Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Spatiotemporal expression of the putative MdtABC efflux pump of Phtotorhabdus luminescens occurs in a protease-dependent manner during insect infection

  • Ziad Abi Khattar ,

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    ziad.abikhattar@ul.edu.lb

    Affiliation Laboratory of Georesources, Geosciences and Environment, Microbiology team, Faculty of Science 2, Lebanese University, Fanar, Lebanon

  • Anne Lanois,

    Roles Conceptualization, Formal analysis, Investigation, Methodology, Resources, Supervision, Validation, Writing – review & editing

    Affiliations INRA, UMR Diversité, Génomes et Interactions Microorganismes-Insectes, Montpellier, France, Université de Montpellier, UMR Diversité, Génomes et Interactions Microorganismes-Insectes, Montpellier, France

  • Linda Hadchity,

    Roles Investigation

    Affiliation Laboratory of Georesources, Geosciences and Environment, Microbiology team, Faculty of Science 2, Lebanese University, Fanar, Lebanon

  • Sophie Gaudriault,

    Roles Formal analysis, Supervision, Writing – review & editing

    Affiliations INRA, UMR Diversité, Génomes et Interactions Microorganismes-Insectes, Montpellier, France, Université de Montpellier, UMR Diversité, Génomes et Interactions Microorganismes-Insectes, Montpellier, France

  • Alain Givaudan

    Roles Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – review & editing

    Affiliations INRA, UMR Diversité, Génomes et Interactions Microorganismes-Insectes, Montpellier, France, Université de Montpellier, UMR Diversité, Génomes et Interactions Microorganismes-Insectes, Montpellier, France

Abstract

Photorhabdus luminescens is an enterobacterium establishing a mutualistic symbiosis with nematodes, that also kills insects after septicaemia and connective tissue colonization. The role of the bacterial mdtABC genes encoding a putative multidrug efflux system from the resistance/nodulation/cell division family was investigated. We showed that a mdtA mutant and the wild type had similar levels of resistance to antibiotics, antimicrobial peptides, metals, detergents and bile salts. The mdtA mutant was also as pathogenic as the wild-type following intrahaemocoel injection in Locusta migratoria, but had a slightly attenuated phenotype in Spodoptera littoralis. A transcriptional fusion of the mdtA promoter (PmdtA) and the green fluorescent protein (gfp) encoding gene was induced by copper in bacteria cultured in vitro. The PmdtA-gfp fusion was strongly induced within bacterial aggregates in the haematopoietic organ during late stages of infection in L. migratoria, whereas it was only weakly expressed in insect plasma throughout infection. A medium supplemented with haematopoietic organ extracts induced the PmdtA-gfp fusion ex vivo, suggesting that site-specific mdtABC expression resulted from insect signals from the haematopoietic organ. Finally, we showed that protease inhibitors abolished ex vivo activity of the PmdtA-gfp fusion in the presence of haematopoietic organ extracts, suggesting that proteolysis by-products play a key role in upregulating the putative MdtABC efflux pump during insect infection with P. luminescens.

Introduction

Photorhabdus luminescens is a member of the family Enterobacteriaceae. This bacterium is highly pathogenic to many insects and maintains a mutualistic relationship in the gut of free-living entomopathogenic nematodes [1]. On reaching the insect haemocoel, nematodes regurgitate their bacterial load in the haemolymph (insect blood). Despite the efficient immune response of the insect host, Photorhabdus survives antimicrobial defences in the haemolymph, including circulating antimicrobial peptides (AMPs) [2, 3]. The most attractive site for early bacterial colonization outside the haemolymph is the connective tissue within the muscle layers of the mid-gut of lepidopterans and within the haematopoietic organ (HO) of Locusta migratoria larvae [4, 5]. The HO is a filter that captures bacteria before phagocytosis by tissue-specific phagocytes, trapping them in nodules. These nodules are composed of haemocytes and play a key role in the cellular response by surrounding aggregated bacteria [6, 7]. Bacteria growing in the haemolymph and connective tissues produce large amounts of toxins and virulence factors, including proteases, leading to insect death by lethal septicaemia within 24 to 48 hours of infection [5, 8].

Increasing interest in bacterial behaviour during infection has led to the monitoring of pathogen gene expression in response to the ever-changing environment of the infected host to improve our understanding of host–microbe interactions [9]. Host-induced genes are required for adaptation of the microbe to the new metabolic requirements of life in host tissues, and for tissue colonization and the disruption of host cellular functions and immune responses [10, 11]. Important among these factors are Resistance/Nodulation/cell Division (RND) multidrug efflux pumps that can extrude a wide range of substrates including, besides exogenous and self-produced antibiotics, damaging endogenous metabolites and toxic xenobiotics, heavy metals, organic pollutants, plant-produced compounds, quorum sensing signals, and bacterial toxins, among others [1215]. Hence, some RND drug efflux systems are required for colonization and full virulence in vivo [1620], and were recently shown to impact virulence factor production and adaptive responses via periplasmic sensor proteins in Vibrio cholerae [21].

The best studied RND efflux pumps are AcrAB-TolC and MdtABC-TolC in Escherichia coli and Salmonella enterica [2225], and MexAB-OprM in Pseudomonas aeruginosa [26, 27]. In E. coli, the mdtABC (multidrug transporter ABC, formerly known as yegMNO) genes encode the MdtABC drug efflux system that comprises the transmembrane MdtB/MdtC heteromultimer and MdtA membrane fusion protein. This export system requires the multifunctional outer membrane channel TolC for its function, encoded by the tolC gene not located in the same cluster [28]. These broad-specificity transporters decrease the cellular accumulation of structurally diverse substrates some of which are also inducers of host origin such as bile salts, AMPs, plant flavonoids, and fatty acids, thereby conferring multi-drug resistance (MDR) in these bacteria [2931]. Moreover, RND efflux pumps were shown to have a role in microbial interspecific competition and establishment of infection by protecting pathogenic bacteria against antibiotics produced by the microbial community present in the same environment [14]. In line with all these, the MdtABC efflux pump has been shown to be required for full Salmonella colonization of intestine and virulence in mice, as well as for full ability of the plant pathogen Erwinia to multiply in apple rootstock [25].

A key to understanding bacterial strategies to effectively exploit these multiple efflux pumps lies in the regulation of pump expression. The currently available data show that multidrug transporters are often expressed under precise and elaborate transcriptional control by local and global regulators [15, 32]. The expression of different RND efflux pumps could be induced by different host-produced compounds, contributing to a successful colonization of different sites within the host during the infection process [12]. In E. coli and Salmonella, the expression of the multidrug efflux pump MdtABC is regulated by two stress response systems, Bae and Cpx. The BaeSR and CpxARP two-component signal transduction systems respond to damage of the cell envelope; however, they differ with regard to specific inducers. BaeR is considered the primary regulator of mdtABC in response to a wide range of environmental stresses in vitro, including exposure to indole, tannins, flavonoids, tungstate, zinc, and copper that are also substrates for this pump along with bile salts derivatives, SDS and novobiocin [23, 28, 33, 34]. The overlapping substrate specificities of Mdt transporters among enterobacteria for novobiocin and bile salts suggest that these compounds may be similar to the natural substrates of these pumps such as sodium tungstate and flavonoids [35]. Pletzer and Weingart demonstrated that the expression of the mdtABC operon in the phytophatogen E. amylovora was induced by the plant polyphenol tannin in a BaeSR-dependent manner. They further showed that MdtABC was upregulated in vivo during bacterial growth in planta suggesting a role of this efflux pump in resistance towards antimicrobial plant compounds, such as flavonoids [36]. Similarly in P. aeruginosa, expression of the mexAB-oprM genes is increased in the upper layer of a biofilm upon colistin exposure so that a spatially distinct subpopulation of metabolically active cells develop tolerance to this AMP [37]. For instance, there is no data available about RND efflux pumps of entomopathogenic nematode-associated bacteria, and here we propose to monitor their expression and to assess their roles in the life cycle of Photorhabdus luminescens within its insect hosts.

In the present study, we identified genes from P. luminescens encoding a putative MdtABC efflux pump, which shows sequence similarity to other proven efflux pumps of enterobacteria. The mdtA mutant showed wild-type levels of MDR and virulence in insects. We then showed that the mdtABC operon was specifically induced during late stages of insect infection, within bacterial aggregate formations in the connective tissue of L. migratoria HO and that of S. littoralis midgut. Finally, we described a protease-dependent induction of the mdtABC promoter ex vivo in a HO extract-containing medium.

Materials and methods

Bacterial strains, plasmids and growth conditions

The bacterial strains and plasmids used in this study are listed in Table 1. Photorhabdus luminescens TT01 [38] was routinely grown in LB broth (DIFCO) or on nutrient agar (DIFCO) at 28°C. Escherichia coli XL1-Blue MRF’ (Stratagene) and S17.1 (Simon, 1984) were routinely grown in LB or on LB agar at 37°C. When required, the final concentrations of antibiotics were: 10 μg.ml-1 gentamicin (Gm) for strains harbouring the pBBR1-MCS5 plasmid, 30 μg.ml-1 Gm for strains harbouring the pJQ200KS plasmid, 20 μg.ml-1 kanamycin (Kan), 20 μg.ml-1 chloramphenicol (Cm) for E. coli and 15 μg.ml-1 Cm for P. luminescens.

thumbnail
Table 1. Strains and plasmids used in this study.

https://doi.org/10.1371/journal.pone.0212077.t001

Construction of the P. luminescens ΔmdtA mutant

We created a stable chromosomal mutation in the mdtA gene of P. luminescens TT01 (mdtAPl) by allelic exchange, by constructing a derivative of pJQ200KS carrying the upstream part of the target mdtA gene (690 bp extending from positions—532 to + 158 with respect to the mdtA translation initiation site), an ΩCm antibiotic resistance cassette [42], and the downstream part of the target gene (603 bp extending from positions—453 to + 130 with respect to the mdtA stop codon). TT01 genomic DNA fragments were amplified by PCR with the oligonucleotide primer pairs 5’ -GCGCTCTAGAATCATCGGAAGCCGTATCTG- 3’ / 5’ -CGCGGATCCGGGGGGTAAAGGGGAATGTCT- 3’ (upstream region) and 5’-CGCGGATCCGGTTGTTAGTGCCTGGGATCG- 3’ / 5’ -GCGCGAGCTCCCACTTCCGGTAATGCAGAC- 3’ (downstream region). The PCR products were restricted with XbaI/BamHI and BamHI/SacI enzymes, the recognition sites of which are underlined. The ΩCm antibiotic resistance cassette was isolated as a 3.5 kb BamHI fragment from the pHP45-ΩCm plasmid. This 3.5 kb DNA fragment was then ligated into the BamHI site, between the upstream and downstream mdtA regions, the resulting fragment being inserted into the pUC19/XbaI-SacI vector to generate pUC-mdtA-ΩCm. The full-length 4.8 kb mdtA-ΩCm DNA fragment was gel-purified, digested with XbaI and SacI and inserted into the corresponding restriction sites of the pJQ200KS vector, yielding pJQ-mdtA-ΩCm. The pJQ200KS plasmid is a derivative of pACYC184 carrying the sacB gene and the mob site from RP4. The pJQ-mdtA-ΩCm plasmid was used to transform E. coli strain S17.1 and was introduced into P. luminescens TT01 by mating, as previously described [43]. CmR and SacR exconjugants were selected on 3% sucrose and LB agar supplemented with chloramphenicol. The 612 bp mdtA deletion and the omega insertion were checked by PCR analysis and DNA sequencing (MACROGEN, Seoul, Korea). The polar effect of mdtA mutation was checked by reverse transcription PCR (RT-PCR). The resulting recombinant clone was named ΔmdtA.

Construction of vectors for complementation assays

The entire mdtABC operon of P. luminescens TT01 (plu2774-plu2776) (https://www.genoscope.cns.fr/agc/mage) was amplified by PCR from TT01 genomic DNA with the high-fidelity Herculase DNA polymerase (Stratagene) and the oligonucleotide primers 5’-GCGCCTGCAGGCCTTGCGTTTGAGAGAATG-3’ and 5’- GCGCTCTAGACCACTGATGCCGAGTTTCAT-3’, which include recognition sites for PstI and XbaI, respectively. The resulting 7.5 kb fragment was digested with PstI and XbaI and ligated with the pBBR1MCS-5 vectors digested with the same enzymes. E. coli XL1-Blue MRF’ was transformed with the ligation product, according to standard protocols [44]. The resulting plasmid, pBB-mdtABC, was checked by restriction and sequencing (MACROGEN, Seoul-Korea) and transferred into ΔmdtA by mating [43]. We then checked, by RT-qPCR, that the mdtABC operon was expressed in the complemented mutant.

Determination of the minimum inhibitory concentrations of toxic compounds

In vitro susceptibility tests to determine minimum inhibitory concentrations (MICs) for wild-type P. luminescens and its derivatives were performed for a range of antimicrobial peptides (AMPs): cecropin A (Sigma), polymyxin B sulphate (Sigma), colistin methanesulphate (Sigma) and Spodoptera frugiperda-derived cecropin B [45]; antibiotics (Sigma): novobiocin, kanamycin, erythromycin, tetracycline, ampicillin, cefoxitin, rifampicin, ciprofloxacin, cefaclor, cefuroxime, ceftriaxone, enrofloxacin, and nalidixic acid; dyes: Bromothymol blue; metals (Sigma): copper (CuSO4), magnesium (MgSO4), and zinc (ZnSO4); bile-salts: sodium deoxycholate (Sigma); detergents: sodium dodecyl sulphate (Fluka), and quaternary ammoniums: Triphenyl tetrazolium chloride (Sigma), and flavonoids (Sigma): quercetin, rutin and saponin. Efflux pump inhibitors 1-(1-naphthylmethyl)-piperazine (NMP) (Chess GmbH) and Phe-Arg-β-naphthylamide dihydrochloride (PAβN) (Sigma) were used at concentrations of 50 μg.ml-1 and 25 μg.ml-1, respectively. Briefly, 96-well microtiter plates containing various concentrations of each antimicrobial agent to be tested were prepared by two-fold dilution in LB broth supplemented with gentamicin, if necessary. Wells were inoculated with 103 CFU of mid-exponential growth-phase bacterial cultures. Growth was scored visually after 48 hours of incubation at 28°C. Additional in vitro studies of bacterial kinetics were carried out with an Infinite M200 microplate reader (TECAN) and growth was monitored by following the change in Absorbance at 600 nm (A600nm) at 30-minute intervals.

Construction of transcriptional fusions with the green fluorescent protein gene gfp[AAV]

The PmdtA-gfp[AAV] and Plac- gfp[AAV] transcriptional fusions were constructed by inserting the promoter regions of the mdtA gene (PmdtA) and of the lactose operon (Plac) upstream from a promoter-less gfp[AAV] gene [46] located on a low-copy plasmid, pPROBE’GFP-AAV [46]. Briefly, the 332 bp PmdtA corresponding to the sequence extending from positions—338 to—6 relative to the translation start site of the mdtA gene was amplified by PCR from P. luminescens TT01 genomic DNA with sense 5’-GCGCGAATTCCGCAGGAATATGTTCTATACACTATGG-3’ and antisense 5’-CGCGGATCCGACATTCTCTCAAACGCAAGG-3’ primers, in which the EcoRI and BamHI recognition sites, respectively, are underlined. Similarly, the Plac promoter (120 bp) was amplified by PCR from the bluntII-TOPO vector (Invitrogen), with sense 5’-GCTCTAGAGCGCAACGCAATTAATGTG-3’ and antisense 5’-GGGGTACCAGCTGTTTCCTGTGTGAAATTG-3’ primers, in which the XbaI and KpnI recognition sites, respectively, are underlined. The PCR products were purified and inserted upstream from the gfp[AAV] gene of pPROBE’gfp-AAV, to generate PmdtA-gfp[AAV] and Plac-gfp[AAV]. Mating experiments were performed as previously described [43], to transfer PmdtA-gfp[AAV] and Plac-gfp[AAV]-containing plasmids into P. luminescens strain TT01, resulting in P. luminescens-PmdtA-gfp[AAV] and P. luminescens-Plac-gfp[AAV], respectively. Plasmid stability was checked in bacteria isolated from infected insects.

In vivo infection assays

The Noctuidae species studied (S. littoralis and S. frugiperda) and locusts, L. migratoria, were reared on an artificial diet at 23°C and on grass at 30°C, respectively, with a photoperiod of 12 h. Larvae were selected and surface-sterilised with 70% (v/v) ethanol before intrahaemocoel injection. All the bacterial strains used were grown to late exponential growth phase in LB broth, washed and diluted in LB medium supplemented with 20 μg.ml-1 km, when necessary. We injected 20 μl each of bacterial suspension, containing 103 bacteria (for S. littoralis and S. frugiperda) or 104 bacteria (for L. migratoria), into groups of 20 larvae. LB medium was injected as a control into groups of 10 larvae. Treated larvae were incubated for up to 96 h, and the time of death of the insects was recorded. Bacterial concentrations, in CFU, were determined by plating dilutions on nutrient agar. Statistical analyses were performed, as previously described [43], with SPSS (SPSS, Chicago, IL), for the comparison of survival rates.

Insect dissection and histology

We assessed the in vivo expression of the gfp[AAV] transcriptional fusions in the body cavity of the insect by dissecting, at regular time points, the larval cuticle dorsally, removing pieces of the organs of interest (the haematopoietic organ in L. migratoria and mid-gut connective tissues of S. littoralis and S. frugiperda), squashing them between the slide and cover slip and viewing them under fluorescence conditions. 10 μl of insect haemolymph were examinated at regular intervals, by fluorescence microscopy (Leica).

In vitro reporter gene assays

We analysed the kinetics of gene expression in vitro by inoculating fresh LB containing the appropriate concentrations of kanamycin and a potential inducer to be tested, in black-sided clear bottomed 96-well plates (Greiner), with a 1/500 dilution of an overnight culture of wild-type TT01 strain carrying one of the various GFP fusions. The use of such a high dilution (1/500) ensured that GFP proteins present in the inocula were diluted out by the first cell divisions and do not interfere with the monitoring of gene expression. Plates were incubated for 48 h at 28°C, with orbital shaking, in an Infinite M200 microplate reader (Tecan). A600nm and GFP fluorescence intensity, with excitation at 485 ± 4.5 nm and emission at 520 ± 10 nm, were measured every 30 minutes. The effects of various chemical components on PmdtA activity were determined at maximum fluorescence intensity. Each of the follwing was added to an appropriate final concentration, as follows: 25 μg.ml-1 S. frugiperda cecropin B, 25 μg.ml-1 cecropin A (Sigma), 1 mM MgCl2, 0,5 mM FeSO4, 2 mM CuSO4. CuSO4 was added at 2 mM to the bacterial culture at mid-exponential growth phase (O.D600 = 0.4). The pH of the culture medium supplemented with these compounds was adjusted to that of LB medium, and we checked that cell growth was unaffected. We also investigated the effects of insect-derived molecules on PmdtA activity by removing HOs cleanly from 20 L. migratoria larvae and grinding them in 500 μl of cold PBS, with a microtissue grinder (Ultra-turrax, IKA). The mixture was centrifuged at 13000 g for 5 minutes and the supernatant was collected, filtered (0.2 μm pores) and stored at– 80°C until further use. For induction tests, the HO-derived stock solution was diluted (10-fold) in fresh LB medium. For the inhibition of proteases in bacterial and insect HO cells, Complete Mini and Complete Mini EDTA-free tablets (Roche) were added to the LB medium to yield a 0.4x solution. Plasma was collected from locust larvae by centrifuging haemolymph at 13000 g for 5 minutes, for the elimination of circulating cells. Plasma was then filtered (0.2 μm pores) and stored at– 80°C or used directly as a medium for bacterial inoculation. Growth data were recorded in triplicate for each set of conditions and A600nm and fluorescence recorded over 48 hours of incubation were averaged for the plotting of curves and histograms. Fluorescence intensities were then normalized with respect to bacterial cell density, by dividing the fluorescence unit value (FU) recorded at a given time and in a specific condition by the corresponding A600nm, to obtain a specific fluorescence value. For data analysis, Relative Fluorescence Units (RFUs) were determined by the ratio of the PmdtA-gfp[AAV] specific fluorescence value to that of the Plac-gfp[AAV] in a given condition and at maximum fluorescence intensity.

RNA preparation and quantitative RT-PCR analysis

Total RNA was extracted from P. luminescens TT01 wild-type strain cultured in LB broth (at an optical density of 0.4, corresponding to the middle of the exponential growth phase) in TRIzol reagent, according to the manufacturer’s instructions (Invitrogen). Total RNA was then purified with the High Pure RNA Isolation kit (Roche), including incubation with DNase I. RNA concentration was determined by measuring absorbance at 260 nm. For each RNA preparation, we assessed DNA contamination by carrying out a control PCR before RT-qPCR analysis.

RT-qPCR was performed in two steps. First, cDNAs were synthesised from 1 μg of total RNA with the Super Script II Reverse Transcriptase from Invitrogen and random hexamers (100 ng.μl -1) from Roche Diagnostics. Quantitative PCR was then performed, in triplicate, with the Light Cycler 480 SYBR Green I Master kit from Roche Diagnostics, with 1 μl of cDNA synthesis mixture and 1 μM of specific gene primers for mdtA (5’-GTTTTACAAGCTCAGAAAACGAATC-3’ and 5’-ACTGATTTGGGAATAAGATGCTTTC-3’) or 16S rRNA, used as the control gene (5’- AATGGCATCTAAGACTGGTTGACTG -3’ and 5’- TACCAGGGTATCTAATCCTGTTTGC -3’). The enzyme was activated by heating for 10 minutes at 95°C. The reaction mixture was then subjected to 45 cycles of 95°C for 5 s, 60°C for 5 s and 72°C for 10 s, with the Light Cycler 480 system (Roche) used for monitoring. Melting curves were analysed for each reaction, and each curve contained a single peak. We determined the amounts of PCR products generated from standard curves obtained for PCR with serially diluted genomic DNA from P. luminescens TT01. Data were analyzed as a ratio, with 16S rRNA gene used as the control gene (95% confidence limits).

Results

Identification and genomic environment of the mdtABC operon in Photorhabdus

Analysis of the P. luminescens TT01 genome sequence [47] revealed the presence of a mdt locus containing three open reading frames, mdtA, mdtB and mdtC (plu2774 to plu2776) (Fig 1). The mdtA gene encodes a 401-amino acid (aa) putative membrane fusion protein (MFP) 64.29% (E-value of 1e-166) identical to the MdtA (YegM) protein of E. colithat serves as periplasmic “adaptor” connecting the inner membrane transporter (MdtB-MdtC) to an outer membrane channel such as TolC. MdtA of P. luminescens is also 81% identical to the TT01 acrA (acriflavin resistance protein A precursor)-encoded proteins AcrA. Both mdtB and mdtC genes encode homomultimer RND-type transporter proteins MdtB and MdtC that share 48.04% of identity and are 77.81% (E-value of 0,0) and 76.13% (E-value of 0,0) identical to MdtB (YegN) and MdtC (YegO) of E. coli, respectively. MdtB and MdtC are each partially identical to TT01 AcrB (acriflavin resistance protein B) (28.42% and 28.9%, respectively) and to the plu0758 gene product (28.26% and 27.74%, respectively) which is predicted to be similar to a RND-type multidrug transporter AcrB/AcrD/AcrF with a highly conserved AcrB domain. The genome sequences of E. coli and Salmonella also contain a gene encoding an additional putative MFS-type drug exporter, MdtD. mdtD is located between the mdtC and baeS genes. However, there is no mdtD gene in the genome of Photorhabdus (Fig 1). In E. coli and Salmonella, the function of the MdtABC transporter requires the outer membrane channel TolC that is also found in the Photorhabdus genome (plu3954). According to Joshi and Xu (2007) in their measure of functional similarity based on Gene Ontology annotation, if two proteins have sequence identity more than 70%, they have about 90% probability or more to share the same biological process [48]. In line with this and in light of the high amino acid sequence similarity of Mdt proteins from P. luminescens and E. coli, as well as the remarkable similarities in genomic organization of the mdtABC operon among enterobacteria, the MdtABC complex of P. luminescens is likely to be an export system whose function also requires TolC. Moreover, the 121 nucleotides downstream from the TT01 mdtC stop codon constitute the baeS/baeR genes, which are thought to encode putative sensor kinase BaeS and response regulator BaeR, which are 61.09% and 70.74% identical to BaeS and BaeR of E. coli, respectively (Fig 1). The presence of short intergenic sequences, an absence of putative terminators between the genes and the presence of a putative terminator downstream from baeR strongly suggest that the baeSR operon may be transcribed with mdtABC as a monocistronic RNA, as in E. coli and Salmonella [28, 34].

thumbnail
Fig 1. Genomic organisation of the mdtABC and baeSR loci in Photorhabdus luminescens TT01 and several enterobacteria.

Photorhabdus luminescens TT01 (BX470251), Salmonella typhimurium LT2 (AE006468), and Escherichia coli K-12 (U00096). kb, kilobases.

https://doi.org/10.1371/journal.pone.0212077.g001

Phenotypic characterisation of the isogenic P. luminescens ΔmdtA mutant

We investigated the role of the mdtABC operon in P. luminescens TT01 by inactivating the mdtA gene by allelic exchange. The phenotypic traits of the resulting ΔmdtA mutant and the wild-type strain were then compared. The ΔmdtA and wild-type TT01 grew similarly in LB medium at 28°C, indicating that the mdtA mutation did not affect bacterial growth. We then assessed the role of the mdtABC operon in the resistance of P. luminescens to various antimicrobial compounds (bile salts, antibiotics, AMPs, detergents and metals), by determining MICs for growth for the wild-type and ΔmdtA strains (Table 2). The ΔmdtA and wild-type strains had similar susceptibilities to all the antimicrobial compounds tested. RT-qPCR experiments showed that mdtABC expression was ten times stronger in the complemented strain (ΔmdtA/pBB-mdtABC) but no increase in MIC was observed. Thus, mdtABC inactivation is not sufficient to reduce the metal or antimicrobial resistance of P. luminescens.

thumbnail
Table 2. Minimum growth-inhibitory concentrations (MICs)a of various antimicrobial and toxic compounds for wild-type P. luminescens TT01 (TT01 WT), the ΔmdtA mutant and its derivatives harbouring pBBR1-MCS5 or pBB-mdtABC.

https://doi.org/10.1371/journal.pone.0212077.t002

We also investigated the effect of efflux pump inhibitors (EPI) on both wild-type TT01 and ΔmdtA strain resistance to some antimicrobial agents. Phenyl-arginine-β-naphthylamide (PAβN) acts as broad-spectrum EPI in various Gram-negative bacteria [49], whereas arylpiperidines, such as 1-(1-naphthylmethyl)-piperazine (NMP) moderately decrease MDR in E. coli strains overexpressing RND-type efflux pumps [50, 51]. Both PAβN and the NMP EPIs block RND-type efflux pumps, such as E. coli AcrAB, specifically. We established the EPI concentrations to be used in assays with antimicrobial compounds at concentrations of 50 μg.ml-1 for NMP and 25 μg.ml-1 for PAβN, values one quarter and one eighth the MICs of these inhibitors for wild-type TT01 and ΔmdtA strains, respectively. Only PAβN significantly decreased, to various degrees, the MICs in wild-type TT01 and ΔmdtA of SDS, rifampicin, novobiocin, nalidixic acid and copper, with respect to the control values obtained in the absence of EPIs (Table 3). This suggests that these compounds are substrates of RND-type efflux transporters, but not solely of the MdtABC efflux pump.

thumbnail
Table 3. Minimum growth-inhibitory concentrations (MICs)a of various antimicrobial and toxic compounds in the presence and absence of RND-type efflux pump inhibitors (PAβN or NMP) for wild-type P. luminescens TT01 (TT01 WT), the ΔmdtA mutant and its derivatives harbouring pBBR1-MCS5 or pBB-mdtABC.

https://doi.org/10.1371/journal.pone.0212077.t003

We also investigated the role of the mdtABC operon in the pathogenicity of P. luminescens in insect larvae by injecting similar doses of the wild-type TT01 strain or its isogenic mdtA mutant directly into the haemocoel of each Spodoptera littoralis, S. frugiperda and Locusta migratoria larva, and by monitoring the insect mortality over time after the injection. Surprisingly, only bacterial injections into S. littoralis larvae showed the mdtA mutant to be slightly attenuated for virulence (Fig 2). These larvae infected with mdtA mutant cells died about 9 h later than larvae infected with the P. luminescens wild-type strain. The mdtA mutation had no effect on insect survival in another lepidopteran, S. frugiperda, or the locust.

thumbnail
Fig 2.

Survival plot of Spodoptera littoralis insect larvae after the injection of Photorhabdus luminescens TT01 wild-type (black line) and mdtA mutant (dotted line). Each experiment was performed with 20 larvae for each bacterium tested and the results shown are the survival functions obtained in four independent experiments. Statistical analyses with SPSS showed that the survival curve of the mdtA mutant was significantly different from that of the wild type (P < 0.0001). The calculated median survival times of larvae infected with WT and mdtA mutant were 34.9 h and 43.5 h, respectively.

https://doi.org/10.1371/journal.pone.0212077.g002

Copper increases P. luminescens mdtABC promoter activity in vitro

For characterisation of the expression of the P. luminescens mdtABC operon, we fused P. luminescens PmdtA to the reporter gene gfp[AAV] (which encodes a destabilized GFP with a half-life of ~60 min in E. coli) of pPROBE’-gfp[AAV] [46], a highly stable plasmid maintained without selection pressure in a sister taxon of P. luminescens, Xenorhabdus nematophila [52]. The expression of mdtABC in Salmonella is responsive to metals [34]. We first assessed the role of metals, such as copper, magnesium and iron, in regulating mdtABC gene expression in P. luminescens, by adding these metals to bacterial exponential growth-phase cultures, as described by Nishino et al. (2007). Similarly, we investigated the effects of AMPs from insects, such as cecropin A and Sf cecropin B. Only the addition of copper (2 mM) to a mid-exponential growth phase culture of P. luminescens-PmdtA-gfp[AAV] significantly enhanced fluorescence emission without affecting bacterial growth. At the maximum rate, recorded six hours after the addition of copper, specific fluorescence was 2.3 times higher than that in the control LB culture to which no copper was added (Fig 3).

thumbnail
Fig 3. Copper significantly enhances the PmdtA-gfp[AAV] activity in vitro in Photorhabdus luminescens.

Overnight cultures of P. luminescens carrying the PmdtA-gfp[AAV] fusion were diluted (1/500) in fresh LB medium in black-sided clear-bottomed 96-well plates (Greiner) and incubated at 28°C, with shaking, in a microplate reader system (TECAN). 2mM Copper was added to the bacterial culture at mid log phase (O.D600 equivalent to 0.4). Changes in A600nm and GFP fluorescence were monitored after copper supplementation and the data shown are maximum specific fluorescence obtained by FU/A600nm ratio value, calculated at six hours after the addition of copper. The results shown are the means of three experiments and asterisks indicate statistically significant differences (*, P < 0.05) in paired Student’s t tests.

https://doi.org/10.1371/journal.pone.0212077.g003

The mdtABC operon is expressed within specific insect tissues and induced ex vivo by insect haematopoietic organ extracts

For the characterisation of mdtA expression in vivo, we injected the TT01 strain carrying the PmdtA-gfp[AAV] fusion or the Placgfp[AAV] fusion (positive control) into the haemocoel of L. migratoria last-instar larvae (104 bacteria/larva) and S. littoralis fifth-instar larvae (103 bacteria/larva). We then monitored the presence of bacteria for up to 30 hours after infection in haemolymph, the locust haematopoietic organ (HO), and S. littoralis mid-gut connective tissues. We first localized P. luminescens-Plac-gfp[AAV] fluorescent bacteria to the sites of preferential colonization: the haemolymph (Fig 4A, 4B, 4E and 4F), the HO of L. migratoria (Fig 5A), and the mid-gut connective tissues of S. littoralis (Fig 5K) from 20 hours to 30 hours after infection.

thumbnail
Fig 4. Comparison of the in vivo expression of the Photorhabdus luminescens mdtABC operon and constitutive GFP expression in Locusta migratoria and Spodoptera littoralis haemolymphs.

Insects were injected with wild-type P. luminescens harbouring a transcriptional fusion between E. coli Plac (A, B, E, and F) or the mdtABC (C, D, G, and H) promoter and the gfp[AAV] reporter gene. Haemolymph was regularly extracted from infected larvae during infection, observed under a light microscope (A, C, E, and G) and fluorescence was determined (B, D, F, and H). The observations shown were made at 20 to 24 hours post-injection for S. littoralis larvae and at 30 hours post-injection for L. migratoria, and correspond to the results of at least three independent experiments. Scale bar represents 10 μm.

https://doi.org/10.1371/journal.pone.0212077.g004

thumbnail
Fig 5. In vivo site-specific expression of the Phototrhabdus luminescens mdtABC operon during colonization of Locusta migratoria HO and Spodoptera littoralis midgut.

Insects were injected with recombinant P. luminescens-Plac-gfp[AAV] (A-E and K-O) or with recombinant P. luminescens-PmdtA-gfp[AAV] (F-J and P-T). HO tissues were observed under a light microscope (B, D, G, I; L, N, Q, and S), or by fluorescence microscopy (A, C, E, F, H, and J). Nodules formed after the injection of P. luminescens TT01 or its derivatives into the L. migratoria haemocoel are indicated with white arrows (A, F, B, and G). Note the presence of bacterial aggregates within the connective tissues of the HO in L. migratoria (A and F) and in the vicinity of the midgut in S. littoralis (K and P), each injected with Photorhabdus. Pieces of HO in which nodule structures were visible (B and G) or not visible (D and I) were observed under the epifluorescence microscope (C and E, H and J, respectively). Brightly fluorescent green bacteria were detected in both cases, demonstrating the HO site-specific expression of PmdtA-gfp[AAV] within closed bacterial aggregates, independently of nodule structures. The circle (G) indicates the limit of a bacterial aggregate and arrowheads (H) indicate isolated bacteria. All these observations were made 20 to 28 hours post-injection for S. littoralis and at 30 hours post-injection for L. migratoria, and correspond to results of at least three independent experiments. ECM, extracellular matrix. Red scale bar represents 10 μm. White scale bar represents 50 μm.

https://doi.org/10.1371/journal.pone.0212077.g005

After injection of the P. luminescens-PmdtA-gfp[AAV] strain, only 5% of fluorescent bacteria were detected after recovery from haemolymph at 20 to 24 hours (S. littoralis) and 30 hours post-injection (L. migratoria) (Fig 4D and 4H). However, All P. luminescens-Plac-gfp[AAV] recovered from the haemolymph at the same time points were fluorescent (Fig 4B and 4F). Thus, PmdtA activity is almost entirely absent from the haemolymph in both Locusta and Spodoptera. In Locusta, numerous nodules were observed in the HO after the injection of P. luminescens-Plac-gfp[AAV] (Fig 5A and 5B). Constitutively fluorescent P. luminescens bacteria colonised the connective tissues of the locust HO and the lepidopteran mid-gut as bacterial aggregates, as observed under a fluorescence microscope (Fig 5A, 5C, 5E, 5F, 5H and 5J). The localisation of bacterial aggregates was not necessarily associated with the presence of nodules (Fig 5B–5E). Moreover, fluorescence microscopy observations of HO and mid-gut connective tissues showed that bacteria harbouring the PmdtA-gfp[AAV] fusion were fluorescent within aggregates (Fig 5F, 5H and 5J). Not all the fluorescent bacteria observed were in contact with nodules and the trachea in Locusta HO and Spodoptera, respectively, suggesting that the PmdtA activity was not related to these structures (Fig 5I, 5J, 5S and 5T).

For further confirmation of MdtABC induction ex vivo, we monitored the fluorescence of P. luminescens-PmdtA-gfp[AAV] grown in the plasma (cell-free haemolymph) of locust larvae or in HO homogenate-containing medium. We found that PmdtA activity was almost entirely absent when bacteria were grown in plasma, but very strong in locust HO extracts (Fig 6). Indeed, the specific fluorescence of P. luminescens-PmdtA-gfp[AAV] in the presence of locust HO extracts measured in vitro was at least 12 times stronger than that recorded in the plasma of the same insect (Fig 6). These experiments clearly support the in vivo observations and indicate that the PmdtA activity is tissue-specific. Moreover, we observed under fluorescence microscopy bacteria from culture-based induction assays at different time intervals and during peak expression. We first showed that both planktonic and aggregated bacterial cells from HO-containing cultures strongly expressed GFP. However, bacteria grown in either plasma or LB showed slight expression similar to what we have observed in the plasma from infected insects. These results suggestthat mdtABC expression in locust HO was unrelated to aggregate formation. Such a transient (late stages of infection) and spatially (connective tissues) specific expression of mdtABC operon most probably improve bacterial dissemination and persistence into the insect cadaver. Moreover, giving the strong activity of the PmdtA reported both ex vivo and in vivo in the locust HO, we wanted to test the phenotype of Photorhabdus under these conditions regarding MICs changes in vitro. P. luminescens mdtA mutant and wild-type strains exhibited the same MICs for SDS, Kanamycin, copper, and novobiocin, in the presence or absence of HO extracts (S1 Table).

thumbnail
Fig 6. Level of expression of Photorhabdus luminescens mdtABC operon in Locusta migratoria plasma and medium containing HO extract in vitro.

Overnight cultures of P. luminescens carrying the PmdtA-gfp[AAV] fusion were diluted (1/500) in black-sided clear-bottomed 96-well plates containing one of the following media: fresh LB medium, plasma or fresh LB medium supplemented with L. migratoria HO extract. A600nm and GFP fluorescence were monitored, in real time, in triplicate for each set of conditions, at 28°C, with orbital shaking, in an Infinite M200 microplate reader (TECAN). Specific fluorescence was obtained by dividing GFP fluorescence units (FU) by the A600nm value at 20 hours of growth. Relative Fluorescence Units (RFUs) were determined by the ratio of the PmdtA-gfp[AAV] specific fluorescence value to that of the Plac-gfp[AAV]. Asterisks indicate statistically significant differences (*, P <0.05) in the paired Student’s t test. The expression rate is the ratio between specific activity obtained after incubation with HO extracts and that obtained after incubation with insect plasma.

https://doi.org/10.1371/journal.pone.0212077.g006

HO-mediated mdtABC expression is reduced by protease inhibitors

For preliminary characterisation of the HO-derived putative signals for mdtABC expression, the TT01 strain carrying the PmdtA-gfp[AAV] fusion in LB supplemented was grown with HO extracts untreated or previously heated at 60°C. The use of heated HO extracts resulted in significantly lower levels of PmdtA-gfp[AAV] activity (S1 Fig), indicating that the stimuli upregulating mdtABC expression are non-heat stable and could be proteinaceous in nature (proteins or peptides).

Photorhabdus produces high numbers of proteases during the colonization of insect host tissues [5]. We therefore focused on the protease-dependent modulation of mdtABC gene expression. We monitored the expression of both PmdtA-gfp[AAV] and Plac-gfp[AAV] fusions in TT01 strain, by recording GFP fluorescence in LB supplemented with HO extracts in the presence and absence of complete mini EDTA-free protease inhibitor, which fully inhibits a broad spectrum of serine and cysteine proteases (Fig 7A). We first showed that a 0.4x solution of EDTA-free protease inhibitor had no effect on bacterial growth (data not shown). We then showed that expression of the PmdtA-gfp[AAV] fusion was inhibited by the addition of EDTA-free protease inhibitor to the culture medium containing the inductive HO extract, no such inhibition being observed with non-supplemented control medium (Fig 7A). As a control, expression of the Plac-gfp[AAV] fusion remained very strong in the presence of HO extracts and inhibitors (Fig 7B). Thus, expression of the mdtABC operon in Photorhabdus is dependent on proteolysis by-products.

thumbnail
Fig 7. Cysteine and serine protease inhibitors prevent expression of the mdtABC operon.

TT01 strains carrying the PmdtA–gfp[AAV] (A) or Plac–gfp[AAV] (B) fusions were grown in LB medium containing HO extracts and supplemented (× and □) or not supplemented (● and ♦) with complete mini EDTA-free protease inhibitor. Specific fluorescence is expressed as the ratio of GFP fluorescence units (FU) to A600nm value. The results are representative of three independent assays.

https://doi.org/10.1371/journal.pone.0212077.g007

Discussion

We examined the role of the putative MdtABC efflux pump in P. luminescens MDR and virulence. P. luminescens ΔmdtA was as resistant as the wild-type strain to common substrates of multidrug transporters, such as DOC, SDS and novobiocin. We therefore suggest that the MdtABC multidrug transporter alone is not required for MDR in P. luminescens, at least in vitro. However, this is not surprising because the deletion of single RND drug efflux pump genes, including the mdtABC operon of S. enterica and E. coli, has no significant effect on drug resistance, other than in acrAB mutants [25, 34]. As mentioned in results section, other putative RND pumps-encoding genes are present in the genome of P. luminescens TT01 such as acrAB and acrB/acrD/acrF homologues, that probably contribute to MDR resistance in Photorhabdus as described in other enterobacteria [22, 25, 53, 54]. This hypothesis is strongly supported by our findings that RND inhibitors significantly enhanced bacterial susceptibility to SDS, rifampicin, novobiocin and nalidixic acid, all of which are common substrates of RND efflux pumps. Although some substrates of the MdtABC efflux pump were characterized in some bacteria, most of its known substrates, such as antibiotics and detergents, are not encountered in the natural environment of these bacteria. In this study, we showed that the genetic control of the MdtABC-mediated efflux is characterized by a well regulated expression of the mdtABC genes in specific spatial (connective tissues) and temporal (late infection stages) patterns. Therefore, it seems likely that the MdtABC efflux system may have evolved for specific purposes during the interaction of Photorhabdus with its invertebrate hosts from symbiosis with nematodes to pathogenicity for insects. In this regard, it is noteworthy that the natural environment of Photorhabdus, especially the insect cadaver, is enriched in antimicrobial compounds produced by Photorhabdus itself, such as potentially toxic metabolites [5557], bacteriocins [58], and stilbene [5961], as well as other antibiotics that are released by the competitive microbiota of both the nematode and the insect [62, 63].

Bacterial multidrug efflux pumps of the RND family have been shown to be important for virulence in model animals, following infection via several routes, including ingestion, inhalation and the intraperitoneal injection of bacteria [64, 65]. We show here that P. luminescens ΔmdtA is as virulent as the wild-type strain after injection into haemocoel of the locust and the lepidopterans Spodoptera. These findings were expected given that Photorhabdus has a plenty of different and redundant virulence factors ranging from potent toxins and enzymes to PhoP-regulated LPS modification systems mediating resistance to AMPs produced in insect haemolymph upon infection [9]. Therefore, it is often hard to identify an effect on insect pathogenicity when just a single gene or operon that might contribute to virulence is inactivated. The only genes currently described as essential for P. luminescens resistance to AMPs and virulence in insects are phoP and pbgPE [66, 67], that were recently shown to govern the main virulence strategy of an AMP resistant subpopulation of P. luminescens causing septicemia in insects [68]. Previous studies of the colonization of insect larvae by P. luminescens have shown that the extracellular matrix of the connective tissues and haemolymph are initially more extensively colonized than other tissues [4, 5]. We showed, by transcriptional fusion with the gfp gene, that the PmdtA activity of Photorhabdus mdtABC operon was clearly increased in the connective tissues, but not in the plasma, during the infection of three insect species. We mimicked the ‘host-like’ conditions triggering the MdtABC efflux system encountered during bacterial colonization of the extracellular matrix, by dissecting the HO from Locusta. Only a moderately developed connective tissue enclosing the belts of muscle around the mid-gut is found in lepidopterans, such as Spodoptera. By contrast, a well-developed connective tissue with specialist cells and extracellular material, often organised into structured fibres (collagen), has been described in the HO along the dorsal vessel in Locusta migratoria [69]. Our ex vivo findings provide strong evidence for a specific signal within the HO but apparently absent from insect plasma. Collagen is a normal constituent of the animal extracellular matrix, including that of the insect L. migratoria, which has been shown to possess two types of collagen: a predominant fibrous collagen similar to collagen I from mammals and a minor collagenous component very similar to basement membrane collagen IV [69]. Preliminary assays showed that mammalian collagen IV and collagen I had no effect on mdtABC expression. Our studies have shown that expression of the lopT gene, encoding an antiphagocytic type three secretion system (TTSS) effector, is induced only at sites of cellular defence reactions, such as nodules in the HO of L. migratoria [4]. We show here that mdtABC expression is also site-specific but independent of these defence reactions, because fluorescent bacteria were not only associated with nodule formation in the HO.

Our data revealed that the inhibition of cysteine and serine proteases in HO-supplemented medium was sufficient to inhibit the ex vivo expression of PmdtA-gfp[AAV]. Indeed, Photorhabdus produces a wide range of proteases, including metalloproteases and non-metalloproteases, in culture media or in contact with insect tissues during infection [7072]. PrtA, a metalloprotease inhibited by disulfide bridge-reducing agents and SH group reagents, is a good candidate that is produced within the connective tissues close to the midgut epithelium during late infection stages in insects when septicaemia is well established [73, 74]. PrtA degrades basal lamina, providing the bacteria with access to the underlying tissues for bioconversion [5]. Moreover, the genome of the TT01 strain contains other sequences potentially corresponding to cysteine and serine protease- or peptidase-encoding genes [47]. The peptides and/or amino acids generated by the proteolytic action of these bacterial proteases on the HO tissue probably trigger the production of the MdtABC pump in vivo.

Sensing of and responding to environmental fluctuations via two-component systems are of vital importance for bacteria [75, 76], especially in the specific context of MDR [75, 77, 78]. Indeed, the BaeSR two-component system of E. coli and Salmonella detects specific envelope-damaging compounds (indole, zinc, copper and certain flavonoids) and induces the MdtABC efflux pump, which can expel these inducing compounds, as well as some antibiotics and bile salt derivatives, thereby maintaining bacterial envelope homeostasis [23, 34, 35, 79, 80]. The baeS and baeR genes are found immediately downstream from mdtABC in P. luminescens TT01 genome, suggesting that BaeSR may also regulate the expression of the mdt operon. This supports the hypothesis that the mdtA-inducing compounds within the insect HO are sensed by the Photorhabdus BaeSR pathway. Our data indicate that mdtABC expression is modulated by copper in vitro, but no change in P. luminescens copper resistance was observed with the mdtA mutant strain. This finding further suggests that the MdtABC pump may be one of multiple redundant systems contributing to metal homeostasis in Photorhabdus as demonstrated for Salmonella, and that other transporters may function independently or in synergy with MdtABC to increase copper resistance. This hypothesis is supported by our finding that mdtA gene was weakly expressed in the widely used laboratory LB medium, and that such expression was slighlty increased after copper supplementation. Copper in insects may derive from phenoloxidase that is a metalloenzyme involved in nodule formation [81]. As we already showed that the PmdtA activity was slightly increased (2.3 folds) by copper in vitro, we investigated whether copper induces MdtABC site-specific expression within the HO ex vivo. This seems consistent with the fact that proteases such as PrtA produced at later stages of infection could cause copper release from phenoloxidase in the HO, resulting in the increase in steady state levels of mdtABC expression. Nevertheless, we demonstrated that addition of a copper chelator to the HO extracts-containing medium did not affect GFP levels emitted by P. luminescens-PmdtA-gfp[AAV] comparing to a copper chelator-free medium, thereby suggesting that copper is not responsible of activating mdtABC expression within the HO.

The aim of this study was to elucidate the inducing cues and function of the putative MdtABC efflux pump in P. luminescens. Although no clear phenotype for the mdtA mutant has been identified, it is tempting to speculate that the Bae stress response pathway involving MdtABC may be involved in fostering Photorhabdus survival to the complex stresses of its hosts [82]. Microbes that can grow within the constraints of the insect cadaver may, themselves, produce stress through competitive or antagonistic interactions. Therefore, microbial activity in host tissues, or interactions with specific microbial taxa within the community, may induce multiple stresses that symbiotic Photorhabdus should overcome in order to increase their fitness and specific recruitment by the infective juvenile nematodes. These hypotheses are highly consistent with our findings concerning the site-specific expression of MdtABC during late infection stages prior to insect death. Further studies are required to determine the precise nature of signals involved in MdtABC induction as well as its natural substrates in P. luminescens. For instance, we suggest that these inducers could belong to by-products resulting from the action of proteases on HO matrix compounds. This would constitute a novel type of cross-talk, highlighting the versatility of efflux pumps in responses to the various compounds generated or encountered by bacteria in their surrounding environment.

Supporting information

S1 Table. Minimum growth-inhibitory concentrations (MICs)a of SDS, Kanamycin, copper, and novobiocin, for wild-type P. luminescens TT01 (TT01 WT), the ΔmdtA mutant and its derivatives harbouring pBBR1-MCS5 or pBB-mdtABC, in the presence or absence of HO extracts.

https://doi.org/10.1371/journal.pone.0212077.s001

(PDF)

S1 Fig. Heating of HO extracts abolishes the expression of the PmdtA-gfp[AAV] fusion in vitro.

TT01 strain carrying the PmdtA–gfp[AAV] fusion was grown in LB medium containing HO extracts previously heated at 60°C (×) or not heated (●). Specific fluorescence is expressed as the ratio of GFP fluorescence to Absorbance at 600 nm. The results are representative of three independent assays.

https://doi.org/10.1371/journal.pone.0212077.s002

(TIF)

S2 Fig. Microscopic observations of locust HO and Spodoptera midgut ECM infected with P. luminescens harbouring a promoter less fusion pPROBE’-gfp[AAV].

These figures serve as negative controls to show that bright fluorescence observed in Figs 4 and 5 is specific to PmdtA-gfp[AAV] and Plac-gfp[AAV] and that is not autofluorescence of insect tissues. Insects were injected with recombinant P. luminescens- pPROBE’-gfp[AAV]. Insect tissues and haemolymphs were observed by fluorescence microscopy. All these observations were made 20 to 28 hours post-injection for S. littoralis and at 30 hours post-injection for L. migratoria, and correspond to results of at least three independent experiments. ECM, extracellular matrix.

https://doi.org/10.1371/journal.pone.0212077.s003

(TIF)

S1 Dataset. Values behind the means and standard deviations used to build graph of Fig 3.

https://doi.org/10.1371/journal.pone.0212077.s004

(XLS)

S2 Dataset. Values behind the means and standard deviations used to build graph of Fig 6.

https://doi.org/10.1371/journal.pone.0212077.s005

(XLS)

S3 Dataset. Values behind the means and standard deviations used to build graph of Fig 7.

https://doi.org/10.1371/journal.pone.0212077.s006

(XLS)

Acknowledgments

We thank Gaëtan Clabots for insect rearing and Nadège Ginibre for HO extraction.

References

  1. 1. Boemare NE. Biology, taxonomy and systematics of Photorhabdus and Xenorhabdus. In: Gaugler R, editor. Entomopathogenic nematology. Wallingford, United Kingdom: CABI Publishing; 2002. p. 35–56.
  2. 2. Eleftherianos I, Marokhazi J, Millichap PJ, Hodgkinson AJ, Sriboonlert A, ffrench-Constant RH, et al. Prior infection of Manduca sexta with non-pathogenic Escherichia coli elicits immunity to pathogenic Photorhabdus luminescens: roles of immune-related proteins shown by RNA interference. Insect Biochem Mol Biol. 2006;36(6):517–25. pmid:16731347.
  3. 3. Waterfield NR, Ciche T, Clarke D. Photorhabdus and a host of hosts. Annu Rev Microbiol. 2009;63:557–74. pmid:19575559.
  4. 4. Brugirard-Ricaud K, Duchaud E, Givaudan A, Girard PA, Kunst F, Boemare N, et al. Site-specific antiphagocytic function of the Photorhabdus luminescens type III secretion system during insect colonization. Cell Microbiol. 2005;7(3):363–71. Epub 2005/02/01. CMI466 [pii] pmid:15679839.
  5. 5. Silva CP, Waterfield NR, Daborn PJ, Dean P, Chilver T, Au CP, et al. Bacterial infection of a model insect: Photorhabdus luminescens and Manduca sexta. Cell Microbiol. 2002;4(6):329–39. pmid:12067318.
  6. 6. Hoffmann D, Brehelin M, Hoffmann JA. Modifications of the hemogram and of the hemocytopoietic tissue of male adults of Locusta migratoria (Orthoptera) after injection of Bacillus thuringiensis. J Invertebr Pathol. 1974;24(2):238–47. pmid:4414702.
  7. 7. Hoffmann J. Etude de la récupération hémocytaire après hémorragies expérimentales chez l'orthoptère Locusta migratoria. J insect Physiol. 1969;15:1375–84.
  8. 8. ffrench-Constant R, Waterfield N, Daborn P, Joyce S, Bennett H, Au C, et al. Photorhabdus: towards a functional genomic analysis of a symbiont and pathogen. FEMS Microbiol Rev. 2003;26(5):433–56. Epub 2003/02/15. S0168644502001304 [pii]. pmid:12586390.
  9. 9. Nielsen-LeRoux C, Gaudriault S, Ramarao N, Lereclus D, Givaudan A. How the insect pathogen bacteria Bacillus thuringiensis and Xenorhabdus/Photorhabdus occupy their hosts. Curr Opin Microbiol. 2012;15(3):220–31. pmid:22633889.
  10. 10. Chiang SL, Mekalanos JJ, Holden DW. In vivo genetic analysis of bacterial virulence. Annu Rev Microbiol. 1999;53:129–54. Epub 1999/11/05. pmid:10547688.
  11. 11. Rediers H, Rainey PB, Vanderleyden J, De Mot R. Unraveling the secret lives of bacteria: use of in vivo expression technology and differential fluorescence induction promoter traps as tools for exploring niche-specific gene expression. Microbiol Mol Biol Rev. 2005;69(2):217–61. Epub 2005/06/10. 69/2/217 [pii] pmid:15944455; PubMed Central PMCID: PMC1197422.
  12. 12. Alvarez-Ortega C, Olivares J, Martinez JL. RND multidrug efflux pumps: what are they good for? Front Microbiol. 2013;4:7. pmid:23386844; PubMed Central PMCID: PMCPMC3564043.
  13. 13. Blanco P, Hernando-Amado S, Reales-Calderon JA, Corona F, Lira F, Alcalde-Rico M, et al. Bacterial Multidrug Efflux Pumps: Much More Than Antibiotic Resistance Determinants. Microorganisms. 2016;4(1). pmid:27681908; PubMed Central PMCID: PMCPMC5029519.
  14. 14. Martinez JL, Sanchez MB, Martinez-Solano L, Hernandez A, Garmendia L, Fajardo A, et al. Functional role of bacterial multidrug efflux pumps in microbial natural ecosystems. FEMS Microbiol Rev. 2009;33(2):430–49. Epub 2009/02/12. pmid:19207745.
  15. 15. Du D, Wang-Kan X, Neuberger A, van Veen HW, Pos KM, Piddock LJV, et al. Multidrug efflux pumps: structure, function and regulation. Nat Rev Microbiol. 2018;16(9):523–39. pmid:30002505.
  16. 16. Aendekerk S, Diggle SP, Song Z, Hoiby N, Cornelis P, Williams P, et al. The MexGHI-OpmD multidrug efflux pump controls growth, antibiotic susceptibility and virulence in Pseudomonas aeruginosa via 4-quinolone-dependent cell-to-cell communication. Microbiology. 2005;151(Pt 4):1113–25. pmid:15817779.
  17. 17. Hirakata Y, Srikumar R, Poole K, Gotoh N, Suematsu T, Kohno S, et al. Multidrug efflux systems play an important role in the invasiveness of Pseudomonas aeruginosa. J Exp Med. 2002;196(1):109–18. Epub 2002/07/03. pmid:12093875; PubMed Central PMCID: PMC2194012.
  18. 18. Lacroix FJ, Cloeckaert A, Grepinet O, Pinault C, Popoff MY, Waxin H, et al. Salmonella typhimurium acrB-like gene: identification and role in resistance to biliary salts and detergents and in murine infection. FEMS Microbiol Lett. 1996;135(2–3):161–7. pmid:8595853.
  19. 19. Bina XR, Lavine CL, Miller MA, Bina JE. The AcrAB RND efflux system from the live vaccine strain of Francisella tularensis is a multiple drug efflux system that is required for virulence in mice. FEMS Microbiol Lett. 2008;279(2):226–33. pmid:18179581.
  20. 20. Bina XR, Provenzano D, Nguyen N, Bina JE. Vibrio cholerae RND family efflux systems are required for antimicrobial resistance, optimal virulence factor production, and colonization of the infant mouse small intestine. Infect Immun. 2008;76(8):3595–605. pmid:18490456.
  21. 21. Bina XR, Howard MF, Taylor-Mulneix DL, Ante VM, Kunkle DE, Bina JE. The Vibrio cholerae RND efflux systems impact virulence factor production and adaptive responses via periplasmic sensor proteins. PLoS Pathog. 2018;14(1):e1006804. pmid:29304169; PubMed Central PMCID: PMCPMC5773229.
  22. 22. Ma D, Cook DN, Alberti M, Pon NG, Nikaido H, Hearst JE. Molecular cloning and characterization of acrA and acrE genes of Escherichia coli. J Bacteriol. 1993;175(19):6299–313. pmid:8407802.
  23. 23. Baranova N, Nikaido H. The baeSR two-component regulatory system activates transcription of the yegMNOB (mdtABCD) transporter gene cluster in Escherichia coli and increases its resistance to novobiocin and deoxycholate. J Bacteriol. 2002;184(15):4168–76. Epub 2002/07/11. pmid:12107134; PubMed Central PMCID: PMC135214.
  24. 24. Nikaido H, Basina M, Nguyen V, Rosenberg EY. Multidrug efflux pump AcrAB of Salmonella typhimurium excretes only those beta-lactam antibiotics containing lipophilic side chains. J Bacteriol. 1998;180(17):4686–92. Epub 1998/08/29. pmid:9721312; PubMed Central PMCID: PMC107484.
  25. 25. Nishino K, Latifi T, Groisman EA. Virulence and drug resistance roles of multidrug efflux systems of Salmonella enterica serovar Typhimurium. Mol Microbiol. 2006;59(1):126–41. Epub 2005/12/20. MMI4940 [pii] pmid:16359323.
  26. 26. Gotoh N, Tsujimoto H, Poole K, Yamagishi J, Nishino T. The outer membrane protein OprM of Pseudomonas aeruginosa is encoded by oprK of the mexA-mexB-oprK multidrug resistance operon. Antimicrob Agents Chemother. 1995;39(11):2567–9. pmid:8585747.
  27. 27. Li XZ, Nikaido H, Poole K. Role of mexA-mexB-oprM in antibiotic efflux in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1995;39(9):1948–53. pmid:8540696; PubMed Central PMCID: PMCPMC162861.
  28. 28. Nagakubo S, Nishino K, Hirata T, Yamaguchi A. The putative response regulator BaeR stimulates multidrug resistance of Escherichia coli via a novel multidrug exporter system, MdtABC. J Bacteriol. 2002;184(15):4161–7. Epub 2002/07/11. pmid:12107133; PubMed Central PMCID: PMC135206.
  29. 29. Nikaido H, Pages JM. Broad-specificity efflux pumps and their role in multidrug resistance of Gram-negative bacteria. FEMS Microbiol Rev. 2012;36(2):340–63. Epub 2011/06/29. pmid:21707670; PubMed Central PMCID: PMC3546547.
  30. 30. Ravirala RS, Barabote RD, Wheeler DM, Reverchon S, Tatum O, Malouf J, et al. Efflux pump gene expression in Erwinia chrysanthemi is induced by exposure to phenolic acids. Mol Plant Microbe Interact. 2007;20(3):313–20. pmid:17378434.
  31. 31. Barabote RD, Johnson OL, Zetina E, San Francisco SK, Fralick JA, San Francisco MJ. Erwinia chrysanthemi tolC is involved in resistance to antimicrobial plant chemicals and is essential for phytopathogenesis. J Bacteriol. 2003;185(19):5772–8. pmid:13129948; PubMed Central PMCID: PMCPMC193971.
  32. 32. Grkovic S, Brown MH, Skurray RA. Regulation of bacterial drug export systems. Microbiol Mol Biol Rev. 2002;66(4):671–701. pmid:12456787.
  33. 33. Hirakawa H, Inazumi Y, Masaki T, Hirata T, Yamaguchi A. Indole induces the expression of multidrug exporter genes in Escherichia coli. Mol Microbiol. 2005;55(4):1113–26. pmid:15686558.
  34. 34. Nishino K, Nikaido E, Yamaguchi A. Regulation of multidrug efflux systems involved in multidrug and metal resistance of Salmonella enterica serovar Typhimurium. J Bacteriol. 2007;189(24):9066–75. Epub 2007/10/16. JB.01045-07 [pii] pmid:17933888; PubMed Central PMCID: PMC2168627.
  35. 35. Leblanc SK, Oates CW, Raivio TL. Characterization of the induction and cellular role of the BaeSR two-component envelope stress response of Escherichia coli. J Bacteriol. 2011;193(13):3367–75. Epub 2011/04/26. pmid:21515766; PubMed Central PMCID: PMC3133272.
  36. 36. Pletzer D, Weingart H. Characterization and regulation of the resistance-nodulation-cell division-type multidrug efflux pumps MdtABC and MdtUVW from the fire blight pathogen Erwinia amylovora. BMC Microbiol. 2014;14:185. pmid:25012600; PubMed Central PMCID: PMCPMC4107485.
  37. 37. Pamp SJ, Gjermansen M, Johansen HK, Tolker-Nielsen T. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB-oprM genes. Mol Microbiol. 2008;68(1):223–40. pmid:18312276.
  38. 38. Fischer-Le Saux M, Viallard V, Brunel B, Normand P, Boemare NE. Polyphasic classification of the genus Photorhabdus and proposal of new taxa: P. luminescens subsp. luminescens subsp. nov., P. luminescens subsp. akhurstii subsp. nov., P. luminescens subsp. laumondii subsp. nov., P. temperata sp. nov., P. temperata subsp. temperata subsp. nov. and P. asymbiotica sp. nov. Int J Syst Bacteriol. 1999;49 Pt 4:1645–56. pmid:10555346.
  39. 39. Simon R, Priefer U., and Pühler A. A broad hostrange mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria Bio/Technology 1983;1 784–91.
  40. 40. Kovach ME, Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., 2nd, and Peterson, K.M.. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes 1995
  41. 41. Miller WG, Leveau JH, Lindow SE. Improved gfp and inaZ broad-host-range promoter-probe vectors. Mol Plant Microbe Interact. 2000;13(11):1243–50. pmid:11059491.
  42. 42. Fellay R, Frey J, Krisch H. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria. Gene. 1987;52(2–3):147–54. pmid:3038679.
  43. 43. Brillard J, Duchaud E, Boemare N, Kunst F, Givaudan A. The PhlA hemolysin from the entomopathogenic bacterium Photorhabdus luminescens belongs to the two-partner secretion family of hemolysins. J Bacteriol. 2002;184(14):3871–8. pmid:12081958.
  44. 44. Ausubel FM, Brent R., Kingston R.E., Moore D.D., Seidman J.G. and Struhl K. Current Protocols in Molecular biology. New York: John Wiley and sons; 1993.
  45. 45. Duvic B, Jouan V, Essa N, Girard PA, Pages S, Abi Khattar Z, et al. Cecropins as a marker of Spodoptera frugiperda immunosuppression during entomopathogenic bacterial challenge. J Insect Physiol. 2012;58(6):881–8. Epub 2012/04/11. S0022-1910(12)00090-X [pii] pmid:22487443.
  46. 46. Andersen JB, Sternberg C, Poulsen LK, Bjorn SP, Givskov M, Molin S. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl Environ Microbiol. 1998;64(6):2240–6. Epub 1998/06/03. pmid:9603842.
  47. 47. Duchaud E, Rusniok C, Frangeul L, Buchrieser C, Givaudan A, Taourit S, et al. The genome sequence of the entomopathogenic bacterium Photorhabdus luminescens. Nat Biotechnol. 2003;21(11):1307–13. pmid:14528314.
  48. 48. Joshi T, Xu D. Quantitative assessment of relationship between sequence similarity and function similarity. BMC Genomics. 2007;8:222. pmid:17620139; PubMed Central PMCID: PMCPMC1949826.
  49. 49. Lomovskaya O, Warren MS, Lee A, Galazzo J, Fronko R, Lee M, et al. Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob Agents Chemother. 2001;45(1):105–16. pmid:11120952.
  50. 50. Pages JM, Masi M, Barbe J. Inhibitors of efflux pumps in Gram-negative bacteria. Trends Mol Med. 2005;11(8):382–9. Epub 2005/07/06. S1471-4914(05)00126-7 [pii] pmid:15996519.
  51. 51. Schumacher A, Steinke P, Bohnert JA, Akova M, Jonas D, Kern WV. Effect of 1-(1-naphthylmethyl)-piperazine, a novel putative efflux pump inhibitor, on antimicrobial drug susceptibility in clinical isolates of Enterobacteriaceae other than Escherichia coli. J Antimicrob Chemother. 2006;57(2):344–8. pmid:16354746.
  52. 52. Jubelin G, Pages S, Lanois A, Boyer MH, Gaudriault S, Ferdy JB, et al. Studies of the dynamic expression of the Xenorhabdus FliAZ regulon reveal atypical iron-dependent regulation of the flagellin and haemolysin genes during insect infection. Environ Microbiol. 2011;13(5):1271–84. Epub 2011/02/22. pmid:21332625.
  53. 53. Ma D, Cook DN, Alberti M, Pon NG, Nikaido H, Hearst JE. Genes acrA and acrB encode a stress-induced efflux system of Escherichia coli. Mol Microbiol. 1995;16(1):45–55. pmid:7651136.
  54. 54. Okusu H, Ma D, Nikaido H. AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants. J Bacteriol. 1996;178(1):306–8. pmid:8550435; PubMed Central PMCID: PMCPMC177656.
  55. 55. Wang L, Yang X, Jian H, Yang H, Huang D. [Metabolites produced by bacteria of Xenorhabdus and Photorhabdus]. Wei Sheng Wu Xue Bao. 2001;41(6):753–6. pmid:12552836.
  56. 56. Bode HB. Entomopathogenic bacteria as a source of secondary metabolites. Curr Opin Chem Biol. 2009;13(2):224–30. pmid:19345136.
  57. 57. Tobias NJ, Heinrich AK, Eresmann H, Wright PR, Neubacher N, Backofen R, et al. Photorhabdus-nematode symbiosis is dependent on hfq-mediated regulation of secondary metabolites. Environ Microbiol. 2017;19(1):119–29. pmid:27555343.
  58. 58. James F. White Jr. MST. Defensive Mutualism in Microbial Symbiosis. Boca Raton, Florida, USA: CRC Press, Taylor and Francis group; 2009.
  59. 59. Li J, Chen G, Wu H, Webster JM. Identification of two pigments and a hydroxystilbene antibiotic from Photorhabdus luminescens. Appl Environ Microbiol. 1995;61(12):4329–33. pmid:8534100; PubMed Central PMCID: PMCPMC167744.
  60. 60. Wollenberg AC, Jagdish T, Slough G, Hoinville ME, Wollenberg MS. Death Becomes Them: Bacterial Community Dynamics and Stilbene Antibiotic Production in Cadavers of Galleria mellonella Killed by Heterorhabditis and Photorhabdus spp. Appl Environ Microbiol. 2016;82(19):5824–37. pmid:27451445; PubMed Central PMCID: PMCPMC5038048.
  61. 61. Shi D, An R, Zhang W, Zhang G, Yu Z. Stilbene Derivatives from Photorhabdus temperata SN259 and Their Antifungal Activities against Phytopathogenic Fungi. J Agric Food Chem. 2017;65(1):60–5. pmid:27960253.
  62. 62. Enright MR, Griffin CT. Specificity of association between Paenibacillus spp. and the entomopathogenic nematodes, Heterorhabditis spp. Microb Ecol. 2004;48(3):414–23. pmid:15692861.
  63. 63. Enright MR, Griffin CT. Effects of Paenibacillus nematophilus on the entomopathogenic nematode Heterorhabditis megidis. J Invertebr Pathol. 2005;88(1):40–8. pmid:15707868.
  64. 64. Piddock LJ. Multidrug-resistance efflux pumps—not just for resistance. Nat Rev Microbiol. 2006;4(8):629–36. pmid:16845433.
  65. 65. Perez A, Poza M, Fernandez A, Fernandez Mdel C, Mallo S, Merino M, et al. Involvement of the AcrAB-TolC efflux pump in the resistance, fitness, and virulence of Enterobacter cloacae. Antimicrob Agents Chemother. 2012;56(4):2084–90. Epub 2012/02/01. AAC.05509-11 [pii] pmid:22290971.
  66. 66. Derzelle S, Turlin E, Duchaud E, Pages S, Kunst F, Givaudan A, et al. The PhoP-PhoQ two-component regulatory system of Photorhabdus luminescens is essential for virulence in insects. J Bacteriol. 2004;186(5):1270–9. pmid:14973084; PubMed Central PMCID: PMCPMC344422.
  67. 67. Bennett HP, Clarke DJ. The pbgPE operon in Photorhabdus luminescens is required for pathogenicity and symbiosis. J Bacteriol. 2005;187(1):77–84. pmid:15601690.
  68. 68. Mouammine A, Pages S, Lanois A, Gaudriault S, Jubelin G, Bonabaud M, et al. An antimicrobial peptide-resistant minor subpopulation of Photorhabdus luminescens is responsible for virulence. Sci Rep. 2017;7:43670. pmid:28252016; PubMed Central PMCID: PMCPMC5333078.
  69. 69. Ashhurst DE, Bailey AJ. Locust collagen: morphological and biochemical characterization. Eur J Biochem. 1980;103(1):75–83. Epub 1980/01/01. pmid:6766861.
  70. 70. Marokhazi J, Koczan G, Hudecz F, Graf L, Fodor A, Venekei I. Enzymic characterization with progress curve analysis of a collagen peptidase from an enthomopathogenic bacterium, Photorhabdus luminescens. Biochem J. 2004;379(Pt 3):633–40. Epub 2004/01/28. pmid:14744262; PubMed Central PMCID: PMC1224120.
  71. 71. Marokhazi J, Lengyel K, Pekar S, Felfoldi G, Patthy A, Graf L, et al. Comparison of proteolytic activities produced by entomopathogenic Photorhabdus bacteria: strain- and phase-dependent heterogeneity in composition and activity of four enzymes. Appl Environ Microbiol. 2004;70(12):7311–20. Epub 2004/12/03. 70/12/7311 [pii] pmid:15574931; PubMed Central PMCID: PMC535150.
  72. 72. Marokhazi J, Mihala N, Hudecz F, Fodor A, Graf L, Venekei I. Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate. FEBS J. 2007;274(8):1946–56. Epub 2007/03/16. EJB5739 [pii] pmid:17355285.
  73. 73. Daborn PJ, Waterfield N, Blight MA, Ffrench-Constant RH. Measuring virulence factor expression by the pathogenic bacterium Photorhabdus luminescens in culture and during insect infection. J Bacteriol. 2001;183(20):5834–9. pmid:11566980.
  74. 74. Cabral CM, Cherqui A, Pereira A, Simoes N. Purification and characterization of two distinct metalloproteases secreted by the entomopathogenic bacterium Photorhabdus sp. strain Az29. Appl Environ Microbiol. 2004;70(7):3831–8. pmid:15240252.
  75. 75. Wang S. Bacterial Two-Component Systems: Structures and Signaling Mechanisms Protein Phosphorylation in Human Health: IntechOpen; 2012.
  76. 76. Groisman EA. Feedback Control of Two-Component Regulatory Systems. Annu Rev Microbiol. 2016;70:103–24. pmid:27607549.
  77. 77. Hirakawa H, Nishino K, Hirata T, Yamaguchi A. Comprehensive studies of drug resistance mediated by overexpression of response regulators of two-component signal transduction systems in Escherichia coli. J Bacteriol. 2003;185(6):1851–6. pmid:12618449.
  78. 78. Kwun MJ, Hong HJ. The activity of glycopeptide antibiotics against resistant bacteria correlates with their ability to induce the resistance system. Antimicrob Agents Chemother. 2014;58(10):6306–10. pmid:25092694; PubMed Central PMCID: PMCPMC4187914.
  79. 79. Nishino K, Honda T, Yamaguchi A. Genome-wide analyses of Escherichia coli gene expression responsive to the BaeSR two-component regulatory system. J Bacteriol. 2005;187(5):1763–72. pmid:15716448.
  80. 80. Wang D FC. The BaeSR regulon is involved in defense against zinc toxicity in E. coli. Metallomics. 2013;(5)4:372–83. pmid:23446818
  81. 81. Kawabata T, Yasuhara Y, Ochiai M, Matsuura S, Ashida M. Molecular cloning of insect pro-phenol oxidase: a copper-containing protein homologous to arthropod hemocyanin. Proc Natl Acad Sci U S A. 1995;92(17):7774–8. pmid:7644494; PubMed Central PMCID: PMCPMC41228.
  82. 82. Schwartzman JA, Ruby EG. Stress as a Normal Cue in the Symbiotic Environment. Trends Microbiol. 2016;24(5):414–24. pmid:27004825; PubMed Central PMCID: PMCPMC4841697.