells [1,57]. Inducing autophagy, oxidative metabolism, apoptosis and affecting translation machinery are other pathways proposed to be influenced by LiCl intake [2,6]. LiCl has also been investigated as a treatment option for Alzheimer’s disease which is caused by the aging of the nervous system [6,8]. Although much has been learned about the influence of LiCl, how it affects the cell at the molecular level and the mechanism(s) of its activity, as well as its side effects (secondary effects) require further investigations [1,2,8].

At the molecular level, the sensitivity of yeast cells to LiCl was previously described by changes in the level of expression and activity for PGM2 that encodes a phosphoglucomutase [9,10]. Phosphoglucomutase is responsible for converting glucose-1-phosphate to glucose-6-phosphate and LiCl is an inhibitor of its enzymatic activity. When galactose is used as the carbon source, inhibition of phosphoglucomutase by LiCl results in the accumulation of galactose metabolite intermediates that in turn causes growth defects [11,12]. In the presence of glucose, LiCl reduces the levels of UDP-glucose and disrupts the associated pathways. It has also been suggested that LiCl may inhibit RNA processing enzymes [13,14]. Also, it is reported that under LiCl stress, there seems to be a rapid loss of ribosomal protein gene pre-mRNAs and a decrease in the number of mature mRNAs in the cytoplasm [14]. In addition, it is possible that LiCl may inhibit the initial steps of the protein synthesis pathway. It is thought that LiCl may disrupt the association of translation initiation factor eIF4A RNA helicase to the yeast translation machinery [9] impairing translation initiation. Deletion of TIF2 that codes for the eIF4A helicase increased yeast sensitivity to LiCl. Over-expression of eIF4A helicase reverted the translational inhibition caused by LiCl [9].

In the current study, we observed that the deletion of two yeast genes, YTA6 and YPR096C increased the sensitivity of yeast cells to LiCl. YTA6 codes for a putative ATPase of the CDC48/PAS1/SEC18 (AAA) family of proteins and YPR096C codes for a protein of unknown function. Neither of the genes was previously linked to cell responses to LiCl. Our follow-up genetic investigations suggest that the involvement of YTA6 and YPR096C in yeast LiCl sensitivity seems to be due to their influence on PGM2 translation.

Materials and methods

Strains, plasmids, gene collections and cell and DNA manipulations

MATa mating strain Y4741 orfΔ::KanMAX4 his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 and MATα mating strain, Y7092 can1Δ::STE2pr-Sp_his5 lyp1Δ his3Δ1 leu21Δ0 ura3Δ0 met15Δ0 were used. Yeast non-essential gene knockout collections [15], yeast over-expression plasmid library [16] and the collection of yeast gene-GFP fusion strains were utilized as before [1719]. Yeast gene knockout was performed by PCR transformation using the Lithium Acetate method and confirmed by PCR analysis [20,21]. Over-expression plasmids for YTA6 and YPR096C were purchased from Thermofisher® and their integrity was confirmed using PCR analysis. PGM2-GFP strain was purchased from Thermofisher® Yeast GFP Clone Collection and was utilized in qRT-PCR and western blot analysis. The integrity of this strain was confirmed using PCR and drug sensitivity analyses.

p281 construct carries a LacZ expression cassette under the control of a gal promoter. p281-4 construct carries an insert with a strong hairpin structure (5’GATCCTAGGATCCTAGGATCCTAGG ATCCTAG3’) upstream of LacZ cassette[22]. pAG25 plasmid was used as a DNA template for nourseothricin sulfate (clonNAT) resistance gene marker in PCR reactions for gene knockout experiments. Kanamycin and NAT markers were used as selection markers for corresponding deletion mutant strains. All plasmids carried an ampicillin resistance gene which was used as a selection marker in E. coli DH5α, and a URA3 marker gene for selection in yeast.

P416 construct carries a LacZ expression cassette under the transcriptional control of a gal promoter. To generate reporter LacZ mRNAs under the translational control of complex RNA structures, three different fragments were cloned upstream of the LacZ mRNA in p416 construct using XbaI restriction site. In this way three expression constructs were designed as follows: pPGM2 construct contains the 5’-UTR of PGM2 gene (5’TAATAAGAAAAAGATCACCAATC TTTCTCAGTAAAAAAAGAACAAAAGTTAACATAACAT 3’), pTAR construct contains the 5’ UTR of HIV1-tar gene (5’GGGTTCTCTGGTTAGCCAGATCTGAGCCCGGGAGCTCTCTGGCTAGCTAGGGAACC CACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCC 3’) and pRTN that contains the 5’ UTR of FOAP-11 gene (5’GGGATTTTTACATCGTCTTGGTAAAGGCGTGTGACCCATA GGTTTTTTAGATCAAACACGTCTTTACAAAGGTGATCTAAGTATCTC 3’).

YP (1% Yeast extract, 2% Peptone) or SC (Synthetic Complete) with selective amino acids (0.67% Yeast nitrogen base w/o amino acids, 0.2% Dropout mix,) either with 2% dextrose or 2% galactose, as a source of carbohydrates, was used as culture medium for yeast and LB (Lysogeny Broth) was used for E. coli cultures. 2% agar was used for all solid media. Yeast plasmid extraction was performed using yeast plasmid miniprep kit (Omega Biotek®) and E. coli plasmid extraction was carried out using GeneJET plasmid miniprep kit (Thermofisher® and Bio-Basics®) according to the manufacturers’ instructions.

Drug sensitivity analysis

For drug sensitivity analysis, yeast cells were grown from independent colonies to saturation for two days at 30°C in liquid YPgal. Spot test analysis of serial dilutions of cell suspensions were spotted onto solid media with or without LiCl. For growth sensitivity to LiCl, 10 mM and 100 mM concentrations were used in media containing galactose or glucose, respectively, as described before [10,11]. Sensitivity to the compound was assessed by comparing the number and size of the colonies formed on each plate after 48 hours in comparison with wild type [20].

For quantification analysis, colony counting was done by taking 100 μL of diluted (10−4) cell cultures from independent colonies, grown for two days at 30°C in liquid YPgal, and spreading on YPgal plates in the absence and presence of LiCl. The colonies were counted two days after incubation at 30°C. Each experiment was repeated at least three times. t-test analysis (P-value ≤ 0.05) was used to determine statistically significant differences.

Quantitative β-galactosidase assay

The effect of 5’-UTR regions to mediate translation in different yeast strains were examined using LacZ reporter systems. To evaluate the activity of LacZ expression cassettes, quantitative β-galactosidase assay was performed using ONPG (O-nitrophenyl-α-D-galactopyranoside) as described [23,24]. Each experiment was repeated at least three times.

Quantitative real time PCR (qRT-PCR)

The content of mRNAs was evaluated using qRT-PCR analysis. Deletion mutants in PGM2-GFP strain background were grown in YPgal overnight with or without LiCl treatment. Total RNA was extracted with Qiagen® RNeasy Mini Kit. Complementary DNA (cDNA) was made using iScript Select cDNA Synthesis Kit (Bio-Rad®) according to the manufacturer’s instructions. cDNA was then used as a template for quantitative PCR. qPCR was carried out using Bio-Rad® iQ SYBR Green Supermix and the CFX connect real time system (Bio-Rad®), according to the manufacturer’s instructions. PGK1 was used as a constitutive housekeeping gene (internal control). The procedure and data analysis were performed according to MIQE guidelines [25].

The procedure was done in three repeats and t-test analysis (P-value ≤ 0.05) was used to determine statistically significant results. The following primers were used to quantify PGM2 and PGK1 mRNAs, as our positive control in different mutant strains.

PGM2: Forward GGTGACTCCGTCGCAATTAT; Reverse: CGTCGAACAAAGCACAGAAA

PGK1: Forward ATGTCTTTATCTTCAAAGTT; Revers: TTATTTCTTTTCGGATAAGA

Western blot analysis

Western blot analysis was used to investigate the protein content for Pgm2p-GFP fusion protein. Different strains were grown in media treated with and without LiCl. Protein extraction was performed as described by Szymanski [26]. Bicinchoninic acid assay (BCA) was performed to estimate protein concentration as described by the manufacturer (Thermo Fisher®). Equal amounts of total protein extract (50 μg) were loaded onto a 10% SDS-PAGE gel, run on Mini-PROTEAN Tetra cell electrophoresis apparatus system (Bio-Rad®). Proteins were transferred to a nitrocellulose 0.45 μm membrane via a Trans-Blot Semi-Dry Transfer (Bio-Rad®). Mouse monoclonal anti-GFP antibody (Santa Cruz®) was used to detect protein levels of Pgm2p-GFP. Mouse anti-Pgk1 (Santa Cruz®) was used to detect Pgk1 protein levels used as internal controls. Immunoblots were visualized with chemiluminescent substrates (Bio-Rad®) on a Vilber Lourmat gel doc Fusion FX5-XT (Vilber®). Densitometry analysis was carried out using the FUSION FX software (Vilber®). Experiments were repeated at least three times; t-test analysis (P-value ≤ 0.05) was used to determine statistically significant results.

Genetic interaction analysis

Synthetic genetic analysis for YTA6 and YPR096C was performed in a 384 format as before [17,19,27]. In brief, deletion mutant for query genes in Mat α mating type were crossed to two sets of gene deletion mutants in Mat a mating type. After a few rounds of selection, double gene deletion mutants were selected in Mat a mating type. Colony size was used as a measure of fitness [27,28]. Colony size was measured as described before [29,30]. The experiment was repeated three times.

For Phenotypic Suppression Array (PSA) analysis a MATα yeast strain having an over-expression plasmid of our query gene is mated into the entire deletion set along with an empty plasmid used as a control [31,32]. For phenotypic suppression analysis, the final constructs transformed into deletion library were grown on YPgal compared to the control plasmid. Phenotypic suppression array was performed by growing the transformed cells on YPgal with a sub-inhibitory concentration of LiCl (3 mM, approximately 1/3 of the concentration used for strain sensitivity analysis) as a stress condition drug [33]. We investigated the ability of the over-expression of our query genes to compensate for the sick phenotype of our deletion sets under the inhibitory concentration of LiCl. If the over-expression of our candidate genes overcome the sensitivity of a yeast deletion strain caused by drug inhibition, we can suggest that a functional connection exists between the two genes [20,34].

Genetic interaction data analysis

Scoring fitness was done by colony size measurement as in [29,30]. Those deletions that had 30% or more reduction in colony size in at least two experiments were considered hits. Based on their biological process and/or molecular function, hits were clustered into groups with enriched GO terms using Gene Ontology Resource http://geneontology.org/ and Genemania database http://genemania.org.

Results and discussion

Deletion of YTA6 and YPR096C increases yeast sensitivity to lithium

Drug sensitivity of mutant strains to a target chemical is an important tool to investigate how a chemical compound affects the cell at the molecular level and pathways influenced by the drug [17,19,35]. While investigating yeast gene deletion mutants that are sensitive to LiCl we identified two gene deletion mutants for YTA6 and YPR096C that showed increased sensitivity to LiCl. Little is known about the molecular activity of these two genes and the cellular process in which they participate making them interesting targets to study. YTA6 codes for a putative ATPase and YPR096C is an uncharacterized ORF.

In the spot test assay indicated in Fig 1 yta6Δ and ypr096cΔ show growth reduction in the presence of LiCl (10 mM LiCl) suggesting increased sensitivity of yeast strains when these two genes are deleted. tif2Δ was used as a positive control. Introduction of the over-expression plasmids that express the deleted genes, into the corresponding gene deletion mutants reversed the observed sensitivities to LiCl (Fig 1). To confirm the results obtained by the spot test assay we perform colony count measurement analysis, which represents a more quantitative approach. In this method, the decreased percentage of colonies is calculated by dividing the number of colonies in media in the presence of the LiCl to the number of colonies in control media and normalized to Wild Type (WT). Indicated in Fig 2 deletion of YTA6, YPR096C or TIF2 show reduced colony formation in the presence of LiCl. As before, introduction of the over-expression plasmids that express the deleted genes into the corresponding gene deletion mutants suppressed cell sensitivities to LiCl caused by gene deletions.

thumbnail
Fig 1. Drug sensitivity analysis for different yeast strains using spot test assay.

In (A) and (B) yeast cells were serially diluted as indicated (10−1 to 10−4) and spotted on YPgal media with or without LiCl (10 mM). yta6 and ypr096c show less growth under LiCl treatment. Double deletion for GAL1 with YTA6 or YPR096C suppressed the observed sensitivity of single-gene deletions for YTA6 or YPR096C. Deletion of TIF2 was used as a positive control. In (C) over-expression of the target gene in their corresponding deletion mutants reverted cell sensitivity to LiCl (10 mM). Each experiment was repeated at least three times (n ≥ 3) with similar outcomes.

https://doi.org/10.1371/journal.pone.0235033.g001

thumbnail
Fig 2. Quantitative analysis of drug sensitivity for different yeast strains.

The average number of colonies formed for different yeast strains in the presence of LiCl (10 mM) was normalized to that for the WT strain (WT average colony count = 285.33). Double deletion for GAL1 with YTA6 or YPR096C suppressed the observed sensitivity of single-gene deletions for YTA6 or YPR096C. Data represent the average from three independent experiments (n = 3) and error bars represent standard deviation. * represent statistically significant results compared to the WT. t-test analysis (P-value ≤ 0.05) was used to compare differences.

https://doi.org/10.1371/journal.pone.0235033.g002

LiCl reduces the activity of phosphoglucomutase enzyme leading to the accumulation of intermediate metabolites from the galactose metabolism including galactose-1-phosphate, a toxic intermediate. In yeast, galactokinase is encoded by the GAL1 gene. To investigate the influence of YTA6 and YPR096C on LiCl toxicity through galactose metabolism, we generated double gene deletions for YTA6 or YPR096C with the GAL1 gene. Deletion of the GAL1 gene relieved the sensitivity of gene deletion mutants for YTA6 or YPR096C to LiCl (Fig 1). Also, when glucose was used as a carbon source deletion strains for YTA6 or YPR096C showed no sensitivity to 10 mM LiCl. When the concentration of LiCl was increased to a toxic level (100 mM) in the presence of glucose as a carbon source [11,36], deletion mutants for YTA6 or YPR096C did not show increased sensitivity (S1 Fig). Together these results further connect the observed LiCl sensitivity for YTA6 and YPR096C deletion strains to galactose metabolism.

YTA6 and YPR096C regulate the expression of PGM2 at the level of translation

PGM2 has been identified as a target of LiCl in yeast cells and its expression has been reported to change in the presence of LiCl [10]. Next, we investigated the ability of YTA6 and YPR096C to change PGM2 expression both at the levels of translation (Fig 3A) and transcription (Fig 3B). This was done using western blot analysis in a strain where Pgm2p was tagged with a GFP gene. In the absence of LiCl, we observed no notable alteration in the Pgm2p levels when either YTA6 or YPR096C were deleted. However, when cells were challenged with 10 mM LiCl, the deletion of either YTA6 or YPR096C reduced the protein content of Pgm2p.

thumbnail
Fig 3. Protein and mRNA content analysis.

(A) Protein content analysis of Pgm2p-GFP protein in deletion of yeast strains for yta6Δ and ypr096cΔ. Western blot analysis was used to measure the protein content for Pgm2p-GFP protein in the absence or presence of LiCl (10 mM) and related to WT. Pgk1p was used as a housekeeping gene and the values are normalized to that. The inset represents a typical blot (B) mRNA content analysis of PGM2 in yta6Δ and ypr096cΔ. qRT-PCR was used to evaluate the content of PGM2 mRNA in yeast gene deletion mutants related to WT strain and normalized to PGK1 mRNA levels in the absence or presence of LiCl (10 mM). Each experiment was repeated at least three times (n ≥ 3). Error bars represent standard deviation. * represent statistically significant results compared to the value in the corresponding WT. t-test analysis (P-value ≤ 0.05) was used to compare differences.

https://doi.org/10.1371/journal.pone.0235033.g003

To investigate the possible effect of YTA6 and YPR096C on PGM2 transcription, we used qRT-PCR analysis to measure the content of PGM2 mRNA when YTA6 and YPR096C were deleted. Indicated in Fig 3B, deletion of YTA6 and YPR096C did not noticeably change the content of PGM2 mRNA when cells were treated with LiCl. This suggests that YTA6 and YPR096C are unlikely to alter PGM2 expression at the transcription level. Together these observations connect the activities of YTA6 and YPR096C to the expression of Pgm2p at the protein level. This is in agreement with a previous observation by Sofola-Adesakin et al. that in Drosophila melanogaster LiCl impaired gene expression at the protein synthesis level and not the mRNA level[6].

Translation of β-galactosidase reporter mRNA with a hairpin structure is altered by the deletion of YTA6 and YPR096C

The 5’-UTR of PGM2 mRNA is predicted to contain a highly structured region [37,38] (S2 Fig). This knowledge along with the observation that YTA6 and YPR096C appear to impact PGM2 expression at the translation level prompted us to investigate the influence of YTA6 and YPR096C on the translation of other structured mRNAs. First, we placed the 5’-UTR of PGM2 mRNA in front of a LacZ reporter gene in a p416 expression construct [39]. Indicated in Fig (4A and 4B), when YTA6 and YPR096C were deleted the activity of β-galactosidase was reduced for the reporter gene that contained 5’-UTR of PGM2 mRNA and not a control mRNA without the 5’-UTR of PGM2. The deletion of TIF2 was used as a positive control.

thumbnail
Fig 4. β-galactosidase expression analysis in different yeast strains.

Activities from β-galactosidase mRNAs that carry 5’-UTR of PGM2 mRNA (pPGM2) (A) upstream of LacZ reporter was reduced in yta6Δ and ypr096cΔ strains; tif2Δ was used as a positive control. Strains carrying low complexity regions upstream of LacZ reporters p416 (B) did not show as significant reductions in β-galactosidase activity. Values are normalized to that for WT which resulted in average β-galactosidase values of 38.1U and 407.5U for pPGM2 and p416 constructs, respectively. Each experiment was repeated at least three times (n ≥ 3) and error bars represent standard deviation. * represent statistically significant results (P-value ≤ 0.05) compared to the WT. t-test analysis (P-value ≤ 0.05) was used to compare differences. The insets represent schematic reporter mRNA structures.

https://doi.org/10.1371/journal.pone.0235033.g004

Next, we utilized an expression cassette, p281-4 with a strong hairpin structure in front of a LacZ reporter gene [22]. A second construct, p281 without the hairpin structure was used as a control. Illustrated in Fig (5A and 5B) it was observed that when YTA6 and YPR096C were deleted the activity of β-galactosidase was reduced for the reporter gene that contained a hairpin structure. When the hairpin was absent, the activity of β-galactosidase was independent of YTA6 and YPR096C. Together these data show that the deletion of YTA6 and YPR096C seem to reduce the translation of structured reporter mRNAs.

thumbnail
Fig 5. Normalized β-galactosidase activity is lower in yta6Δ and ypr096cΔ for structured mRNAs.

A strong hairpin structure (p281-4) (A) upstream of a LacZ reporter pTAR (C) highly structured 5’-UTR of HIV1-tar and pRTN (D) constructs contain the highly structured 5’-UTR of FOAP-11 genes in front of the β-galactosidase reporter mRNA. P281 (B) was served as a control plasmid with no inhibitory structure did not show as significant reductions in β-galactosidase activity. Values are normalized to that for WT which resulted in average β-galactosidase values of 14.1U and 37.9U for pRTN and p416 constructs, respectively. Each experiment was repeated at least three times (n ≥ 3) and error bars represent standard deviation. * represent statistically significant results (P-value ≤ 0.05) compared to the WT. t-test analysis (P-value ≤ 0.05) was used to compare differences. The insets represent schematic reporter mRNA structures.

https://doi.org/10.1371/journal.pone.0235033.g005

Next, we investigated the influence of YTA6 and YPR096C on other structured mRNAs. For this, we designed two additional β-galactosidase mRNA reporters each carrying different complex RNA structures. pTAR carries the 5’-UTR of the HIV1-tar gene. This region contains a strong hairpin loop involved in modulating expression [40]. pRTN carries the 5’ UTR of FOAP-11 gene that contains a highly structured region [41]. Indicated in (Fig 5C and 5D), deletion strains for YTA6 and YPR096C had a reduced level of β-galactosidase expression.

Genetic interaction analysis further connects the activity of YTA6 and YPR096C to the protein biosynthesis pathway

Genetic Interaction (GI) analysis is based on the assumption that parallel compensating cellular pathways give the cell its plasticity and tolerance against random deleterious mutations [29]. In this way, deletion of individual genes that can functionally compensate for each other has little or no phenotypic consequences. However, when both genes are deleted, an unexpected phenotype can emerge which can often be detected but a decrease in cell fitness or even cell death. In this case, the two genes are said to be forming a negative genetic interaction (nGI). An nGI can reveal the involvement of genes in compensating parallel pathways. nGI analysis has been used in various investigations to study gene function [17,18,33]. Systematic analysis of GIs in yeast is made possible by its two mating types. A target gene deletion in α-mating type (MAT alpha) is crossed with an array of single-gene deletion in a-mating type (MAT a) background and after a few rounds of selection double gene knockouts are selected [27]. Colony size measurement is often used to determine the fitness of double gene knockouts [28]. To this end, we generated a set of double gene deletions mutants for our two query genes with 402 deletion mutants for genes involved in gene expression (S2 Table). This array was termed gene expression array. Due to inherent bias associated with such enriched subsets, a second set of double gene deletions were made for our query genes with 304 random gene deletions, termed random array, and was used as a control (S2 Table).

YTA6 formed 7 nGIs with different genes (S3 Table). The list of interactors includes YPL079W that encodes for large ribosomal subunit protein 21B and YPL090C that codes for small ribosomal subunit 6A. YPR096C interacted with 8 genes including YOR091W that codes for a protein associated with translating ribosomes and YOR078W that codes for a protein involved in small ribosomal subunit biogenesis (S3 Table). The low number of nGIs observed for both YTA6 and YPR096C makes it difficult to draw a statistically meaningful enrichment for the interacting genes. As a result, formulating function(s) for YTA6 and YPR096C on the basis of the observed interactions is not feasible.

In addition, we also investigated the conditional nGIs for the two target genes. Conditional GIs represent an interesting form of gene association. They represent a further insight into the function of genes under a specific condition. The activities of many genes are known to be condition dependent. For example, the expression of many DNA repair genes are regulated in response to DNA damage [42,43]. To this end, we investigated conditional nGIs for YTA6 and YPR096C in the presence of a mild concentration of LiCl (3 mM). Illustrated in Fig 6 YTA6 formed a total of 14 conditional nGIs. On the basis of their functions and cellular processes in which they participate, these genes can be divided into different categories. Of note, the category of genes involved in protein biosynthesis was the only significantly enriched category (P = 1.6e-4). Within this category, we find 7 genes including, RPL2B that encodes large ribosomal subunit protein 2B and YDR159W that codes for a protein required for biogenesis of small ribosomal subunit. YPR096C formed 13 conditional nGIs, 6 of which belonged to the category of protein biosynthesis (P = 6.6e-4). The genes in this category include YDL081C that codes for ribosomal stalk protein P1 alpha and YER153C that codes for a mitochondrial translation activator. The conditional nGIs observed here suggest a possible functional association for YTA6 and YPR096C to protein biosynthesis when cells are challenged with LiCl.

thumbnail
Fig 6. Conditional nGIs for YTA6 and YPR096C in the presences of 3 mM concentration of LiCl.

Our data shows a cluster of interactors involved in the protein biosynthesis pathway for YTA6 (P = 1.6e-4) and YPR096C (P = 6.6e-4). CTK1, HAC1, BCK1, MRPL1, and PGM2 are mutual hits shared between YTA6 and YPR096C. Circles represent genes, dashed lines represent nGIs identified in this study and solid lines represent previously reported interactions in the literature. The inset represents an example of a typical interaction.

https://doi.org/10.1371/journal.pone.0235033.g006

Phenotypic Suppression Array (PSA) analysis focuses on another form of GIs, where a specific phenotype associated with a gene deletion mutant is suppressed by the over-expression of the second gene [32,44,45]. This type of GI generally indicates a close functional association where the activity of an over-expressed gene compensates for the absence of the others. To this end, we subjected the gene expression array (described above) to 10 mM of LiCl. In this concentration, a number of strains showed sensitivity. We then attempted to reverse the observed sensitivities by over-expression of either YTA6 or YPR096C in these mutants. Interestingly over-expression of either YTA6 or YPR096C compensated for the sensitivity of the same two gene deletions, bck1Δ and eap1Δ, to LiCl (Fig 7). We confirmed our PSA data using spot test drug sensitivity analysis (Fig 7). We observed that sensitivity of bck1Δ and eap1Δ to 10 mM LiCl was relieved by introducing pYTA6 and pYPR096C over-expression plasmids into deletion mutant strains (Fig 7). The fact that YTA6 and YPR096C compensated the same two gene deletions, further connects their activities together in the context of LiCl sensitivity. Another possibility is that the over-expression of YTA6 and YPR096C would improve PGM2 mRNA translation, leading to an increase in PGM2 activity in the cells that was shown to confer resistance to lithium in galactose medium [11]. According to this hypothesis, if the main cause of toxicity under these conditions is the decrease in PGM2 activity, the over-expression of YTA6 and YPR096C would be "solving" the original problem and thus making any yeast strain more tolerant to lithium, not only those with a related function in the cell. Bck1 is reported to function in cell wall integrity pathway and deadenylation of mRNAs and Eap1 is an eIF4E-associated protein and accelerates the decapping of mRNAs. They have both been implemented in the regulation of alternative translation initiation via Dhh1p, a helicase protein [4649]. Dhh1p is a member of the DEAD-box family of RNA helicases capable of unwinding strong secondary structures. It functions in mRNA decapping and translational repression among other processes [45,50]. A proposed functional association for both YTA6 and YPR096C to the regulation of translation via Dhh1 merits further investigations.

thumbnail
Fig 7. Over-expression of YTA6 and YPR096C compensate for the sensitivity of eap1Δ and bck1Δ to 10 mM LiCl.

(A) BCK1 and EAP1 are known to be involved in translation initiation via DHH1 through previously reported genetic. New genetic interactions (PSA-based) identified in this study are shown with dashed lines. (B) Spot test analysis confirms the relief of drug sensitivity to LiCl for eap1Δ and bck1Δ by over-expression of YTA6 and YPR096C. Spot test analysis was repeated three times (n = 3) with similar outcomes.

https://doi.org/10.1371/journal.pone.0235033.g007

Supporting information

S1 Fig. Drug sensitivity analysis for different yeast strains on YPD media.

No increased LiCl sensitivity was observed for deletion mutant strains for YTA6 and YPR096C in media containing glucose as a carbon source. Spot test analysis was repeated at least three times (n ≥ 3) with similar outcomes.

https://doi.org/10.1371/journal.pone.0235033.s001

(TIF)

S2 Fig. The secondary structure of PGM2 5’-UTR.

Unlike most yeast ORFs, the 5’ UTR of PGM2 is thought to be structured (38).

https://doi.org/10.1371/journal.pone.0235033.s002

(TIF)

S1 Table. qRT-PCR raw data for different strains with and without LiCl treatment.

Each experiment was repeated at least three times (n ≥ 3).

https://doi.org/10.1371/journal.pone.0235033.s003

(DOCX)

S2 Table. List of mutant strains in gene expression and random arrays.

https://doi.org/10.1371/journal.pone.0235033.s004

(DOCX)

S3 Table. List of negative genetic interactions (nGIs) for YTA6 and YPR096C (no LiCl in media).

https://doi.org/10.1371/journal.pone.0235033.s005

(DOCX)

Acknowledgments

This work is dedicated to the memory of our friend and colleague Fareed Arasteh who lost his life in the Tehran Plane Crash, 2020.

References

  1. 1. Lenox RH, Wang L. Molecular basis of lithium action: integration of lithium-responsive signaling and gene expression networks. Mol Psychiatry. 2003;8:135–44. pmid:12610644
  2. 2. Won E, Kim Y. An Oldie but Goodie: Lithium in the Treatment of Bipolar Disorder through Neuroprotective and Neurotrophic Mechanisms. Int J Mol Sci. 2017;18(12):2679.
  3. 3. Fornaro M, Berardis D De, Anastasia A, Novello S, Fusco A, Ignazio C, et al. The identification of biomarkers predicting acute and maintenance lithium treatment response in bipolar disorder: A plea for further research attention. Psychiatry Res. 2018;269:658–72. pmid:30216918
  4. 4. Ariyasinghe D, Perera SR. The role of lithium in the treatment of bipolar disorder. Sri Lanka J Psychiatry. 2018;28–30.
  5. 5. Yang D, Song L, Hu J, Yin W, Li Z, Chen Y, et al. Biochemical and Biophysical Research Communications Enhanced tolerance to NaCl and LiCl stresses by over-expressing Caragana korshinskii sodium / proton exchanger 1 (CkNHX1) and the hydrophilic C terminus is required for the activity of CkNHX1 in Atsos3. Biochem Biophys Res Commun. 2012;417(2):732–7. pmid:22197553
  6. 6. Sofola-adesakin O, Castillo-quan J., Rallis C, Tain L., Bjedov I, Rogers I, et al. Lithium suppresses A β pathology by inhibiting translation in an adult Drosophila model of Alzheimer ‘ s disease. Front Aging Neurosci. 2014;6(July):1–10.
  7. 7. Castillo-Quan J., Li L, Kinghorn K., Hardy J, Bjedov I, Partridge L. Lithium Promotes Longevity through GSK3 / NRF2- Dependent Hormesis Lithium Promotes Longevity. Cell Rep. 2016;15:638–50. pmid:27068460
  8. 8. Williams RS., Harwood A. Lithium therapy and signal transduction. Trends Pharmacol Sci. 2000;21(2):61–4. pmid:10664610
  9. 9. Montero-Lomelí M, Morais BLB, Figueiredo DL, Neto DCS, Martins JRP, Masuda CA. The initiation factor eIF4A is involved in the response to lithium stress in Saccharomyces cerevisiae. J Biol Chem. 2002;277(24):21542–8. pmid:11940596
  10. 10. Bro C, Regenberg B, Lagniel G, Labarre J, Montero-Lomelí M, Nielsen J. Transcriptional, proteomic, and metabolic responses to lithium in galactose-grown yeast cells. J Biol Chem. 2003;278(34):32141–9. pmid:12791685
  11. 11. Masuda CA, Xavier MA, Mattos KA, Galina A, Montero-Lomeli M. Phosphoglucomutase Is an in Vivo Lithium Target in Yeast. Biol Chem. 2001;276:37794–801.
  12. 12. Liu J., Zhang GC, Kong I., Yun E., Zheng J., Kweon D., et al. A mutation in PGM2 causing inefficient Galactose metabolism in the Probiotic Yeast Saccharomyces boulardii. Appl enviromental Microbiol. 2018;84(10):1–12.
  13. 13. Dichtl B, Stevens A, Tollervey D. Lithium toxicity in yeast is due to the inhibition of RNA processing enzymes. EMBO J. 1997;16(23):7184–95. pmid:9384595
  14. 14. Bergkessel M, Whitworth G., Guthrie C. Diverse environmental stresses elicit distinct responses at the level of pre-mRNA processing in yeast. RNA. 2011;17:1461–78. pmid:21697354
  15. 15. Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, et al. Functional Characterization of the S. cerevisiae Genome by Gene Deletion and Parallel Analysis. Science (80-). 1999;285(5429):901–7.
  16. 16. Gelperin DM, White MA, Wilkinson ML, Kon Y, Kung LA, Wise KJ, et al. Biochemical and genetic analysis of the yeast proteome with a movable ORF collection. Genes Dev. 2005;2816–26. pmid:16322557
  17. 17. Moteshareie H, Hajikarimlou M, Indrayanti AM, Burnside D, Paula A, Id D, et al. Heavy metal sensitivities of gene deletion strains for ITT1 and RPS1A connect their activities to the expression of URE2, a key gene involved in metal detoxification in yeast. Plose one. 2018;13:1–18.
  18. 18. Jessulat M, Malty RH, Nguyen-tran D, Deineko V, Aoki H, Vlasblom J, et al. Spindle Checkpoint Factors Bub1 and Bub2 Promote DNA DoubleStrand Break Repair by Nonhomologous End Joining. mcb. 2015;35(14):2448–63. pmid:25963654
  19. 19. Alamgir M, Jessulat M, Azizi A, Golshani A. Chemical-genetic profile analysis of five inhibitory compounds in yeast. bmc Chem Biol. 2010;10(6).
  20. 20. Samanfar B, Omidi K, Hooshyar M, Laliberte B, Alamgir M, Seal AJ, et al. Large-scale investigation of oxygen response mutants in Saccharomyces cerevisiae. Mol Biosyst. 2013;9(6):1351–9. pmid:23467670
  21. 21. Karlsson-rosenthal C, Millar JBA. Cdc25: mechanisms of checkpoint inhibition and recovery. Trends Cell Biol. 2006;16(6).
  22. 22. Altmann M, Müller P., Wittmer B, Ruchti F, Lanker S, Trachsel H. A Saccharomyces cerevisiae homologue of mammalian translation initiation factor 4B contributes to RNA helicase activity. EMBO J. 1993;12(10):3997–4003. pmid:8404865
  23. 23. Stansfield I, Akhmaloka M, Tuite F. A mutant allele of the SUP45 (SAL4) gene of Saccharomyces cerevisiae shows temperature-dependent aUosuppressor and omnipotent suppressor phenotypes. Curr Genet. 1995;27:417–26. pmid:7586027
  24. 24. Krogan NJ, Kim M, Tong A, Golshani A, Cagney G, Canadien V, et al. Methylation of Histone H3 by Set2 in Saccharomyces cerevisiae Is Linked to Transcriptional Elongation by RNA Polymerase II. mcb. 2003;23(12):4207–18. pmid:12773564
  25. 25. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611–22. pmid:19246619
  26. 26. Szymanski EP, Kerscher O. Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications. J Vis Exp. 2013;80(October):1–9.
  27. 27. Tong A, Evangelista M, Parsons AB, Xu H, Bader GD, Page N, et al. Systematic Genetic Analysis with Ordered Arrays of Yeast Deletion Mutants. Science (80-). 2001;294(December):2364–9.
  28. 28. Toufighi K, Youn J, Ou J, Luis BS, Hibbs M, Hess D, et al. Quantitative analysis of fitness and genetic interactions in yeast on a genome scale. Nat Methods. 2011;7(12):1017–24.
  29. 29. Wagih O, Usaj M, Baryshnikova A, Vandersluis B, Kuzmin E, Costanzo M, et al. SGAtools: one-stop analysis and visualization of array-based genetic interaction screens. Nucleic Acids Res. 2013;41(May):591–6.
  30. 30. Memarian N, Jessulat M, Alirezaie J, Mir-Rashed N, Xu J, Zareie M, et al. Colony size measurement of the yeast gene deletion strains for functional genomics. BMC Bioinformatics. 2007;8(117).
  31. 31. Sopko R, Huang D, Preston N, Chua G, Papp B, Kafadar K, et al. Mapping pathways and phenotypes by systematic gene overexpression. Mol Cell. 2006;21:319–30. pmid:16455487
  32. 32. Douglas AC, Smith AM, Sharifpoor S, Yan Z, Durbic T, Heisler LE, et al. Functional Analysis With a Barcoder Yeast Gene Overexpression System. G3 Genes|Genomes|Genetics. 2012;2(10):1279–89. pmid:23050238
  33. 33. Samanfar B, Shostak K, Moteshareie H, Hajikarimlou M, Shaikho S, Omidi K, et al. The sensitivity of the yeast, Saccharomyces cerevisiae, to acetic acid is influenced by DOM34 and RPL36A. PeerJ. 2017;2017(11).
  34. 34. Samanfar B, Tan LH, Shostak K, Chalabian F, Wu Z, Alamgir M, et al. A global investigation of gene deletion strains that affect premature stop codon bypass in yeast, Saccharomyces cerevisiae. Mol Biosyst. 2014;10(4):916–24. pmid:24535059
  35. 35. Omidi K, Jessulat M, Hooshyar M, Burnside D, Schoenrock A, Kazmirchuk T, et al. Uncharacterized ORF HUR1 influences the efficiency of non-homologous end-joining repair in Saccharomyces cerevisiae. Gene. 2018;639:128–36. pmid:28987344
  36. 36. Phiel CJ, Klein PS. Molecular Targets of Lithium Action. Annu Rev Pharmacol Toxicol. 2001;41:789–813. pmid:11264477
  37. 37. Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, Gerstein M, et al. The Transcriptional Landscape of the Yeast Genome Defined by RNA Sequencing. Science (80-). 2008;320(June):1344–50.
  38. 38. Tuller T, Ruppin E, Kupiec M. Properties of untranslated regions of the S. cerevisiae genome. BMC Genomics. 2009;10(391).
  39. 39. Cuperus JT, Groves B, Kuchina A, Rosenberg AB, Jojic N, Fields S, et al. Deep learning of the regulatory grammar of yeast 5 ′ untranslated regions from 500, 000 random sequences. Genome Res. 2017;27:2015–24. pmid:29097404
  40. 40. Bolinger C, Sharma A, Singh D, Yu L. RNA helicase A modulates translation of HIV-1 and infectivity of progeny virions. Nucleic Acids Res. 2010;38(5):1686–96. pmid:20007598
  41. 41. Washietl S, Hofacker IL, Lukasser M, Hüttenhofer A, Stadler PF. Mapping of conserved RNA secondary structures predicts thousands of functional noncoding RNAs in the human genome. Nat Biotechnol. 2005;23(11):1383–90. pmid:16273071
  42. 42. Omidi K, Hooshyar M, Jessulat M, Samanfar B, Sanders M, Burnside D, et al. Phosphatase Complex Pph3 / Psy2 Is Involved in Regulation of Efficient Non-Homologous End-Joining Pathway in the Yeast Saccharomyces cerevisiae. Plose one. 2014;9(1).
  43. 43. Hendry JA, Tan G, Ou J, Boone C, Brown GW. Leveraging DNA Damage Response Signaling to Identify Yeast Genes Controlling Genome Stability. G3 Genes|Genomes|Genetics. 2015;5(May):997–1006.
  44. 44. Ooi SL, Pan X, Peyser BD, Ye P, Meluh PB, Yuan DS, et al. Global synthetic-lethality analysis and yeast functional profiling. Trends Genet. 2006;22(1):56–63. pmid:16309778
  45. 45. Boone C, Bussey H, Andrews BJ. Exploring genetic interactions and networks with yeast. Nat Rev Genet. 2007;8(6):437–49. pmid:17510664
  46. 46. Li X, Ohmori T, Irie K, Kimura Y, Suda Y, Mizuno T, et al. Different Regulations of ROM2 and LRG1 Expression by Ccr4, Pop2, and Dhh1 in the Saccharomyces cerevisiae Cell Wall Integrity Pathway. mSphere. 2016;1(5).
  47. 47. Castelli LM, Lui J, Campbell SG, Rowe W, Zeef LAH, Holmes LEA, et al. Glucose depletion inhibits translation initiation via eIF4A loss and subsequent 48S preinitiation complex accumulation, while the pentose phosphate pathway is coordinately up-regulated. Mol Biol Cell. 2011;22(15):3379–93.
  48. 48. Blewett NH, Goldstrohm AC. A Eukaryotic Translation Initiation Factor 4E-Binding Protein Promotes mRNA Decapping and Is Required for PUF Repression. mcb. 2012;32(20):4181–94. pmid:22890846
  49. 49. Fischer N, Weis K. The DEAD box protein Dhh1 stimulates the decapping enzyme Dcp1. EMBO J. 2002;21(11):2788–97. pmid:12032091
  50. 50. Carroll JS, Munchel SE, Weis K. The DExD/H box ATPase Dhh1 functions in translational repression, mRNA decay, and processing body dynamics. cell Biol. 2011;194(4):527–37.