Figures
Abstract
Toxoplasma gondii (T. gondii) is a protozoan parasite that infects all warm-blooded animals including domesticated birds and humans. Birds normally get infected by ground feeding and human beings contract the disease by consumption of undercooked chicken meat. This study aimed to analyze seroprevalence and DNA of T. gondii in chickens (domesticated and broiler) and to assess possible transfer to humans by review of available literature from Pakistan. Blood from and tissues from domesticated and broilers chickens were analyzed for Toxo-IgM/IgG and Toxoplasma DNA through ELISA and PCR respectively. Furthermore, research articles published during 1990–2019 on the prevalence of T. gondii in humans from Pakistan, were analyzed to assess the possible infection burden in the area in connection to transmission from chickens. The overall prevalence of IgM and IgG for T. gondii was 17.83% and 8.8% respectively in the study areas. Significant seroprevalence was found in domesticated chickens than broilers. In domesticated chickens, the prevalence was high in age ≥ 2 years. Toxoplasma DNA was detected in tissues with an overall prevalence of 10.84%. Higher prevalence was observed in liver (10.50%) than heart (9.5%) and muscles (7.11%). Only 4.78% broiler and 2.38% domesticated chickens were positive for both IgM and DNA, 1.2% domesticated and 1.30% broilers were positive for IgG and DNA, while 2.98% domesticated and 2.17% broilers were positive for IgM, IgG, and DNA. Available literature showed that 25.8% of human beings were infected with T. gondii in Pakistan. The prevalence was 20.64% in male and 26.82%in the female. The rate of infections increases with age and high (37.36%) was found in humans of age range 40 to 60 years. A high prevalence of T. gondii is found in both domesticated and broiler chickens in the study area. Moreover, the literature survey indicates that a high seroprevalence of T. gondii is present in human beings of Pakistan. It is concluded that the high prevalence of T. gondii in humans may be associated with the parasite transmission through infected chicken’s meat in Pakistan.
Citation: Khan MB, Khan S, Rafiq K, Khan SN, Attaullah S, Ali I (2020) Molecular identification of Toxoplasma gondii in domesticated and broiler chickens (Gallus domesticus) that possibly augment the pool of human toxoplasmosis. PLoS ONE 15(4): e0232026. https://doi.org/10.1371/journal.pone.0232026
Editor: Gheyath K. Nasrallah, Qatar University, QATAR
Received: October 26, 2019; Accepted: April 6, 2020; Published: April 22, 2020
Copyright: © 2020 Khan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting Information files.
Funding: The author(s) received no specific funding for this work.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Toxoplasmosis is a zoonotic disease caused by a unicellular, protozoan parasite Toxoplasma gondii (T. gondii). It is a cyst-forming coccidian parasite and exists in three infectious morphological forms; i) an aggressive and quickly dividing tachyzoite stage, ii) slowly dividing semi-dormant bradyzoite stage within tissue cysts [1,2] and iii) an environmentally resistant sporozoite stage within oocysts. Sporulated oocysts survive for a long time under moderate environmental conditions and can infect all warm-blooded animals including birds and humans [3–5]. About one-third of the human population is infected by T. gondii, causing various complications like microcephaly, hydrocephaly, chorido-retinitis, mental health disorders [1] severe congenital pathologies and spontaneous abortion, or stillbirth [6]. Even in developed countries like the USA, annually 400–4000 infants are born with congenital toxoplasmosis and reports showed complications like schizophrenia, depression, and obsessive-compulsive disorder which are linked to T. gondii [7].
Various domesticated and farm animals and birds harbor infection and maybe a potent source of transmission to humans. T. gondii prevalence in different birds has been reported from various countries [8]. It is possibly transmitted to birds through food taken from the ground contaminated with oocysts. Free-range (domesticated) chickens may get infected with T. gondii during feed on the contaminated ground/soil with cat feces and excreta of domesticated animals. Broiler chickens may also become infected due to poor hygienic conditions in poultry farms [9]. Humans become infected by use of contaminated water and consumption of oocysts contaminated food. Direct consumption of undercooked chicken meat or meat products may be a possible way of T.gondii transmission to humans [10].
Humans consume meat as the main source of protein and global annual per capita meat consumption is expected to reach 35.3 kg by 2025. In Pakistan 1.02 billion broiler chickens are produced annually and it ranks the 11th largest poultry producer in the world. In Pakistan poultry is the cheapest and favorite source of meat which contributes about 28% of the total meat production [11,12], so to meet the increasing demand of protein to the population, the pressure on the livestock industry is also increasing. It is estimated that per capita meat consumption in Pakistan increased from 11.7 kg in 2000 to 32 kg in 2016, almost double what was predicted that it will increase to 47 kg by 2020 [11]. It is reported that about 50% of all human T. gondii infections are foodborne [13], and 30–63% of infections are associated with the consumption of meat [1]. Some recent reports from Pakistan showed the prevalence of T. gondii in human population range from 12–28% [14–16]. This study was, therefore, designed to analyze T. gondii in blood and tissues of domesticated and broiler chickens and to associate it with the prevalence of infection in human beings in the study area.
Materials and methods
Study area
Two districts (Upper Dir and Peshawar) of Khyber Pakhtunkhwa province, Pakistan, were selected for this study. The district Upper Dir lies between 35°-04 to 35°-46 North latitudes and 71°-32 to 72°-22 East longitudes. The mean maximum and minimum temperature during June is about 33°C and 16°C respectively. The summer season of district Upper Dir is moderate and warm with June and July as the hottest months. The winter season is very cold and severe. The temperature rapidly falls from November till the end of March. During December-to February temperature falls below freezing point. The district Peshawar lies between 33°-44 and 34°-15 North latitudes and 71°-22 and 71°-42 East longitudes. Winter months in Peshawar start from mid-November and lasts till the end of March. The summer months are from May to September. The mean range of temperature in summer is 25–40°C [17]. The above mentioned two districts were selected because of different climatic conditions, cat densities and meat feeding habits of people. Blood and tissues were collected and analyzed at Molecular Biology and Virology Laboratory Department of the Zoology University of Peshawar, Khyber Pakhtunkhwa, Pakistan.
Ethical approval
This study was approved by the Ethical Committee of the Center of Biotechnology and Microbiology, and Advanced Studies and Research Board University of Peshawar Khyber Pakhtunkhwa Pakistan. Prior verbal consent was taken from each farmer before samples and data collection.
Sample and data collection
Data regarding food, feeding and living habit, cat presence in the vicinity, etc. was collected from farmers through a predesigned questionnaire. About 2mL blood was collected in a kindly manner to minimize pain from the jugular vein through a sterile syringe from 398 chickens (168 domesticated free-range and 230 broilers). The serum was separated and stored at -20°C until use.
Tissue samples were collected from 295 chickens (65 domesticated and 230 broilers) from which serum was already collected, in sterile plastic bags and transferred in cold box to the laboratory for further analysis. Domesticated chickens were purchased and slaughtered with a sharp knife without stunning in a humanely way and tissues (liver, heart, and pectoral muscle) were isolated, while tissues of broiler chickens were collected from poultry meat shops where chickens were slaughtered (with a sharp knife without stunning) and sold for commercial purposes.
Serological examination
ELISA was performed using Bio-ELISA Toxo-IgM and IgG kits (Biokit, S.S. Barcelona Spain) according to the supplier’s instructions.
DNA Extraction, amplification, and detection
The tissue specimen (~200mg) was macerated with a mortar and pestle in liquid nitrogen and then DNA was isolated using a DNA extraction kit (DNAzol® Reagent Thermo Fisher USA) according to the manufacture’s protocol. A highly conserved 35- fold repeats of the B1 gene of T. gondii DNA was amplified through nested PCR, using gene-specific primers (Toxo B22 (F): 5′AACGGGCGAGTAGCACCTGAGGAG′3) and (Toxo B23 (R): 5′TGGGTCTACGTCGATGGCATGACAAC′3) according to the method described by Sadek et al. [18]. Briefly, a PCR reaction of 20μL consisted of 10X Taq buffer, 1.2mM of MgCl2, 2μM of each primer, 0.2μM of each dNTP, 1U of Taq DNA polymerase (Thermo Fisher USA) and 5μL extracted DNA. Samples were initially incubated at 95°C for 5min, then 30 cycles of 95°C for the 30s, 60°C for 30s, 72°C for 60s and finally at 72°C for 10 minutes. The amplified DNA fragment of115bp (S1 Fig) was electrophoresed in 2% agarose gel, and visualized under UV light transillumination.
Literature search
To find out the prevalence of T. gondii in humans, research articles were searched by using terms like Toxoplasma gondii, T. gondii, Human Toxoplasmosis, Seroprevalence, ELISA, PCR, and Pakistan. The articles were searched by using search engines like Google Scholar, Pubmed and Science Direct, which were published on the prevalence of T. gondii in humans, from the year 1990 to 2019. Forty-two research articles, relevant to the research work, were analyzed for T. gondii prevalence in humans in different provinces [Khyber Pakhtunkhwa (N = 20), Punjab (N = 18), Sindh (N = 3) and Baluchistan (N = 1)] of Pakistan. Of the total, only 37 could fulfill the required criteria and were included in this study.
Results
Seroprevalence of T. gondii in chickens
Of the total chickens, 17.83% (71) were IgM and 8.8% (35) were IgG positive while 5.77% (23) were both IgM and IgG positive. In domesticated chickens, 26.2% (44) were IgM and 14.88% (25) were IgG positive, while out of broiler chickens, 11.73% (27) were IgM and 4.34% (10) were IgG positive. Significantly (P = 0.02) high seroprevalence was found in domesticated chickens as compared to broiler chickens. In domesticated chickens, significantly high prevalence (P = 0.01) was found in female chickens (28.7% IgM, 16.7% IgG) as compared to males (21.7% Ig, 11.7% IgG). In broilers chickens, no significant difference was found in females (11.12% IgM, 5.18% IgG) and male (12.63% IgM, 3.5% IgG). In the current study, the prevalence rate increased with age significantly (P = 0.03) and high prevalence was found in domesticated chickens of age more than two years and in broilers of age more than 90–120 days. In domesticated chickens, high seroprevalence [IgM (28.7%), IgG (16.67%)] was observed in district Dir as compared to [IgM (21.67%), IgG (11.67%)], but the case was opposite in broiler chickens, where seroprevalence [IgM (8%), IgG (3%)] was low in Dir than Peshawar [IgM (14.61%), IgG (5.38%)] (Table 1).
Evaluation of chickens’ tissues for T. gondii DNA
Of the total tissue samples (65 domesticated and 230 broilers) 10.84% (32) were found positive for Toxo-DNA. Non-significant (P = 0.25) high prevalence (10.50%) of Toxo-DNA was observed in the liver as compared to heart (9.5%) and pectoral muscles (7.11%). Comparatively, the high prevalence was found in tissues of domesticated chickens as compared to broiler chickens. Toxo-DNA was detected in 9.32% (11/118) male chickens and 11.87% (21/177) female chickens. High prevalence was found in females of both domesticated and broiler chickens (Table 2).
Comparison of Toxo-antibodies and Toxo-DNA in chickens
Based on the overall results obtained, eight categories to compare antibodies and DNA absence/presence in domesticated and broiler chickens. Of the total Toxo-DNA detected in tissues 20% were in domesticated and 8.26% in broiler chickens. About 2.98% domesticated and 2.17% broiler chickens were positive for IgM/IgG and PCR. Complete results of all the eight categories are given in Table 3.
Risk factors associated prevalence of T. gondii in chickens
The highest prevalence (40%) was found in those domesticated chickens living in the vicinity of cats. The overall T. gondii prevalence was found in domesticated chickens that were ground feeders and free-living. Low prevalence was found in the broiler chickens, as they were normally caged with no direct contact with cats, and fed in special pots (Table 4).
T. gondii in humans: A literature review
Prevalence of T. gondii in humans was 25.8% (3636/14098), analyzed from available research articles (N = 41) from Pakistan. Overall, high prevalence (26.82%, 3150/11744) was observed in females as compared to males (20.64%, 486/2354).
Of the total, 21 research articles presented data of Khyber Pakhtunkhwa province, in which 16 articles showed data according to age. Male to female infection ratio was 1:8.1 and high prevalence was (32% was found in the age group 41–60 years. Overall, 19.8% (231/1168) males and 25.72% (1191/4630) females were positive for T. gondii reported from Punjab province. Of the total 16 articles from Punjab, only 14 mentioned age-relevant prevalence. In Sindh province, 40.22% (35/87) males and 47% (171/364) females were positive, while in Balochistan only five females were reported positive. Articles presented data of Sindh and Baluchistan did not show age-wise prevalence (Table 5).
Discussion
The chicken’s tissues can harbor T. gondii, promoting zoonotic transmission by consuming raw or undercooked meat [1]. In Pakistan, grilled chicken is a food of choice and traditionally free-range chicken is considered the healthiest and wholesome meat especially recommended for pregnant women and inevitably leads to public health risks. Free-range chickens can get T. gondii from contaminated soil during feed and are potential risks to humans [8]. About one third of the global population are positive for T. gondii antibodies [53], indicating worldwide spread [54]. Meat-borne infection previously reported from some countries was approximately 30% to 63% and was linked to eating habits, environment, housing as well as climatic conditions [54,55]. It is important to uncover the parasite pervasiveness in understanding the transmission patterns between man and animals [56]. The present study analyzed chickens and their tissues as a possible risk of T. gondii transmission to humans. It is observed that domesticated chickens harbored more T. gondii infection than broiler chickens. The high prevalence, in domesticated chickens, may be due to their frequent contact with cats and ground feeding. The low prevalence in broiler chickens may be attributed to their confinement, fast-breeding and few chances of contact with reservoir animals like cats [6,8]. However, it is also alarming that 10% of broiler chickens were positive for T. gondii and indicates flaws in existing poultry management and hygiene which needs improvement in the study area. It is also investigated during meta-analysis of bird toxoplasmosis in Iran that industrially raised chickens were significantly less infected as compared to free-range birds as their food and water were free of parasites and rare contact with cats or other animals [53].
Serum IgG and IgM immune assays are used to differentiate chronic and acute infection and population surveillance of T. gondii [7]. In the current study, 17.83% of chickens were found positive for IgM, 8.8% for IgG and 5.77% were both IgM and IgG positive. In the current study gender-wise prevalence in domesticated chickens were significantly (χ2 = 0.01, P<0.05) higher in females (28.7% IgM, 16.7% IgG) than males (21.7% IgM, 11.7% IgG). These findings are similar to those previously reported from different regions of the country [9,55]. Studies from different parts of the world have demonstrated parallel findings in other animals such as mice [57], dogs [58], goats [56,59], cats [53] and sheep [59]. The investigations demonstrated that gender influenced the incidence, severity, and course of T. gondii infection especially in female mice with severe brain inflammation [60], and severe combined immunodeficiency [61], while enhanced innate immune responses were reported in males [62]. It is also showed that the gender-based difference in responses to T. gondii is due to hormonal profiles [51,54,57,63], and reduced females immunity due to nutrition [63,64], age [54, 63], reproductive and certain environmental factors [7, 63,64].
In the current study, the prevalence of T. gondii was found to increase significantly (χ2 = 0.03, P<0.05) with age and high prevalence (28%) was found in domesticated chickens more than two years and 15.62% in broiler chickens old 90 days to 120 days. An increase in prevalence with age was also described in the previous studies, where older birds were at risk of exposure and more opportunities to come in contact with the contaminated environment than the younger ones [1,56,63,65,66]. High prevalence in older animals may also be due to their weak immune systems than younger animals [57].
Geography and environment also play an important role and considered major risk factors in the distribution of T. gondii infection [67]. In this study, high prevalence (28.7% IgM, 16.67% IgG) was observed in domesticated chickens from district Upper Dir when compared to Peshawar district (21.67% IgM, 11.67% IgG). District Upper Dir has high annual rainfall, and humidity which are considered favorable for the survival of T. gondii oocysts [1,65]. On the other hand, high prevalence of T. gondii in broiler chickens (14.61% IgM, 5.38%IgG) was reported from Peshawar as compared to district Upper Dir (8% IgM, 3% IgG), and it may be due to their excessive use, hygienic condition and dry climate which influence on the sporulation of oocysts in the environment [1]. The current study findings of the two different districts are in line with other studies who attributed prevalence in different geographical areas may be due to different social and cultural habits, sample size, and age, chicken housing, hygienic standards, drinking water type, cat densities, type of confinement, ecological and climatic conditions, and annual rainfall [1,63,68,69].
In this study, an overall 10.84%, Toxo-DNA was detected by PCR in the tissues of chickens. Toxo-DNA prevalence (10.84%.) of the current study is higher than reported from neighboring countries like India (6.06%) [70] and Iran (8%) [71], but lower than reported from Kenya (24–79%) [63, 72], and Iraq (26.9%) [73]. The change in prevalence might be due to the differences in geography, climate, the number and age of chickens examined, and sanitation conditions [68]. The highest prevalence (20%) was detected in the meat of domesticated chickens due to their free-living habit and possibly higher chance of contact with cat feces [1,9,63,71]. A high prevalence (10.50%) of Toxo-DNA was found in the liver tissues followed by heart and muscle (9.5% and 7.11%, respectively). The prevalence of the pathogen in chicken’s muscles of the current study was almost similar to a study from Canada [74] but lower from that of Brazil [75]. In the current study, T. gondii prevalence was more in older chickens and in those who were in contact with cats, free-living, and ground feeders, supported the investigations that cats, the only host can shed oocysts (resistant stage) in the feces hence increases the chances of T. gondii infection [4,5].
The prevalence of T. gondii in humans in Pakistan, assessed from literature was 25.8%. A high prevalence of 26.82% was found in human females as compared to 20.64% in males. Prevalence was found to increase with age and a high prevalence of 37.36% was found in humans of age range 40 to 60 years.
Pakistan is ranked in the largest poultry producer countries and also chicken is the easiest source of meat, contributes about 28% in the total meat production [11,12]. The increasing trends of chicken consumption [11] seem an increase in the chances of T. gondii transmission to the consumers. Previously, it is reported about 50% of all human T. gondii infections are linked to various food [13], meat contributed about 30–63% of infections [1]. It is worthwhile that the rise in chicken consumption in Pakistan [11,12] and the current study findings of high prevalence in chickens and humans may be associated with the possible transmission of T. gondii to humans.
Conclusion and recommendations
High seroprevalence and Toxo-DNA were observed both in domesticated and broiler chickens. Furthermore, the literature review showed that toxoplasmosis is prevalent in humans in Pakistan. It is also concluded that the high prevalence of T. gondii in humans may be associated with the parasite transmission through infected chicken’s meat. The study suggests that chicken should be kept in a clean area and limit their contact with cats to reduce the chances of parasite transmission. Humans should avoid eating raw and undercooked chicken meat.
Supporting information
S1 Fig. Amplified DNA (115bp) of T. gondi: Left to right Lane 1& 3–6 positive, Lane 2 negative, Lane 7 negative control (distilled water), Lane 8 ladder marker (100bp).
https://doi.org/10.1371/journal.pone.0232026.s001
(PDF)
References
- 1. Tenter AM, Heckeroth AR, Weiss V. Toxoplasma gondii: From animal to human. Int J Parasitol. 2000; 30:1217–1258. pmid:11113252
- 2. Ferguson DJ. Use of molecular and ultra-structural markers to evaluate stage conversion of Toxoplasma gondii in both the intermediate and definitive host. Int J Parasitol. 2004; 34:347–360. pmid:15003495
- 3.
Frenkel JK. Biology of Toxoplasma gondii. Paris Springer Verlag. 2000; 9–25.
- 4. Sibley LD, Khan A, Ajioka JW, Rosenthal BM. Genetic diversity of Toxoplasma gondii in animals and humans. Philos Trans R Soc Lond B Biol Sci. 2009; 364:2749–2761. pmid:19687043
- 5. Abdel-Shafy S, Shaapan RM, Abdelrahman KA, El- Namaky AH, Abo-Aziza FAM, Zeina HAA. Detection of Toxoplasma gondii Apicomplexa: Sarcocystidae in the Brown Dog Tick Rhipicephalus sanguineus Acari: Ixodidae Fed on Infected Rabbits. Res J Parasitol. 2015; 10:142–150.
- 6. Krueger WS, Hilborn ED, Converse RR, Wade TJ. Drinking water source and human Toxoplasma gondii infection in the United States: a cross sectional analysis of NHANCES data. BMC Public Health. 2014; 14:711. pmid:25012250
- 7. Egorov AI, Converse R, Griffin SM, Styles J, Klein E, Sams E, et al. Environmental risk factors for Toxoplasma gondii infections and the impact of latent infections on allostatic load in residents of Central North Carolina. BMC Inf Dis. 2018; 181: 421.
- 8. Dubey JP. Toxoplasma gondii Infections in Chickens Gallus domesticus: Prevalence, Clinical Disease, Diagnosis and Public Health Significance. Zoonoses Public Health. 2010; 57:60–73.
- 9. Mahmood Z, Zahid M, Sthanadar AA, Shah M, Hussain A. Seroprevalence of Toxoplasma gondii Infection in Gallus domesticatedus of District Mardan, Khyber Pakhtunkhwa, Pakistan. Pak J Zool. 2014; 466:1705–1710.
- 10. Dubey JP, Jones JL. Toxoplasma gondii infection in humans and animals in the United States. Int J Parasitol. 2008; 38:1257–1278. pmid:18508057
- 11. Sohaib M, Jamil F. An Insight of Meat Industry in Pakistan with Special Reference to Halal Meat: A Comprehensive Review. Korean J Food Sci Anim Resour. 2017; 37(3):329–341. pmid:28747818
- 12. Smil V. Eating meat: Constants and changes. Global Food Sec. 2014; 3:67–71.
- 13. Slifko TR, Smith HV, Rose JB. Emerging parasite zoonoses associated with water and food. Int J Parasitol. 2000; 30:1379–1393. pmid:11113263
- 14. Latif AA, Mushtaq S, Fazal S, Mansha M, Yaqub A. Seroprevalence of Toxoplasma gondii among Pregnant Women in Lahore, Pakistan. Biologia. 2017; 63(2):141–146.
- 15. Nazir MM, Akhtar M, Maqbool A, Waheed A, Sajid MA, Ali MA, et al. Antibody Prevalence and Risk Factors for Toxoplasma gondii Infection in Women from Multan, Pakistan. Zoonoses and Public Health. 2017; 647:537–542.
- 16. Majid A, Khan S, Jan AH, Taib M, Adnan M, Ali I, et al. Chronic toxoplasmosis and possible risk factors associated with pregnant women in Khyber Pakhtunkhwa. Biotech & Biotechnological Equipment. 2016; 304:733–736.
- 17.
Pakistan District Census Report, 1998.
- 18. Sadek OA, Zeinab M, Hameed A, Kuraa HM. Molecular detection of Toxoplasma gondii DNA in raw goat and sheep milk with discussion of its public health importance in Assiut. Assiut Vet Med J. 2015; 61:145.
- 19. Aleem U, Sanaullah Qasim M, Suliman M. Seroprevalence of Toxoplasmosis in Pregnant Women in Matta, Upper Swat, Khyber Pakhtunkhwa Pakistan. JSMC. 2018; 8(2):103–106.
- 20. Jan H, Haroon M, Faisal S, Kamal A, Khan MT, Ahmad K, et al. Sero-epidemiology of human Toxoplasma gondii infection among male population in Charsadda, KPK, Pakistan. Int J Biosci. 2018;12(4):110–116.
- 21. Kalimullah Adnan M, Khan A, Gul N, Gohar F, Irfanullah. Seroprevalence of Toxoplasma gondii in women and children of District Peshawar, Khyber Pakhtunkhwa, Pakistan. Pak J Parasit. 2017; 64.
- 22. Khan F, Rooman M, Rehman H, Rab A, Khan A, Rehman A, et al. Prevalence of Toxoplasma gondii antibodies among pregnant women in District Bannu, Khyber Pakhtunkhwa, Pakistan. Int J Biosci. 2018; 12(5):235–239.
- 23. Khan SN, Khan S, Ayaz S, Jan AH, Jehangir S, Attaullah S, et al. Seroprevalance and Risk Factors of Toxoplasmosis among Pregnant Women in District Kohat, Khyber Pakhtunkhwa Pakistan. World Appli Sci J. 2011; 14(7):1032–1036.
- 24. Shah H, Saeed M, Naz F, Jan A, Roohullah Khan SFA, et al. Seroprevalence and Risk Factors of Toxoplasmosis among Women in District Chitral, Khyber Pakhtunkhwa, Pakistan. World J Zoo. 2016; 11(3):135–140.
- 25. Sadiqui S, Shah SRH, Almugadam BS, Shakeela Q, Ahmad S. Distribution of Toxoplasma gondii IgM and IgG antibody seropositivity among age groups and gestational periods in pregnant women. F1000Research. 2018; 7:18237.
- 26. Faisal Alvi I, Khan A, Waqar M, Ahmad T, Shah T, et al. Distribution of Toxoplasma gondii in the Pregnant Women of District Swabi Khyber Pakhtunkhwa Pakistan. World App Sci J. 2014; 29(1):77–79.
- 27. Khattak MNK, Iltaf M, Rehman AU, Malik S, Zahid M. Prevalence, socio-demographic determinants and risk factors of toxoplasmosis: case-control study in a rural community of Mardan district, northern Pakistan. The J Anim Plant Sci. 2017; 27(2):617–626.
- 28. Shah N, Tanzeela Khan A, Khisroon M, Adnan M, Jawad SM. Seroprevalence and risk factors of toxoplasmosis in pregnant women of district Swabi. Pure Appl Biol. 2017; 6(4):1306–1313.
- 29. Khattak AM, Khan J, Rahman H. Seropositivity of Toxoplasma gondii latent infection in patients with neuropsychiatric disorders. KMUJ. 2015; 7(1).
- 30. Zeb MA, Jamal SF, Mir A, Khan AA, Amanullah. Frequency of Torch Infections during Pregnancy in Peshawar, Pakistan. AdvAppl Sci Res. 2018; 9(1):22–26.
- 31. Khan F, Rooman M, Hameed Ur–Rehman, Rab A, Faiz Ur-Rehman, Abid Ur-Rehman, et al. Seroprevalence of toxoplasmosis in human (Homo sapien) population of District Bannu Khyber Pakhtunkhwa (KP), Pakistan. Int J Biosci. 2018; 12(5):255–264.
- 32. Shah M, Zahid M, Attaullah S. Serological evidence and associated risk factors of toxoplasmosis among pregnant women in District Mardan, Khyber Pakhtunkhwa, Pakistan. Int J Biosci. 2018; 13(2):177–184.
- 33. Naila G, Shehzad Z, Faiz Ur-Rehman, Hameed Ur-Rehman, Sumbel Q, Sumiya K, et al. Risk factors for Toxoplasma gondii infection in Kohat District, Pakistan. Asian Pac J Trop Dis. 2017; 7(1):30–31.
- 34. Khan MZ, Saleem Ur-Rahman, Gul N, Khan AA. Toxoplasmosis; seroprevalence, comparative analysis of diagnostic techniques and identification of risk factors in humans in Malakand Agency, Khyber Pakhtunkhwa, Pakistan. Int J Biosci. 2014; 5(4):1–6.
- 35. Shah M, Zahid M, Sthanadar AA, Ali PA. Seroprevalence of Toxoplasma gondii Infection in Human Population of Mohmand Agency Khyber Pakhtunkhwa, Pakistan. Pakistan J Zool. 2014; 46(4):1169–1172.
- 36. Abdul Bari. Toxoplasmosis among pregnant women in northern parts of Pakistan. 1990; pp288–289.
- 37. Ahmad N, Khan IA, Iqbal Z, Naseem AA, Kayani AR, Afshan K,et al. Seroepidemiology of Toxoplasmosis in Human population with reference to its zoonotic potential in subtropical areas of Pakistan. Pak Vet J. 2019; 39(2):211–215.
- 38. Sheikh MA, Karim S, Malik A. Detection of Toxoplasma Antibodies (lgG, lgM) in Pregnant Women With Bad Obstetric History. Proceedings SZPGMI. 1999; 13(3–4):83–86.
- 39. Ahmad MS, Maqbool A, Mahmood-ul-Hassan M, Mushtaq-ul-Hassan M, et al. Prevalence of Toxoplasma gondii antibodies in human beings and commensal rodents trapped from Lahore, Pakistan. The J Anim Plant Sci. 2012; 22(1):51–53.
- 40. Arshad M, Cheema KJ, Malik HJ, Sajjad S. Seroepidemiology of Toxoplasma gondii infection among human population in Lahore. Int J Biosci. 2017; 10(3):192–198.
- 41. Chaudhary ZI, Ahmed RS, Hussain SMI, Shakoori AR. Detection of Toxoplasma gondii Infection in Butchers and Buffaloes by Polymerase Chain Reaction and Latex Agglutination Test. Pakistan J Zool. 2006; 38(4):333–336.
- 42. Tasawar Z, Aziz F, Lashari MH, Shafi S, Ahmad M, Lal V, et al. Seroprevalence of Human Toxoplasmosis in Southern Punjab, Pakistan. Pak J Life Soc Sci. 2012;10(1):48–52.
- 43. Tasawar Z, Raza AA, Aziz F, Lashari MH. Prevalence of human Toxoplasmosis in District Muzaffargarh, Punjab, Pakistan. Gomal J Med Sci. 2012; 10:1.
- 44. Hayat S, Tasawar Z, Akhtar T. Seroprevalence of human toxoplasmosis in Kallarwali village of district Muzaffar Garh, Pakistan. Gomal J Med Sci. 2014;12:129–32.
- 45. Tabassum R. Seroprevalence and hematological investigation of toxoplasmosis in female population of Lahore, Pakistan. J Infect Dis Ther. 2018; 6.
- 46. Lodhi MS, Khan MA, Ahmad M. Seroepidemiological study of Toxoplasma gondii infection among women of child bearing age. JAMC. 1993; 6(2).
- 47. Shahzad A, Khan MS, Ashraf K, Avais M, Pervez K, Khan JA. Sero-epidemiological and haematological studies on toxoplasmosis in cats, dogs and their owners in Lahore, Pakistan. J Protozool Res. 2006;16:60–73.
- 48. Pal RA, Qayyum M, Yaseen M. Seroprevalence of antibodies to Toxoplasma gondii, with particular reference to obstetric history of patients in Rawalpindi—Islamabad, Pakistan. J Pak Med Assco;1996:56–58.
- 49. Sadaruddin A, Agha F, Anwar F, Ghafoor A. Seroepidemiology of Toxoplasma gondii infection in young school children in Islamabad. J Pak Med Assco; 1991:131–134.
- 50. Tasawar Z, Nawaz S, Lashari MH, Aziz F, Hayat S. Seroprevalence of human toxoplasmosis in Dera Ghazi Khan, Punjab. Gomal J Med Sci. 2011; 9(1).
- 51. Hussain R, Jarnil S, Dockrel HM, Chiang TJ, Hasan R. Detection of high titres of Toxoplasma gondii antibodies in sera of patients with leprosy in Pakistan. Trans R Soc Trop Med Hyg. 1992;86:259–262. pmid:1412648
- 52. Ahmad M, Amtul H. Surveillance of Toxoplasmosis in different groups. J Pak Med Assco;1990:183–186.
- 53. Shokri Sharif M, Teshnizi SH, Sarvi S, Rahimi MT, Mizani A, et al. Birds and poultries toxoplasmosis in Iran: A systematic review and meta-analysis. Asian Pacific J Trop Med. 2017;10(7):635–642.
- 54. Smith JL. Long-Term Consequences of Foodborne Toxoplasmosis: Effects on the Unborn, the Immuno-compromised, the Elderly, and the Immuno-competent. J Food Prot. 1997; 60(12):1595–1611. pmid:31207758
- 55. Schlundt J, Toyofuku H, Jansen J, Herbst SA. Emerging food-borne zoonoses. Int des Epizooties. 2004; 23:513–533.
- 56. Akhtar M, Ahmad AAA, Awais MM, Saleemi MK, Ashra K, Hiszczynska-Sawicka E. Seroprevalence of Toxoplasma gondii in the Backyard Chickens of the Rural Areas of Faisalabad, Punjab, Pakistan. Int J Agri Bio. 2014;166:1105–1111.
- 57. Roberts CW, Walker W, Alexander J. Sex associated hormones and immunity to protozoan parasites. Clin Microbiol Rev. 2001;14:476–488. pmid:11432809
- 58. Bharathi MV, Kandavel E, Nedunchelliyan S, Muralimanohar B, Kumanan K. Prevalence of Toxoplasma antibodies by using modified direct agglutination test in dogs in Chennai. J Vet Parasitol. 2011;25:162–164.
- 59. Ramzan M, Akhtar M, Muhammad F, Hussain I, Sawicka EH, Haq AU,et al. Seroprevalence of Toxoplasma gondii in sheep and goats in RaheemYar Khan Punjab, Pakistan. Trop Anim Health Prod. 2009;41:1225–1229. pmid:19225903
- 60. Henry L, Beverley JKA. Age and sex differences in the response of lymph node post-capillary venules in mice infected with Toxoplasma gondii. J Exp Pathol. 1976; 57:274–281.
- 61. Walker W, Roberts CW, Ferguson DJP, Jebbari H, Alexander J. Innate immunity to Toxoplasma gondii is influenced by gender and is associated with differences in interleukin-12 and gamma interferon production. Infect Immun. 1997; 65:1119–1121. pmid:9038327
- 62. Kittas S, Kittas C, Paizi-Biza P, Henry L. A histological and immune-histochemical study of the changes induced in the brains of white mice by infection with Toxoplasma gondii. Br J Exp Pathol.1984; 65(1):67–74. pmid:6365146
- 63. Mose JM, Kagira JM, Karanja SM, Ngotho M, Kamau M, Njuguna AN, et al. Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction. BioMed Res Int. 2016;1–5.
- 64. Khamesipour F, Doosti A, Iranpour Mobarakeh HVG, Komba E. Toxoplasma gondii in Cattle, Camels and Sheep in Isfahan and Chaharmahal va Bakhtiary Provinces, Iran. Jundishapur J Microbiol. 2014;7(6):e17460. pmid:25371809
- 65. Dubey JP, Huong LT, Lawson BW, Subekti DT, Tassi P, Cabaj W, et al. Sero-prevalence and isolation of Toxoplasma gondii from free-range chickens in Ghana, Indonesia, Italy, Poland, and Vietnam. J Parasitol. 2008; 94:68–71. pmid:18372623
- 66. Zhao GW, Shen B, Xie Q, Xu LX, Yan RF, Song XK,et al. Detection of Toxoplasma gondii in free range chickens in China based on circulating antigens and antibodies. Vet Parasitol. 2012;185:72–77. pmid:22153258
- 67. Zhang N, Wang S, Wang D, Li C, Zhang Z, Yao Z, et al. Seroprevalence of Toxoplasma gondii infection and risk factors in domestic sheep in Henan province, central China. Parasite. 2016; 23:53. pmid:27882868
- 68. Hussain MA, Victoria S, Szabo EA, Nelan B. Toxoplasma gondii in the Food Supply. Pathogens. 2017; 6(2):21.
- 69. Boughattas S, Bouratbine A. Prevalence of Food Borne Toxoplasma gondii in Free Ranging Chickens Sold in Tunis, Tunisia. J Food Qual Hazards Control. 2014;1:89–92.
- 70. Rajendran C, Keerthana CM, Anilakumar KR, Satbige AS, Gopal S. Development of B1 Nested PCR for Assessing the Prevalence of Zoonotic Protozoan Disease Agent Toxoplasma Gondii among Food Animals from Karnataka State, Southern India. J Microbiol Lab Sci. 2018; 1:101.
- 71. Mahami-Oskouei M, Morad M, Fallah E, Hamidi F, Akbari NAR. Molecular Detection and Genotyping of Toxoplasma gondii in Chicken, Beef, and Lamb Meat Consumed in Northwestern Iran. Iran J Parasitol. 2017; 12(1):38–45. pmid:28761459
- 72. Al-nasrawi HA, Naser HH, Kleaf SF. Molecular Detection of Toxoplasma gondii in Human and Chicken by Real-Time PCR Technique. Int J Ad Res. 2014;2:1023–1027.
- 73. Al-Sanjary RA, Hussein TH. Using species-specific PCR technique to detect Toxoplasma gondii in broiler chickens. Iraqi J Vet Sci. 2012; 26(2):53–56.
- 74. Iqbal A, Janecko N, Pollari F, Dixon B. Prevalence and molecular characterization of Toxoplasma gondii DNA in retail fresh meats in Canada. Food and Waterborne. Parasitol. 2018;13:e00031.
- 75. Aigner CP, Da Silva AV, Sandrini F, De-Sa-Osorio P, Poiares L, Largura. Real-time PCR-based quantification of Toxoplasma gondii in tissue samples of serologically positive outdoor chickens. Mem Inst Oswaldo Cruz Rio De Janeiro. 2010;105(7):935–937.