Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Thermodynamic investigation of DNA-binding affinity of wild-type and mutant transcription factor RUNX1

  • Fangrui Wu,

    Roles Investigation, Methodology, Validation

    Affiliation Department of Pharmacology and Chemical Biology, Baylor College of Medicine, Houston, Texas, United States of America

  • Tidie Song,

    Roles Investigation, Methodology, Validation

    Affiliation Department of Pharmacology and Chemical Biology, Baylor College of Medicine, Houston, Texas, United States of America

  • Yuan Yao,

    Roles Methodology

    Affiliation Department of Pharmacology and Chemical Biology, Baylor College of Medicine, Houston, Texas, United States of America

  • Yongcheng Song

    Roles Supervision, Writing – original draft, Writing – review & editing

    ysong@bcm.edu

    Affiliation Department of Pharmacology and Chemical Biology, Baylor College of Medicine, Houston, Texas, United States of America

Abstract

Transcription factor RUNX1 and its binding partner CBFβ play a critical role in gene regulation for hematopoiesis. Mutations of RUNX1 cause ~10% of acute myeloid leukemia (AML) with a particularly poor prognosis. The current paradigm for the leukemogenesis is that insufficient activity of wild-type (WT) RUNX1 impairs hematopoietic differentiation. The majority of mutant RUNX1 proteins lose the DNA-binding affinity and inhibit WT RUNX1 by depletion of CBFβ. Here, isothermal titration calorimetry (ITC) was used to quantitatively study the interactions of WT and three clinical mutant RUNX1, CBFβ and DNA. Our data show that the binding of RUNX1 to DNA is enthalpy-driven, and the affinity decreases in the order of WT > S114L > R139Q >> K83E, which support previous observations and conclusion. To find potentially beneficial RUNX1 mutations that could increase the overall RUNX1 activity, K83R and H179K mutations of RUNX1 were designed, using structure-based computational modeling, and found to possess significantly higher DNA-binding affinities than does WT RUNX1. K83R and H179K mutant RUNX1 could therefore be protein-based RUNX1 activators.

Introduction

Hematopoiesis, generating ~1011-12 differentiated blood cells daily in humans, requires exquisite gene expression regulation. Dysfunction of these controls could lead to initiation of a blood disease, or even leukemia. Transcription factor RUNX1 (also known as AML1) [1] is a master regulator for hematopoiesis [2,3]. It belongs to the core binding factor (CBF) transcription factor family, which consists of CBFα (including RUNX1, 2 and 3) and CBFβ proteins. RUNX1 contains an N-terminal RUNT domain (50–180), which is highly conserved from yeast to mammals, and C-terminal transactivation domains (Fig 1) [4,5]. The biological function of RUNX1 is that RUNT recognizes and binds to the promoter of its target genes with a consensus sequence of PyGPyGGTPy [69], with the transactivation domains recruiting other transcriptional proteins (e.g., p300) to activate or repress transcription of the gene [2,1013]. While CBFβ does not interact with DNA, it forms a heterodimeric complex with RUNT, which can significantly increase the DNA-binding affinity [7] and is essential for hematopoiesis [14,15]. This suggests high affinity binding of RUNX1 to DNA is crucial: reduction of its DNA-binding affinity (e.g., loss of CBFβ) may block the RUNX1-mediated gene transcription and cause abnormal hematopoiesis.

thumbnail
Fig 1. RUNX1 contains the RUNT domain and transactivation domain (TAD).

https://doi.org/10.1371/journal.pone.0216203.g001

Somatic and germline mutations of RUNX1 cause ~10% of acute myeloid leukemia (AML) as well as preleukemic diseases with predisposition to AML, such as myelodysplastic syndrome (MDS) (~10%) [1618]. There are rare cases of inherited, heterozygous germline RUNX1 mutations, which cause familial platelet disorder (FPD) showing low counts or functional defects of platelets [1921]. Depending on the nature of the mutations, 20%-57% of these FPD patients develop AML at the age of 8–62. RUNX1 mutated AML patients have a particularly poor prognosis [22,23] with significantly lower rates of complete remission (47%) and 5-year survival (2%) [22], as compared with those without RUNX1 mutation (77% and 30%, respectively).

The current paradigm for RUNX1 mutation-mediated leukemia initiation is due to insufficient activity of wild-type (WT) RUNX1 for hematopoiesis [1618], which causes accumulation of immature blood cells as well as insufficient numbers of functional blood cells. Over the time, acquiring a second (or more) mutation could lead to an onset of leukemia. It is noteworthy that even RUNX1 haploinsufficiency could lead to AML. A pedigree of FPD patients exhibit RUNX1+/- genotype with one RUNX1 allele deleted [19,20]. The haploinsufficiency caused 7 out of 24 patients to develop leukemia. >80% of RUNX1 mutations occur in the RUNT domain with R80, K83, S114, R139, D171, R174 and R177 being hot spots. Except for S114 which is located in the interface with CBFβ, these residues have interactions with DNA [7]. This suggests that these mutations affect RUNX1’s binding ability to DNA. Several leukemia-causing mutations, such as K83E, R139Q and R174Q, were found to have a reduced DNA binding affinity, but they retain the ability to bind CBFβ [21,2326]. Thus, these RUNX1 mutants could inhibit the activity of WT RUNX1 by reducing the amount of CBFβ. The overall levels of RUNX1 activity seem to correlate with the predisposition to leukemia [26,27].

However, previous studies of the interactions of these clinical RUNX1 mutants with DNA and CBFβ were based on less quantitative electrophoretic mobility shift assay (EMSA). More accurate characterization of the binding affinity of mutant RUNX1 to DNA is needed. Here, we report results of thermodynamic studies of interactions between RUNX1, CBFβ and DNA, using isothermal titration calorimetry (ITC). WT and 3 selected leukemia-causing mutant (i.e., K83E, S114L and R139Q) RUNX1 were included. In addition, we hypothesize that a “good” mutant RUNX1 with a higher binding affinity to DNA could counteract a leukemia-causing RUNX1 mutant and have an enhanced RUNX1 activity for hematopoiesis. This could be a therapeutic approach to AML with RUNX1 mutation. We report 3 novel RUNX1 mutant proteins that were designed using computational modeling and possess a significantly higher binding affinity to DNA than does the WT RUNX1.

Material and methods

Constructs for recombinant proteins

Human RUNX1 gene containing amino acid sequence 1–181 and CBFβ (1–141) were cloned and inserted into pET-28α expression vector. The correctness of the inserted DNA was verified by sequencing.

Site-directed mutagenesis

Site-directed mutagenesis was performed to produce mutant forms of RUNX1, using QuikChange Mutagenesis kit (Agilent) following the manufacturer’s instructions. Within RUNX1, the mutations K83E, S114L, R139Q, K83R, H179K were made individually by using PCR. Two consecutive site-directed mutagenesis experiments were used to yield the K83R/H179K double mutation. The forward primer (5'- ATGGGCAGGGTCTCGTTGCAGCGCCAG -3’) and backward primer (5'- CTGGCGCTGCAACGAGACCCTGCCCAT -3') for K83E, the forward primer (5'- CTCAGCTCAGCCAAGTAGTTTTCATCATTGCCAGCC -3’) and backward primer (5'- GGCTGGCAATGATGAAAACTACTTGGCTGAGCTGAG -3') for S114L, the forward primer (5'- TTTTCCCTCTTCCACTTTGACCGACAAACCTGAGG -3’) and backward primer (5'- CCTCAGGTTTGTCGGTCAAAGTGGAAGAGGGAAAA -3') for R139Q, the forward primer (5'-GTTCACTGCCGCTTTCTTCGAGGTTCTCGGGGCCC-3’) and backward primer (5'-GGGCCCCGAGAACCTCGAAGAAAGCGGCAGTGAAC-3') for H179K and the forward primer (5’-GATGGGCAGGGTCCTGTTGCAGCGCCA-3’) and backward primer (5’-TGG CGCTGCAACAGGACCCTGCCCATC-3’) for K83R were designed with the QuikChange Primer Design Program at Agilent Genomics (http://www.genomics.agilent.com). Sequences of all inserted genes were verified by sequencing.

Protein expression and purification

BL21-CodonPlus strain (Agilent) was transformed with pET28-RUNX1 plasmid using heat shock and cultured at 37 °C in LB medium containing ampicillin (50 μg/mL) and Kanamycin (50 μg/mL). Upon reaching an optical density of ~1.3 at 600 nm, RUNX1(1–181) expression was induced by adding 0.2 mM isopropylthiogalactoside (IPTG) at 18 °C for 20 hours. Cells were harvested, lysed, centrifuged at 20,000 rpm for 20 min and the supernatant was collected and subjected to an affinity column chromatography using a Ni-NTA column (GE Healthcare) followed by a Superdex 75 gel filtration column. All recombinant proteins were found with purity of >90% (SDS-PAGE).

Isothermal titration calorimetry

Isothermal titration calorimetry (ITC) was used to measure the interaction between RUNX1 and 21 base-pair DNA fragment (5’-CAAACTCTGTGGTTGCCTTGC-3’) derived from human CSF-1R gene promoter. The ITC experiments were performed using a Nano ITC LV (190 μL) instrument from TA Instruments (New Castle, DE) at 277 K. A 190 μL solution containing 20 μM Runx1 protein in 10 mM HEPES-NaOH buffer (pH 7.5), containing 0.18 M NaCl and 0.005% Tween 20 was added into the sample cell. DNA fragment (100 μM) in the same buffer solution (50 μL) was transferred into the syringe of the instrument. Upon reaching temperature equilibrium, 25 injections (2 μL each) of the inhibitor were used for the titration. ITC data were then imported into NanoAnalyze software (TA Instruments, New Castle, DE). The titration baseline was corrected, and the ΔH and Kd values for the binding of the inhibitor were obtained by fitting into the independent model in the software. Three independent experiments were done to ensure that the reported data are reliable.

Molecular modeling

Molecular modeling studies were performed using software package Schrödinger suite (version 2018, Schrödinger LLC, NY), which includes all of the programs described below. The structure of DNA-RUNX1-CBFβ complex were prepared using the module “protein preparation wizard” in Maestro with default protein parameters, using the X-ray crystal structure 1IO4 (PDB code) [7] available in Protein Data Bank. Hydrogen atoms were added and irrelevant ligands and all water molecules were removed. Next, hydrogen bonds were optimized, the partial charges for all atoms were assigned, and the protein-DNA complex was energy-minimized using OPLS-2005 force field. Hydrophobic, electrostatic and H-bond interactions among DNA, RUNX1 and CBFβ can be visualized in Maestro. A RUNX1 point mutation (such as K83R) was generated manually by deleting the original sidechain followed by adding a new sidechain in Maestro. The resulting mutant protein structure was globally energy-minimized using OPLS-2005 force field. All figures for molecular modeling studies were generated using Maestro.

Results

Leukemia-causing RUNX1 mutants have reduced DNA-binding affinity

Isothermal titration calorimetry (ITC) was used to quantitatively measure the DNA-binding affinity of WT and 3 selected clinical mutant RUNX1 proteins. In addition, thermodynamic data including changes in enthalpy and entropy (ΔH and ΔS) for the protein-DNA interactions were determined. Because the full-length RUNX1 was not expressed well in E. coli due to its low stability and high propensity to aggregation, the N-terminal 1–181 protein that includes the DNA-binding RUNT domain was used for the study. Three hotspot mutations K83E, S114L and R139Q in AML were chosen and generated with site-specific mutagenesis from the WT RUNX1. All of these recombinant proteins with an N-terminal His6-tag were expressed in E. coli (BL21-CodonPlus strain) and purified with affinity and size-exclusion chromatography in a high yield (~20 mg/L culture) and >90% purity (SDS-PAGE). Recombinant CBFβ (1–141) protein was obtained similarly.

A 21 base-pair DNA (5’-CAAACTCTGTGGTTGCCTTGC-3’) from human CSF-1R gene promoter was used for the studies of RUNX1-DNA interactions [7]. ITC experiments were performed by titrating the DNA solution (100 μM, 25 injections of 2 μL each) into the RUNX1 protein solution (20 μM, 190 μL) at 25 °C in 10 mM HEPES buffer (pH 7.5) containing 180 mM NaCl and 0.005% Tween 20. For experiments including CBFβ, a premixed RUNX1-CBFβ (1:2) solution was used. The ITC results are shown and summarized in Fig 2 and Table 1.

thumbnail
Fig 2. Representative ITC results and fitting curves for titration of DNA into WT and clinical mutant RUNX1, using the independent model.

https://doi.org/10.1371/journal.pone.0216203.g002

thumbnail
Table 1. Thermodynamics data for RUNX1-DNA interactions.

https://doi.org/10.1371/journal.pone.0216203.t001

In the absence of CBFβ, the binding of WT RUNX1 to DNA was found to be strongly exothermic, with a change in enthalpy (ΔH) of -99.3 ± 4.2 kJ/mol (Fig 2A). Fitting the titration curve using the independent model gave the DNA-binding affinity of WT RUNX1 with a Kd (dissociation constant) value of 0.49 ± 0.01 μM, which equals a change in free energy (ΔG) of -42.2 kJ/mol. With a calculated change in entropy (ΔS) of -206 J K-1 mol-1, the experiment shows the binding of WT RUNX1 to DNA is enthalpy-driven. CBFβ was found to significantly enhance the binding affinity of WT RUNX1 to DNA by ~2-fold, with a Kd value of 0.23 ± 0.05 μM (ΔG = -34.7 kJ/mol) (Fig 2B and Table 1). The binding is also highly exothermic (ΔH = -81.8 ± 9.0 kJ/mol) and enthalpy-driven. In contrast, titration of DNA into the K83E mutant RUNX1 (abbreviated to be K83E) with or without CBFβ did not generate a significant amount of enthalpy change (Fig 2C and 2D), suggesting K83E does not bind to DNA. Although this observation does not exclude the possibility that K83E binds to DNA without an enthalpy change, its lack of DNA-binding ability is consistent with previous EMSA results [21]. DNA-binding of S114L mutant RUNX1 exhibited a large ΔH of -100.0 ± 15.4 kJ/mol and a reduced DNA-binding affinity with a Kd value of 0.70 ± 0.08 μM, as compared with WT RUNX1. Although CBFβ was reported to bind significantly weaker to S114L (which is in the interface between RUNX1 and CBFβ) [7], CBFβ was again found to enhance the DNA-binding affinity of S114L by ~2x, with a Kd value of 0.39 ± 0.08 μM. Nonetheless, ITC investigation showed that as compared to WT RUNX1, S114L possesses ~2-fold reduced affinity to DNA. Titration of DNA to the R139Q mutant RUNX1 with and without CBFβ were exothermic and gave Kd values of 1.48 ± 0.51 and 3.35 ± 0.8 μM, respectively, showing that R139Q mutation exerts a more pronounced effect to weaken the DNA-binding ability, and complexation with CBFβ does not improve the binding.

Overall, our ITC experiments demonstrate that the binding of RUNX1 to DNA is enthalpy-driven, and the binding affinity decreases in the order of WT > S114L > R139Q >> K83E. In a quantitative manner, these data are in line with previous EMSA results, supporting the correlation between reduced DNA-binding affinity, decreased RUNX1 activity in gene regulation, and increased predisposition to leukemia in the clinic.

Computational design of RUNX1 mutants with enhanced DNA-binding affinity

We hypothesize that a RUNX1 mutation that binds to DNA stronger could counteract those leukemia-causing RUNX1 mutations. However, no mutant RUNX1 with an enhanced DNA-binding ability has been reported. Molecular modeling software Schrödinger suite was used to design such RUNX1 mutations. Using the X-ray structure of a DNA-RUNX1-CBFβ complex (PDB code 1IO4) [7] in the Protein Data Bank as a template, the structure of RUNX1-DNA-CBFβ was prepared and visualized. Structural analysis revealed that the high-affinity binding of RUNX1 to DNA mainly depends on numerous favorable hydrogen bond and electrostatic interactions. This observation is in line with our ITC studies showing the binding of RUNX1 to DNA is enthalpy-driven (Table 1). Increasing hydrogen bond, electrostatic and/or other polar interactions between RUNX1 and DNA could lead to a higher binding affinity.

There are several opportunities for a RUNX1 point mutation to have increased polar interactions with DNA. One possibility is between the sidechain of K83 and DNA. In the crystal structure, there is no direct interactions between K83 and a DNA’s phosphate (Fig 3A). Rather, a water molecule is found as a bridge to form two hydrogen bonds between K83 and DNA [7]. Thus, the point mutation K83R was designed with a rationale that Arg has a longer, positively charged side chain, which could provide direct and possibly stronger interactions with the DNA’s phosphate group. Next, K83R mutant RUNX1 was generated in the computer and globally energy-minimized using OPLS-2005 force field. The optimized conformation of K83R side chain was predicted to have favorable hydrogen bond and electrostatic interactions with the DNA backbone phosphate group (Fig 3B). Similarly, His-179 sidechain was found to have a hydrogen bond with a nearby DNA phosphate group (Fig 3A). We reasoned that a positively charged lysine sidechain could have improved polar interactions. Using a similar method, H179K mutant RUNX1 was generated and modeled. Modeling results show hydrogen bond and electrostatic interactions between the positively charged lysine and DNA are expected (Fig 3c), which have the potential to increase the binding affinity.

thumbnail
Fig 3.

(A) X-ray structure of WT RUNX1 in complex with DNA (PDB: 1IO4), with DNA shown as a pink model and RUNX1 in green. For clarity, only interacting residues are shown. Hydrogen bonds are shown as yellow dashed lines; (B) Modeled structures of the K83R RUNX1-DNA complex, showing favorable hydrogen-bond/electrostatic interactions between mutated K83R and DNA phosphate; (C) Modeled structures of the H179K RUNX1-DNA complex, showing favorable hydrogen-bond/electrostatic interactions between mutated H179K and DNA phosphate. The bottom-left insets show the enlarged areas in the black boxes.

https://doi.org/10.1371/journal.pone.0216203.g003

K83R and H179K RUNX1 mutants have a higher affinity to DNA

Through site-directed mutagenesis followed by protein expression and purification, recombinant RUNX1 proteins with K83R, H179K and double K83R/H179K mutations were obtained. Their binding affinities to DNA in the presence or absence of CBFβ were determined with ITC and the results are shown in Fig 4 and Table 1. In the absence of CBFβ, titration of DNA into K83R mutant RUNX1 was found to be an exothermic reaction, giving ΔH of -69.4 ± 5.6 kJ/mol and Kd of 0.48 ± 0.15 μM (Fig 4A). CBFβ was found to also significantly enhance the binding affinity of K83R by 3-fold with a Kd value of 0.16 ± 0.03 μM (Fig 4B). K83R mutation showed a comparable or slightly higher binding affinity, as compared with WT RUNX1 (Kd = 0.49 or 0.23 μM with or without CBFβ, respectively). The H179K mutation was found to exert a more pronounced improvement. H179K alone binds to DNA with a Kd value of 0.35 ± 0.12 μM (Fig 4C), more tightly than WT RUNX1. When complexed with CBFβ, H179K showed a strong binding ability with a Kd of 100 ± 40 nM (Fig 4D), having ~2× more affinity to DNA than does the WT RUNX1/CBFβ. In addition, the K83R/H179K double mutant RUNX1 exhibited an improved binding affinity as compared to that of the H179K mutant, with the Kd values of 0.29 ± 0.05 and 0.073 ± 0.005 μM with and without CBFβ, respectively (Fig 4E and 4F).

thumbnail
Fig 4. Representative ITC results and fitting curves, using the independent model, for titration of DNA into mutant RUNX1 proteins that are designed to have a potentially improved binding affinity.

https://doi.org/10.1371/journal.pone.0216203.g004

Discussion

Transcription factor RUNX1, together with its partner CBFβ, plays a critical role in gene expression regulation in hematopoiesis. RUNX1 gene mutations are frequently found in acute myeloid leukemia (AML) with a particularly poor prognosis. There have been no effective treatments for this subtype of AML. In addition, RUNX1 mutations are also commonly found in a number of pre-leukemic diseases, such as myelodysplastic syndrome (MDS) and family platelet disorders (FPD), with predisposition to AML, showing RUNX1 mutation is an early event and the driving force to the cancer. The current paradigm of the mechanism underlying the malignancy is due to insufficient overall biological activity of WT RUNX1, which stems from haploinsufficiency or a mutant RUNX1 that either reduces the amount of CBFβ (for N-terminal mutations) or lacks the transactivation activity (for C-terminal mutations). Insufficient activity of RUNX1 causes hampered hemopoietic differentiation, accumulation of undifferentiated blood cells, and eventually, upon acquisition of other mutations, onset of the leukemia.

High-affinity binding of RUNX1 to its target DNA is critical to the activity of RUNX1. Complexation with CBFβ, which can significantly enhance the binding affinity of RUNX1, is required for hematopoiesis. Therefore, isothermal titration calorimetry (ITC) was used in this study to quantitatively measure the interactions of WT and three clinical mutant RUNX1, CBFβ and DNA. Our data show that the binding of RUNX1 to DNA is enthalpy-driven, and the binding affinity decreases in the order of WT > S114L > R139Q with Kd values of 0.49, 0.70, 1.48 μM, respectively. K83E mutant does not bind to DNA. In addition, CBFβ was found to cause ~2-fold increased binding affinity of WT and S114L RUNX1 with Kd values of 0.23 and 0.39 μM, while CBFβ reduces the bind affinity of R139Q. In the presence of CBFβ, K83E still had no interactions with DNA. These results complement and are generally consistent with those in previous studies using electrophoretic mobility shift assay (EMSA), showing that as compared with WT RUNX1, leukemia-causing RUNX1 mutants have a significantly reduced binding affinity to DNA. As a consequence, the overall activity of RUNX1 in the cancer cells is decreased.

An interesting question we had next is whether there is a mutant RUNX1 bearing a higher DNA-binding ability than the WT protein. Such a “good” mutant could provide an elevated RUNX1 activity and counteract a leukemia-causing RUNX1 mutation. Using structure-based computational modeling, two RUNX1 mutations K83R and H179K were designed with a rationale that more hydrogen-bond and electrostatic interactions with DNA could increase the binding affinity. ITC investigation showed that in the absence of CBFβ, K83R mutant protein possesses a comparable binding affinity, while H179K can significantly enhance DNA-binding affinity. When complexed with CBFβ, more pronounced effects were observed with Kd values for K83R and H179K being 0.16 and 0.10 μM. Compared to that of H179K, RUNX1 with double mutations of K83R and H179K exhibited an improved DNA-binding affinity. Lysine-83 is shown to play an important role in binding to DNA. The leukemia-causing K83E mutation was found to completely abrogate the DNA-binding ability of the protein, because of the electrostatic repulsion between the negatively charged sidechain of glutamate and the DNA phosphate. Our designed K83R mutation, which is positively charged and has a longer sidechain, could form direct hydrogen bond and electrostatic interactions with the DNA-phosphate (without needing a bridging water molecule) (Fig 3B). Histidine-179 lies on the outer edge of the RUNT domain. H179K mutation, which replaces the mostly neutral histidine sidechain with a positively charged lysine sidechain, also greatly increases the affinity to DNA, likely through more favorable hydrogen-bond and electrostatic interactions with the DNA-phosphate.

Possible benefits for introducing a “good” RUNX1 mutation with a higher DNA-binding ability, such as H179K, are two-folded. First, the “good” mutant (with active C-terminal transaction domains) increases the net amount of the active form of RUNX1, thereby enhancing the overall RUNX1 activity. Second, there is a possibility that the activity of such a “good” RUNX1 is independent of CBFβ. For example, the DNA-binding affinity of K83R/H179K alone (Kd = 0.29 μM) is comparable to that of the WT RUNX1-CBFβ complex (Kd = 0.23 μM). Thus, the beneficial RUNX1 mutant could counteract a leukemia-causing RUNX1 that reduces the amount of CBFβ. Therefore, H179K/K83R mutant RUNX1 could serve as a protein-based RUNX1 activator, having the potential to boost RUNX1 transactivation ability and correct the leukemic phenotype.

In summary, isothermal titration calorimetry (ITC) investigation of DNA-binding ability of the WT and clinical mutations of RUNX1 quantitatively confirms results from earlier research [21,2326], showing that DNA-binding of the leukemia-relevant mutant RUNX1 is significantly decreased or lost. Our hypothesis is a mutant RUNX1 with a significantly higher DNA-binding affinity could overcome leukemia-RUNX1 mutations and restore RUNX1-mediated hematopoiesis. Towards achieving this goal, K83R and H179K RUNX1 mutations have been identified to have a significantly enhanced affinity to DNA. Our future work is to develop a cell-based assay to evaluate cellular activity of RUNX1 and test whether transfecting K83R or H179K RUNX1 into the cells would lead to significantly increased RUNX1-mediated gene expression. The ultimate goal is to develop a RUNX1 activation therapy for treatment of RUNX1 mutated leukemia.

Acknowledgments

This work was supported by grants RP150129 and RP180177 from Cancer Prevention and Research Institute of Texas (CPRIT) to Y.S.

References

  1. 1. Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y, Ohik M. t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc Natl Acad Sci U S A. 1991; 88: 10431–10434. pmid:1720541
  2. 2. Speck NA, Gilliland DG. Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer. 2002; 2: 502–513. pmid:12094236
  3. 3. Ito Y, Bae SC, Chuang LS. The RUNX family: developmental regulators in cancer. Nat Rev Cancer. 2015; 15: 81–95. pmid:25592647
  4. 4. Daga A, Tighe JE, Calabi F. Leukaemia/Drosophila homology. Nature. 1992; 356: 484. pmid:1560822
  5. 5. Kagoshima H, Shigesada K, Satake M, Ito Y, Miyoshi H, Ohki M, et al. The Runt domain identifies a new family of heteromeric transcriptional regulators. Trends Genet. 1993; 9: 338–341. pmid:8273148
  6. 6. Melnikova IN, Crute BE, Wang S, Speck NA. Sequence specificity of the core-binding factor. J Virol. 1993; 67: 2408–2411. pmid:8445737
  7. 7. Tahirov TH, Inoue-Bungo T, Morii H, Fujikawa A, Sasaki M, Kimura K, et al. Structural analyses of DNA recognition by the AML1/Runx-1 Runt domain and its allosteric control by CBFbeta. Cell. 2001; 104: 755–767. pmid:11257229
  8. 8. Bravo J, Li Z, Speck NA, Warren AJ. The leukemia-associated AML1 (Runx1)—CBF beta complex functions as a DNA-induced molecular clamp. Nat Struct Biol. 2001; 8: 371–378. pmid:11276260
  9. 9. de Bruijn MF, Speck NA. Core-binding factors in hematopoiesis and immune function. Oncogene. 2004; 23: 4238–4248. pmid:15156179
  10. 10. Zhang DE, Hetherington CJ, Meyers S, Rhoades KL, Larson CJ, Chen HM, et al. CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF alpha2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol Cell Biol. 1996; 16: 1231–1240. pmid:8622667
  11. 11. Takahashi A, Satake M, Yamaguchi-Iwai Y, Bae SC, Lu J, Maruyama M, et al. Positive and negative regulation of granulocyte-macrophage colony-stimulating factor promoter activity by AML1-related transcription factor, PEBP2. Blood. 1995; 86: 607–616. pmid:7605990
  12. 12. Aronson BD, Fisher AL, Blechman K, Caudy M, Gergen JP.Groucho-dependent and -independent repression activities of Runt domain proteins. Mol Cell Biol. 1997; 17: 5581–5587. pmid:9271433
  13. 13. Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E, Hiebert SW. A mechanism of repression by acute myeloid leukemia-1, the target of multiple chromosomal translocations in acute leukemia. J Biol Chem. 2000; 275: 651–656. pmid:10617663
  14. 14. Wang Q, Stacy T, Miller JD, Lewis AF, Gu TL, Huang X, et al. The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell. 1996; 87: 697–708. pmid:8929538
  15. 15. Sasaki K, Yagi H, Bronson RT, Tominaga K, Matsunashi T, Deguchi K, et al. Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor beta. Proc Natl Acad Sci U S A. 1996; 93: 12359–12363. pmid:8901586
  16. 16. Osato M. Point mutations in the RUNX1/AML1 gene: another actor in RUNX leukemia. Oncogene. 2004; 23: 4284–4296. pmid:15156185
  17. 17. Osato M, Yanagida M, Shigesada K, Ito Y. Point mutations of the RUNx1/AML1 gene in sporadic and familial myeloid leukemias. Int J Hematol. 2001; 74: 245–251. pmid:11721958
  18. 18. Roumier C, Fenaux P, Lafage M, Imbert M, Eclache V, Preudhomme C. New mechanisms of AML1 gene alteration in hematological malignancies. Leukemia. 2003; 17: 9–16. pmid:12529654
  19. 19. Song WJ, Sullivan MG, Legare RD, Hutchings S, Tan X, Kufrin D. Haploinsufficiency of CBFA2 causes familial thrombocytopenia with propensity to develop acute myelogenous leukaemia. Nat Genet. 1999; 23: 166–175. pmid:10508512
  20. 20. Dowton SB, Beardsley D, Jamison D, Blattner S, Li FP. Studies of a familial platelet disorder. Blood. 1985; 65: 557–563. pmid:3855665
  21. 21. Michaud J, Wu F, Osato M, Cottles GM, Yanagida M, Asou N. In vitro analyses of known and novel RUNX1/AML1 mutations in dominant familial platelet disorder with predisposition to acute myelogenous leukemia: implications for mechanisms of pathogenesis. Blood. 2002; 99: 1364–1372. pmid:11830488
  22. 22. Mendler JH, Maharry K, Radmacher MD, Mrozek K, Becker H, Metzeler KH. RUNX1 mutations are associated with poor outcome in younger and older patients with cytogenetically normal acute myeloid leukemia and with distinct gene and MicroRNA expression signatures. J Clin Oncol. 2012; 30: 3109–3118. pmid:22753902
  23. 23. Harada H, Harada Y, Niimi H, Kyo T, Kimura A, Inaba T. High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia. Blood. 2004; 103: 2316–2324. pmid:14615365
  24. 24. Imai O, Kurokawa M, Izutsu K, Hangaishi A, Maki K, Ogawa S. Mutational analyses of the AML1 gene in patients with myelodysplastic syndrome. Leuk Lymphoma. 2002; 43: 617–621. pmid:12002768
  25. 25. Imai Y, Kurokawa M, Izutsu K, Hangaishi A, Takeuchi K, Maki K. Mutations of the AML1 gene in myelodysplastic syndrome and their functional implications in leukemogenesis. Blood. 2000; 96: 3154–3160. pmid:11049997
  26. 26. Tsai SC, Shih LY, Liang ST, Huang YJ, Kuo MC, Huang CF. Biological Activities of RUNX1 Mutants Predict Secondary Acute Leukemia Transformation from Chronic Myelomonocytic Leukemia and Myelodysplastic Syndromes. Clin Cancer Res. 2015; 21: 3541–3551. pmid:25840971
  27. 27. Antony-Debre I, Manchev VT, Balayn N, Bluteau D, Tomowiak C, Legrand C. Level of RUNX1 activity is critical for leukemic predisposition but not for thrombocytopenia. Blood. 2015; 125: 930–940. pmid:25490895