http://orcid.org/0000-0002-8055-7495
Figures
Abstract
Toxoplasma gondii is a protozoan that has great genetic diversity and is prevalent worldwide. In 2018, an outbreak of toxoplasmosis occurred in Santa Maria, Brazil, which was considered the largest outbreak ever described in the world. This paper describes the isolation and molecular characterization of Toxoplasma gondii from the placenta of two pregnant women with acute toxoplasmosis who had live births and were receiving treatment for toxoplasmosis during the outbreak. For this, placental tissue samples from two patients underwent isolation by mice bioassay, conventional PCR and genotyping using PCR-RFLP with twelve markers. Both samples were positive in isolation in mice. The isolate was lethal to mice, suggesting high virulence. In addition, the samples were positive in conventional PCR and isolates submitted to PCR-RFLP genotyping presented an atypical genotype, which had never been described before. This research contributes to the elucidation of this great outbreak in Brazil.
Citation: Minuzzi CE, Portella LP, Bräunig P, Sangioni LA, Ludwig A, Ramos LS, et al. (2020) Isolation and molecular characterization of Toxoplasma gondii from placental tissues of pregnant women who received toxoplasmosis treatment during an outbreak in southern Brazil. PLoS ONE 15(1): e0228442. https://doi.org/10.1371/journal.pone.0228442
Editor: Leticia Reyes, University of Wisconsin - Madison, School of Veterinary Medicine, UNITED STATES
Received: September 17, 2019; Accepted: January 15, 2020; Published: January 30, 2020
Copyright: © 2020 Minuzzi et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001 to CEM, PhD Fellow.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Toxoplasma gondii is a tissue cyst-forming protozoan capable of infecting warm-blooded animals, including humans, and is prevalent in most parts of the world [1]. It is one of the most studied coccidians due to its importance in animal and human health [2,3], as well as its suitability as a model in molecular studies [1].
Although T. gondii is the only species of the genus Toxoplasma [1,4], there are various genotypes [1]. The first genotyping studies of T. gondii led to the description of a clonal population structure with three main lines, designated as type I, II, and III [5, 6]. Currently, there are many known genotypes that do not belong to these three clonal lineages and are called atypical. They are generally considered more virulent [7]. They are formed by sexual reproduction between gametes of different genotypes which occur in the intestine of felids [1]. In Brazil, these atypical genotypes have been widely described [8]. There are studies showing the prevalence of T. gondii in animals and humans [9, 10, 11], and some studies have performed the isolation and genetic characterization from cases of congenital toxoplasmosis [12, 13].
T. gondii infection is generally asymptomatic in humans. However, it is potentially serious when acquired during pregnancy in immunocompetent individuals, as it carries the risk of fetal transmission [14]. When congenital toxoplasmosis occurs, the protozoan can cause lesions in the fetus that range from subclinical to neurological lesions, and even fetal death or miscarriage [15, 16]. The clinical manifestation varies according to the stage of pregnancy, infection time [17], and genotype [16]. The latter makes congenital toxoplasmosis more serious in Brazil, due to infection with more virulent genotypes [18].
In 2018, an outbreak of toxoplasmosis occurred in Santa Maria, Rio Grande do Sul, with 809 confirmed cases. Of these, 114 were pregnant women who had 3 fetal deaths, 10 abortions, and 22 live births with congenital toxoplasmosis [19]. The objective of this study was to describe the isolation and molecular characterization of T. gondii from the placenta of two pregnant women with acute toxoplasmosis who delivered alive children and were receiving treatment for toxoplasmosis.
Materials and methods
Samples and clinical history
The placental tissue samples from two patients (patient 1 and patient 2) who delivered their babies at the University Hospital of Santa Maria during the toxoplasmosis outbreak in 2018, were referred to the Laboratory of Parasitic Diseases of the Federal University of Santa Maria (UFSM) for diagnostic purposes. Part of the tissue was intended for protozoan isolation, and another part for molecular tests.
According to their clinical history, both patients were positive for acute toxoplasmosis through the detection of anti-T. gondii IgM in Enzyme-linked Immunosorbent Assay (ELISA). The diagnosis of the two pregnant women occurred in the final trimester of gestation. Both patients received treatment and had alive children. The treatment protocol included a combination of Sulfadiazine, Pyrimethamine and Folinic Acid (SPAF). Patient 1 started receiving treatment from 35 weeks of gestation, while patient 2 received treatment from the 36th week. Both patients received treatment for four weeks and thereafter gave birth.
Isolation through bioassay in mice
The placental tissues were subjected to peptic digestion individually, according to the technique described by Dubey, 1998 [20]. For digestion 50 g of placental tissue were used for peptic digestion. The digested material was resuspended in 5 mL of saline, and immediately after digestion, the mice were inoculated with 1 mL of the peptic digestion solution intraperitoneally. For each sample to be tested, four Swiss female mice were used, maintaining the fifth as a negative control. The animals were obtained from the Central Bioterium of the UFSM.
Mice were monitored daily for possible clinical signs of acute toxoplasmosis. When disease led to death, samples were collected from brain, heart, lung, and intraperitoneal fluid from all mice. The tissue was subjected to molecular analysis. Intraperitoneal fluid was also analyzed under a microscope with 40× magnification.
All procedures were approved by the Committee of Ethics in the Use of Animals of the Federal University of Santa Maria, under the protocol 7150250419.
DNA extraction
DNA extraction was performed from placental tissue samples from both patients, and from mouse tissues using Wizard Genomics DNA Purification kit (Promega), following the manufacturer’s instructions. In all cases, 20mg of tissues were used for DNA extraction.
Polymerase Chain Reaction (PCR)
The PCR amplification was performed with specific primers TOX4 (CGCTGCAGGGAGGAAGACGAAAGTTG) and TOX5 (CGCTGCAGACACAGTGCATCTGGATT) which amplified a 529 bp fragment from the T. gondii genome. The PCR was performed as described by Homan et al. 2000 [21]. As a positive control, tachyzoite DNA from the RH strain was used, and DNAase-free water was used as a negative control. A molecular marker of 100 bp (Brand—Ludwig Biotec) was used as the molecular standard size. Amplified products were visualized in the UV transilluminator after 1.5% agarose gel was stained with SYBR Safe DNA gel stain (Invitrogen).
Analysis of restriction fragment length polymorphism (RFLP)
The genotypic characterization was performed from mouse tissues that were positive for the TOX gene (529 bp) using twelve markers (SAG 1, 5' SAG2, 3' SAG2, Alt SAG2, SAG3, BTUB, GRA6, C22-8, C29-2, L358, PK1, APICO), according to the technique described by Su et al. 2010 [22]. To do so, the extracted DNA was amplified by nested-PCR (n-PCR) technique followed by PCR-RFLP analysis. DNA target sequences were first amplified by multiplex PCR, using external primers of all markers, followed by nested-PCR using internal primers for each marker. DNA samples from standard strains, RH, ME49 and VEG were used as controls for genotypes I, II, and III, respectively.
The polymorphism of each locus was analyzed by standard RFLP bands which was used to distinguish each strain type. For this, nested-PCR products were digested with appropriate restriction enzymes for each marker, according to Su et al. 2010 [22]. The controls were also digested using the same restriction enzymes. The negative control consisted of DNAase-free water. The results obtained were compared and classified according to the genotypes present in ToxoDB (http://toxodb.org/toxo/).
Results
T. gondii was isolated from the placental tissues of two patients. Within two weeks the mice presented signs indicative which acute toxoplasmosis such as apathy, bristly hair, photophobia, ascites, and death (Table 1). In addition, it was possible to identify a large amount of tachyzoites in the intraperitoneal fluid collected from the animals.
As expected the samples of placental tissue as well as tissue samples from mice (brain, heart, and lung) submitted to conventional PCR showed an amplified product of 529 base pairs, confirming the presence of T. gondii DNA in the placenta of the evaluated patients, and in the bioassay mice.
In the genotypic characterization by the RFLP technique, the DNA analysis of T. gondii amplified from the tissues of mice submitted to the bioassay presented an atypical genotype, not yet described in ToxoDB. This result compared to other genotypes in Table 2.
Discussion
Samples from animals have been widely used for isolation and genetic characterization of T. gondii [8]. However, in humans, this diagnosis is restricted [23], which makes it difficult to clarify the virulence of strains that infect humans and their genetic identity. In the present study conducted during the toxoplasmosis outbreak in Santa Maria, T. gondii was isolated from placental tissues of two patients with acute toxoplasmosis who received specific treatment in the third gestation trimester. This result is interesting since the success of T. gondii isolation is lower in cases of pregnant women receiving treatment [16, 24, 25]. The isolation of the protozoan species in the two patients in this study suggests that in both the cases the treatment protocol established did not prevent the protozoa from reaching the placenta, or that the congenital infection occurred even before the start of treatment.
In addition to confirming the presence of T. gondii in the placenta, the isolation in mice allows the virulence evaluation of genotypes present in the samples [26], since virulent strains usually cause acute infection with clinical signs in mice [3]. Signs which are characteristic of acute toxoplasmosis such as ascites, bristly hair, and photophobia were seen in all mice inoculated with placental samples from the patients in this study. In addition, the mice died within a maximum of 15 days, suggesting that the genotype present in the samples was quite virulent, although the amounts of inoculated tachyzoites can also interfere, since it was not estimated.
The genotype found in these samples was characterized as atypical, and is related to more severe forms of toxoplasmosis [27]. Atypical genotypes are not uncommon in Brazil, where the genetic diversity of T. gondii is large [8], but the genotype present in the samples of this research had not yet been described in ToxoDB. Recently, in Southern Brazil, Vielmo et al., 2019 [28], also described an atypical genotype very similar to that found in the current study, capable of causing a chicken outbreak on a small rural property, suggesting that these two closely related genotypes are virulent to humans and animals. Although very similar to each other, both genotypes differ from the Brazilian clonal lineages, BrI, BrII, BrIII and BrIV [9], as shown in Table 2.
In addition, it should be considered that the evaluated patients were diagnosed in the last gestational trimester and started receiving treatment after 30 weeks of gestation. This fact reaffirms the importance of diagnosis pregnant women through serology is essential for fast and efficient treatment to reduce cases of congenital toxoplasmosis [29, 30].
This study was funded by the Higher Education Personnel Improvement Coordination.
Conclusion
It was possible, by isolation and genotyping, to identify a new atypical T. gondii genotype, never described before, and with high virulence characteristics. This research contributes to elucidate the outbreak of toxoplasmosis in Santa Maria, Brazil.
Supporting information
S1 File. Patient Bioassay 1, Patient Bioassay 2 and Mouse images from the bioassay showing some clinical signs.
https://doi.org/10.1371/journal.pone.0228442.s001
(DOCX)
References
- 1. Dubey JP. The history of Toxoplasma gondii-The first 100 years. J. Eukaryot. Microbiol. 2008; 55: 467–475. pmid:19120791
- 2. Tenter AM, Heckeroth AR, Weiss LM. Toxoplasma gondii: from animals to humans. Int. J. Parasitol. 2000; 30:1217–1258. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3109627. pmid:11113252
- 3. Weiss LM, Dubey JP, Toxoplasmosis: a history of clinical observations. Int. J. Parasitol. 2009; 39: 895–901. pmid:19217908
- 4. Dubey JP, Lyndsay DS. Neosporosis, Toxoplasmosis, and Sarcocystosis in Ruminants. Vet Clin Food Anim. 2006; 22: 645–671. pmid:17071358
- 5. Dardé ML, Bouteille B, Pestre-Alexandre M. Isoenzymic characterization of seven strains of Toxoplasma gondii by isoelectrofocusing in polyacrylamide gels. American Journal of Tropical Medicine and Hygiene. 1988; 39: 551–558. pmid:2462794
- 6. Howe DK, Sibley LD. Toxoplasma gondii comprises three clonal lineages: correlation of parasite genotype with human disease. Journal of Infectious Diseases. 1995; 172: 1561–1566. pmid:7594717
- 7. Dardé ML. Toxoplasma gondii, “new” genotypes and virulence. Parasite. 2008; 15: 366–371. pmid:18814708
- 8. Dubey JP, Su C. Population biology of Toxoplasma gondii: what’s out and where did they come from. Mem. Inst. Oswaldo Cruz. 2009; 104: 190–195. pmid:19430643
- 9. Pena HF, Gennari SM, Dubey JP, Su C. Population structure and mouse-virulence of Toxoplasma gondii in Brazil. Int. J. Parasitol. 2008; 38: 561–569. pmid:17963770
- 10. Ferreira IM, Vidal JE, de Mattos Cde C, de Mattos LC, Qu D, Su C, et al. Isolados de Toxoplasma gondii: a genotipagem RFLP-PCR multilocus de pacientes humanos no Estado de São Paulo identificou genótipos distintos. Exp Parasitol. 2011; 129: 190–195. pmid:21741380
- 11. Dubey JP, Lago EG, Gennari SM, Su C, Jones JL. Toxoplasmosis in humans and animals in Brazil: high prevalence, high burden of disease, and epidemiology. Parasitology. 2012; 139(11): 1375–424. pmid:22776427
- 12. Carneiro AC, Andrade GM, Costa JG, Pinheiro BV, Vasconcelos-Santos DV, Ferreira AM, et al. Genetic characterization of Toxoplasma gondii revealed highly diverse genotypes for isolates from newborns with congenital toxoplasmosis in southeastern Brazil. J Clin Microbiol. 2013; 51: 901–907. pmid:23284022
- 13. Silva LA, Andrade RO, Carneiro AC, Vitor RW. Overlapping Toxoplasma gondii genotypes circulating in domestic animals and humans in Southeastern Brazil. PLoS One. 2014; 9: 90237. https://doi.org/10.1371/journal.pone.0090237.
- 14. Robert-Gangneux F, Dupretz P, Yvenou C, Quinio D, Poulain P, Guiguen C, et al. Relevance of Placenta Examination for the Diagnosis of Congenital Toxoplasmosis. Clinical. 2010; 29: 33–8.
- 15. Dunn D, Wallon M, Peyron F, Petersen E, Peckham C, Gilbert R. Mother-to-child transmission of toxoplasmosis: risk estimates for clinical counselling. Lancet. 1999; 353: 1829–1833. pmid:10359407
- 16. Boughattas S, Ben-Abdallah R, Siala E, Souissi O, Maatoug R, Aoun K, et al. Case of fatal congenital toxoplasmosis associated with I/III recombinant genotype. Trop. Biomed. 2011; 28: 615–619. pmid:22433891
- 17. Cook AJ, Gilbert RE, Buffolano W, Zufferey J, Petersen E, Jenum PA, et al. Sources of Toxoplasma infection in pregnant women: European multicenter case-control study. European Research Network on Congenital Toxoplasmosis. Br. Med. J. 2000; 321: 142–147.
- 18. Gilbert RE, Freeman K, Lago EG, Bahia-Oliveira LM, Tan HK, Wallon M, et al. Ocular sequelae of congenital toxoplasmosis in Brazil compared with Europe. PLoS Negl. Trop. Dis. 2008; 2: 277.
- 19.
GOVERNO DO ESTADO DO RIO GRANDE DO SUL/CENTRO ESTADUAL DE VIGILÂNCIA EM SAÚDE/SUPERINTENDÊNCIA DE VIGILÂNCIA EM SAÚDE, 2018. Relatório de Atualização de Investigação de Surto. Rio Grande do Sul, Brasil. https://www.cevs.rs.gov.br/inicial.
- 20. Dubey JP. Refinement of pepsin digestion method for isolation of Toxoplasma gondii from infected tissues. Vet. Parasitol. 1998; 74: 75–77. pmid:9493311
- 21. Homan WL, Vercammen M, De Braekeleer J, Verschueren H. Identification of a 200- to 300- fold repetitive 529bp DNA fragment in Toxoplasma gondii, and its use f.or diagnostic and quantitative PCR. Int. J. Parasitol. 2000; 30: 69–75. pmid:10675747
- 22. Su C, Shwab EK, Zhou P, Zhu XQ, Dubey JP. Moving towards an integrated approach to Molecular detection and identification of Toxoplasma gondii. Parasitology. 2010; 137: 1–11. pmid:19765337
- 23.
Weiss LM, Kim K. Toxoplasma gondii. The Model Apicomplexan—Perspectives and Methods, ELSEVIER, United Kingdom, 2014; p. 1085. https://doi.org/10.1016/j.ijpara.2003.12.009
- 24. Pardini L, Carral LA, Bernstein M, Gos ML, Olejnik P, Unzaga JM, et al. First isolation and molecular characterization of Toxoplasma gondii from a human placenta in Argentina. Parasitol. Int. 2014; 63: 470–472. pmid:24513795
- 25. Pardini L, Bernstein M, Carral LA, Kaufer FJ, Dellarupe A, Gos ML, et al. Congenital human toxoplasmosis caused by non-clonal Toxoplasma gondii genotypes in Argentina. Parasitol. Int. 2019; 68: 48–52. pmid:30304711
- 26. Ferreira TCR, Buery JC, Moreira NIB, Santos CB, Costa JGL, Pinto LV, et al. Toxoplasma gondii: isolation, biological and molecular characterisation of samples from free-range Gallus gallus domesticus from countryside Southeast Brazil. Braz. J. Vet. Parasitol. 2018; 27: 384–389. https://doi.org/10.1590/S1984-296120180028.
- 27. Delhaes L, Ajzenberg D, Sicot B, Bourgeot P, Dardé ML, Dei-Cas E, et al. Severe congenital toxoplasmosis due to a Toxoplasma gondii strain with an atypical genotype: case report and review. Prenat. Diagn. 2010; 30(9):902–5. pmid:20582922
- 28. Vielmo A, Pena HFJ, Panziera W, Bianchi RM, De Lorenzo C, Oliveira S, et al. Outbreak of toxoplasmosis in a flock of domestic chickens(Gallus gallus domesticus) and guinea fowl (Numida meleagris). Parasitology Research. 2019. https://doi.org/10.1007/s00436-019-06233-w.
- 29. Carral L, Kaufer F, Olejnik P, Freuler C, Durlach R. Prevención de la toxoplasmosis congénita en un hospital de Buenos Aires. Medicina (Buenos Aires). 2013; 73: 238–242. https://www.ncbi.nlm.nih.gov/pubmed/23732199.
- 30. Capobiango JD, Breganó RM, Navarro IT, Neto CPR, Casella AMB, Mori FMRL, et al. Congenital toxoplasmosis in a reference center of Paraná, Southern Brazil, Braz. J. Infect. Dis. 2014; 14: 364–371. http://dx.doi.org/10.1016/j.bjid.2013.11.