Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Correction: Real-Time PCR based test for the early diagnosis of Haplosporidium pinnae affecting fan mussel Pinna nobilis

  • Monserrat López-Sanmartín,
  • Gaetano Catanese,
  • Amalia Grau,
  • José María Valencia,
  • Jose Rafa García-March,
  • José Ignacio Navas

In Table 2, the sequence of primer HpR3 is incorrect. The correct sequence of primer HpR3 is 5´ AAAACCAACAAAGGCCCGAA 3´. Please see the correct Table 2 here.

Reference

  1. 1. López-Sanmartín M, Catanese G, Grau A, Valencia JM, García-March JR, Navas JI (2019) Real-Time PCR based test for the early diagnosis of Haplosporidium pinnae affecting fan mussel Pinna nobilis. PLoS ONE 14(2): e0212028. https://doi.org/10.1371/journal.pone.0212028 pmid:30794588