Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Correction

Correction: Real-Time PCR based test for the early diagnosis of Haplosporidium pinnae affecting fan mussel Pinna nobilis

  • Monserrat López-Sanmartín,
  • Gaetano Catanese,
  • Amalia Grau,
  • José María Valencia,
  • Jose Rafa García-March,
  • José Ignacio Navas
  • Article
  • Metrics
  • Comments
  • Media Coverage

In Table 2, the sequence of primer HpR3 is incorrect. The correct sequence of primer HpR3 is 5´ AAAACCAACAAAGGCCCGAA 3´. Please see the correct Table 2 here.

thumbnail
Download:
Table 2. Characteristics of the primers used for PCRs.

https://doi.org/10.1371/journal.pone.0229548.t001

Reference

  1. 1. López-Sanmartín M, Catanese G, Grau A, Valencia JM, García-March JR, Navas JI (2019) Real-Time PCR based test for the early diagnosis of Haplosporidium pinnae affecting fan mussel Pinna nobilis. PLoS ONE 14(2): e0212028. https://doi.org/10.1371/journal.pone.0212028 pmid:30794588

Citation: López-Sanmartín M, Catanese G, Grau A, Valencia JM, García-March JR, Navas JI (2020) Correction: Real-Time PCR based test for the early diagnosis of Haplosporidium pinnae affecting fan mussel Pinna nobilis. PLoS ONE 15(2): e0229548. https://doi.org/10.1371/journal.pone.0229548

Published: February 18, 2020

Copyright: © 2020 López-Sanmartín et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.