http://orcid.org/0000-0003-1298-8522
Correction
19 Nov 2019: Shenge JA, Odaibo GN, Olaleye DO (2019) Correction: Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria. PLOS ONE 14(11): e0225679. https://doi.org/10.1371/journal.pone.0225679 View correction
Figures
Abstract
Hepatitis C virus (HCV) infection has been associated with liver disease including liver cirrhosis and hepatocellular carcinoma (HCC) in chronically-infected persons. However, in HIV/HCV co-infected patients, increased rate of progression to cirrhosis and HCC has been reported. Limited information exists regarding genetic variants of HCV circulating among co-infected patients, which could be important in the design of broadly protective vaccine and management of the disease. Here, we determined the genotypes of HCV isolates circulating among HIV/HCV co-infected patients in Ibadan, southwestern Nigeria. One hundred and twenty-five HIV/HCV IgM positive samples obtained from HIV laboratory, University of Ibadan were used for this study. HCV NS5B gene was amplified using polymerase chain reaction (PCR). The amplified NS5B gene was sequenced using gene specific primers. Twenty isolates were amplified, out of which 13 were successfully sequenced. Phylogenetic analysis of the 13 sequenced isolates showed three HCV subtypes 1a, 3a and 5a belonging to genotypes 1, 3 and 5 respectively. Ten isolates (77%) belong to subtype 5a, followed by 2 isolates (15%) subtype 1a and 1 isolate (8%) was subtype 3a. The predominant HCV genotype was 5, followed by genotype 1 (subtype 1a). The findings, as well as the observed mutations in NS5B gene, indicate the need for screening and monitoring of HIV/HCV co-infected patients. Further study to determine the phylogeny of isolates circulating in other parts of Nigeria will be carried out.
Citation: Shenge JA, Odaibo GN, Olaleye DO (2019) Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria. PLoS ONE 14(2): e0210724. https://doi.org/10.1371/journal.pone.0210724
Editor: Jason Blackard, University of Cincinnati College of Medicine, UNITED STATES
Received: July 4, 2018; Accepted: December 31, 2018; Published: February 6, 2019
Copyright: © 2019 Shenge et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its supporting files. NS5B sequences available at Doi: 10.6084/m9.figshare.7471454.
Funding: This study was supported by Medical Education Partnership Initiative Nigeria (MEPIN) through National Institute of Health (NIH) USA grant funded by Fogarty International Centre, the office of AIDS Research and National Human Genome Research Institute of NIH, the Health Resources and Services Administration (HRSA) and the Office of the U.S. Global AIDS Coordinator under award number R24TW008878’ to JAS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Hepatitis C virus (HCV) still affects more than 185 million people worldwide despite availability of highly effective antiviral therapy such as direct acting antiviral agents (DAA) [1]. According to [2], an estimated 3–4 million people become infected every year, representing more than three percent of the world’s population that are chronically infected, with most of these cases occurring in Africa [2, 3]. It is also estimated that about 350, 000 people die from liver failure and liver cancer caused by hepatitis C disease each year. Furthermore, about 2.3 million people infected with HIV are actually co-infected with hepatitis C virus globally [4].
It has been reported that about one third of HIV-infected patients are also infected with HCV with an undesirable impact on HCV pathogenesis [5]. HIV destroys the immune system by depleting CD4-bearing T cells while HCV causes necrosis of the hepatocytes. Liver disease progression is known to be influenced by some viral and host factors, which include viral load, viral genotype, period of infection, gender, age, alcohol consumption as well as co-infection with hepatitis B virus (HBV) or Human Immunodeficiency Virus (HIV) [6].
Studies have also shown that about 75% of HCV related deaths occur among adults ages 45 to 65 [7] and mostly among individuals having co-infections with HIV, HBV and other liver complications such as cirrhosis and hepatocellular carcinoma [8, 9]. Chronic infection with HCV has been reported as one of the causes of chronic liver disease, the reason for most Orthotopic Liver Transplantation (OLT) in the USA [10]. In sub-Saharan Africa, HBV is the main cause of hepatocellular carcinoma (HCC), followed by HCV mostly as a result of chronic hepatitis with complications from liver cirrhosis [11], especially in HIV co-infected patients [12]. The rate of fibrosis has been estimated to be 3 or more times higher in HIV/HCV co-infected patients, than in patients that are infected with HCV alone [13]. HIV is also known to accelerate the progression of liver disease in HCV-infected persons because HCV replication increases in the presence of HIV resulting in elevated liver HCV RNA levels [14, 15]. Detrimental effect of HCV on HIV infection includes a significant reduction of CD4 cells and total CD4 percent [16]. Independent of HIV or HCV infection, depletion of CD4 cell enhances progression to cirrhosis [17].
HCV is a member of the Flaviviridae family and the only member of the genus Hepacivirus. The virus is a small enveloped, spherical particle with a positive sense, single-stranded RNA genome. The genome consists of a single, open reading frame (ORF) that is 9600 nucleotide bases long and 2 untranslated but highly conserved regions namely; 5'-UTR and 3'-UTR located at both ends of the genome [18]. The genome encodes a single polyprotein, starting with the core proteins (structural) and ending with the NS5B proteins (non-structural proteins, which code for RNA polymerase [19].
The NS5B gene codes for RNA-dependent RNA polymerase (RdRp). It is essential for viral maturation and plays an important role during replication of the virus. The gene represents an ideal target for the development of antiviral drugs. Typically, phylogenetic analysis of the non-structural protein (NS5B) coding region is able to differentiate both genotypes and subtypes of the virus [20]. Due to the fact that the virus evolves rapidly, lack of proofreading activity of the RNA-dependent RNA polymerase results in extreme sequence variability resulting from frequent nucleotide substitutions and this represents marked genetic heterogeneity in HCV [21]. Accumulation of these nucleotide substitutions during HCV replication has resulted in the emergence of seven major HCV genotypes (1–7), each further divided into subtypes based on their genetic diversity [22, 23]. Numerous subtypes of HCV have been identified [24].
HCV genotypes are distributed differently throughout the world [25]. Differences also exist in the global distribution of its subtypes [26, 27]. Divergent strains of genotypes 1 and 2, have been found to be endemic in West African countries including; Burkina Faso, Ghana, Guinea Bissau, Benin Republic and Nigeria. Genotype 3 is found in south Asia, genotype 4 in central Africa and Middle East while genotype 6 is distributed in south-east Asia [27]. Genotype 5 has been found to be common in the northern region of South Africa and Belgium while genotype 7 has been reported only among the central African immigrants in Canada [28].
Limited studies exist concerning HCV genotypes distribution among co-infected persons. However, it has been reported that response to interferon and ribavirin-based regimens among HIV/HCV co-infected patients, depends largely on HCV genotype. It was observed that sustained virologic response is achieved faster in only HCV-infected patients, than in HIV/HCV co-infected patients. Notably, HCV genotype 2 or 3 responds faster to interferon and ribavirin, than HCV genotype 1, making response to antivirals slower in co-infected patients, than in HCV mono-infected patients [29]. Hence, treating HIV may slow progression of HCV-induced fibrosis by improving immune function and modulatory effects of interferon-based HCV treatment and thus improve response to HCV treatment and disease prognosis [30].
In Nigeria, there have been limited studies on the genetic diversity of HCV among various sub-populations [31]. Most of the previous studies from the country were mainly serology-based [32, 33]. Reports have shown that HBV and HCV infection accounts for large number of chronic liver disease and hepatocellular carcinoma (HCC) in Nigeria [34, 35], hence, the need for molecular studies that will provide information on some of the HCV epidemic determinants, types and risk factors. Information on the genetic variants of HCV in Africa is very crucial for better understanding of its epidemiology, pathogenesis, evolutionary dynamics and design of broadly-protective vaccine against infection with the virus [36].
Materials and methods
Study population and sample collection
This study was cross-sectional, in which blood samples of 125 HCV/HIV–co-infected individuals (68 males and 57 females, age range 3 months to 83 years) referred from different clinics at the University College Hospital, Ibadan to the Department of Virology of the same hospital for diagnosis were used. The samples were tested for IgM antibodies to HIV and HCV by the laboratory using ELISA. Positive samples (HCV/HIV) stored at -80°C were then retrieved for this study after approval by the ethical committee. Ethical approval for the study was received from the University of Ibadan/University College Hospital Ethical Committee under the assigned number UI/EC/ 14/0019, before commencement of study. The need for consent from individual participants was waived by the ethics committee.
HCV RNA extraction and reverse transcription
RNA was extracted from aliquots of plasma sample, from which 5 ml blood was used according to manufacturer’s instructions of the commercially available extraction kit used (Jena Bioscience total RNA Purification kit, Germany). Reverse- transcription (first strand cDNA synthesis) of the extracted RNA was performed using random hexamer using Script cDNA synthesis kit (Jena Bioscience, Germany), in a final volume of 20 μl assay. The synthesis conditions were 42o C for 10min followed by incubation at 50°C for 45min.
Amplification of NS5B gene.
NS5B gene segment of the virus located at positions 8275–8616 was amplified using a nested PCR protocol with 5 μl of gene specific primers [26] and 2.5 μl of the RT-PCR product as the template. Amplified fragments were visualised using gel electrophoresis in 1.5% agarose gel concentration. Sequence of primers and the cycling conditions for the nested PCR are as follows: In the first round of PCR the primers used were NS5B-k1 for Forward: 5`TGGGGATCCCGTATGATACCCGCTGCTTTGA and NS5B-k2 reverse reaction: 5`GGCGGAATTCCTGGTCATAGCCTCCGTGAA. The cycling condition is 95°C for 5min, 94°C for 30sec, 50°C for 30sec, 72°C for 45sec,72o C for 10min, for 30cycles. The expected size of amplification product for the first round PCR was 400bp. Five microlitre of the first round PCR product was used as the template for the second round PCR. The nested PCR was performed in a 25μl reaction mixture with 2.5 microlitres with forward primer- NS5B-122: CTCAACCGTCACTGAGAGAGACAT and reverse primers NS5B-R1- GCTCTCAGGCTCGCCGCGTCCTC. The thermal cycling condition was same as the first round reaction but for 45 cycles instead. The PCR product with the expected band size of 301bp was detected by electrophoresis in 1.5% agarose gel and visualized using Bio-Rad Gel Doc XR+ System.
DNA sequencing.
The PCR products were purified with ExoSAP Amplicon Purification kit (Applied Biosystems, Foster city, CA,) according to manufacturer’s instructions and sequenced with ABI V3.1 Big dye terminator (Applied Biosystems, Foster city, CA). The second- round PCR products and the same inner primers used for the nested PCR were used for sequencing. Sequencing reactions were commercially carried out by INQABA BIOTEC, South Africa. Nucleotide sequences of the partial HCV NS5B gene obtained among HIV patients co-infected with HCV are available at the repository Doi: 10.6084/m9.figshare.7471454.
Editing of sequences.
The electropherogram of each sequence was studied and edited using CLC Main Workbench 7.6.2 software (CLC Bio, Cambridge, MA, USA). Each consensus sequence generated was blasted in NCBI nucleotide blast to determine HCV reference sequences with closest matching identity or relatedness to study sequences.
Phylogenetic analysis.
All sequences together with HCV reference prototype sequence H77 and GenBank sequences from different continents including Africa, North America, Europe and Australia, spanning 300-310nt of the NS5B gene {HCV H77 position, 8275–8616 (GenBank, NC.004102.1)} obtained from HCV sequence Database [27], were aligned using Clustal W 1.6 method in MEGA 7.0 version software [37]. The evolutionary history was inferred using the Neighbor-Joining method [38].
Viral diversity and the ancestral relationships among sequences and the reference sequences were determined by Neighbor-Joining phylogeny with Maximum Composite Likelihood model [38, 39]. Test of phylogeny, that is, the percentage replicate trees in which the associated taxa clustered together was performed with bootstrap replicates of 1,000 and branch support values of >60%.
Amino acid sequences were translated with the standard genetic code on MEGA7.0 [40]. Amino acid substitutions generated in this study were aligned with prototype H77 strain (GenBank accession number NC.004102.1).
Results
HCV NS5B gene of 20 isolates were amplified while 13 (65%) of the 20 were successfully sequenced. The sequences have percentage identity of 97%- 100% with reference sequences obtained from GenBank HCV databases. Phylogenetic analysis of the 13 isolates showed three HCV genotypes 1, 3 and 5 (subtypes 1a, 3a and 5a). Ten isolates (77%) were subtype 5a, followed by 2 isolates (15%) subtype 1a and 1 (8%) was subtype 3a. Fig 1 shows the phylogenetic tree of the NS5B gene sequences of the isolates, while Fig 2 shows the amino acid translation indicating conserved and variable sites in the NS5B region. Amino acid substitutions in NS5B gene was compared with the prototype strain H77. Major mutations observed among the genotype 1 isolates (1a) were at positions 61 (G61K) and 89 (G89E). At the other positions, all the amino acids were conserved. In the lone genotype 3, there were substitutions in the following positions: 15 (S15G), 7(T7V), 54 (S54C), 71 (T71S) 89 (G89L) and 80 (T80I). Major mutations among the genotype 5 (5a subtype) isolates were at amino acid positions 89 (G89R) and 84 (S84C).
Tree was constructed using Neighbor-Joining method with Maximum Composite Likelihood model. Study sequences are marked with solid blocks showing genotypes 5a, 1a and 3a locations on the tree.
Two genotype 5 isolates (p9 and p15) generated two variants each. These variants when compared differ by six codons (4 in p9 and 2 in p15), in their nucleotide sequences, representing six different amino acid translations (substitutions) at positions 2, 7, 22, 23, 54 and 81 altogether. At amino acid position 7, P9a had amino acid Thymine (T) while 9b had Serine (S). At position 22, P9a had T while P9b was deleted. At position 23, P9a had amino acid Lysine (L) while P9b had Valine (V). Lastly, at position 81, P9a variant had amino acid Serine while P9b variant had Lysine as its amino acid translation. P15 isolates when compared only had a few substitutions at positions 2 and 54.
Discussion
This study has shown HCV genotype 5, (subtype 5a), as the predominant HCV strain circulating among HIV/HCV co-infected patients in the study area in Nigeria, with the other genotypes being 1 and 3. Previous studies also showed genotype 5 among HCV- infected blood donors and patients with clinical symptoms [41]. Genotype 5 has not been reported among co-infected patients before now. However, multiple genotypes including 1, 2 and 4 have been previously reported among the general population in Nigeria [42, 43], in addition to numerous reported sero-prevalence studies [44]. These reports show that even within regions in Nigeria, HCV genotypes are differentially distributed and this has serious implication for HCV vaccine development and management of infection in the country. The predominance of genotype 5 among HCV infected individuals co-infected with HIV, may represent a trend of infection with the genotype. However, a larger study may be needed in the population, to provide further information on HCV types and pathogenesis among HIV co-infected population. HCV genotype 5 is not distributed globally [45] and as such, it has not been widely studied in infected persons, making its predominance among this population an interesting information and concern with regards to treatment and management.
Genotype 1 is globally distributed and it accounts for most HCV infections in several parts of the world [46, 47]. In the present study, only 2 subtype 1a isolates (15%) were found among HIV/HCV co-infected patients, contrary to previous studies among blood donors and patients with clinical hepatitis where 8(80%) and 2(20%) of the isolates were subtypes 1a respectively; and 5(100%) were subtype 1b[41]. In Nigeria, limited information exists on HCV types among co-infected patients. There is therefore, the need to carry out further molecular studies to generate additional data that would translate into meaningful policies for the management and survival of HIV/HCV co-infected patients in Nigeria and other parts of the world.
These isolates are distinct considering the significant variation observed at the nucleotide and amino acid levels with bootstrap value of 1000 replicates. Genotype 5 isolates from the study clustered closely with those from South Africa, while genotype 1 clustered with those from Canada and Argentina. The lone genotype 3 isolate clustered with a mutant strain from Sri-Lanka with 97% identity.
Despite availability of direct acting antiviral (DAA) agents, HCV remains a health challenge in developed and developing countries, but worse in the latter, where the supply of these antiviral agents is very limited or not yet approved. It is not clear whether genotype 5a found among HIV /HCV co-infected patients in this study affect the pathogenesis and severity of HIV disease than the other HCV genotypes, as this is beyond the scope of this study. Prior to this study, very little was known about the extent of HCV/HIV co-infection and prevalent genotypes in the study area.
The finding reported in this paper is vital for future policies on vaccine development and antiviral therapy suitable for HCV genotypes in West African region, especially with regards to HCV/HIV co-infection, which facilitates progression to cirrhosis and HCC, and obviously a major public health challenge [48, 49]. Findings from this study update information on HCV diversity among co-infected population. Previously genotypes 1 and 2 were reported some fourteen years ago in Northern Nigeria [50], which is consistent with previous findings in the general population in Africa; but differs from the present study in southwest Nigeria, where genotype 5 and 3 are being reported in addition to the genotypes earlier reported in Nigeria among co-infected individuals. This study, therefore, advances knowledge on the geographical distribution and epidemiology of HCV genotypes and subtypes around the world, a trend with consequent implications for therapy and vaccine design. HCV genotype 5 is quite uncommon in most parts of the world. Its spread might have been facilitated by globalization that continues to impact the epidemiology of HCV globally.
Presently, there is no vaccine for prophylaxis against hepatitis C infection. Hence, additional studies are required to further understand the molecular epidemiology of and immunological factors in infected individuals that elicit interactions between these diverse strains of HCV and their hosts, especially with regards to disease progression in mono-infected and co-infected patients, as well as to determine drug -resistant markers in the diverse HCV strains that may halt or delay response to available antiviral cocktails in Nigeria.
Conclusion
In conclusion, three HCV genotypes 1, 3 and 5 were found circulating among HIV/HCV co-infected persons in Ibadan, Nigeria, with the predominant strain as genotype 5 S1 Fig. Mutations observed at the NS5B gene of HCV isolates have implications for therapy and monitoring of drug resistance, especially in regions, where the use of DAAs is limited, due to costs of procurement of the drugs. The high prevalence of genotype 5 among HCV patients co-infected with HIV has implication for diagnosis and treatment of this population in Nigeria.
Supporting information
S1 Fig. Distribution of HCV subtypes in HIV/HCV co-infected population.
The vertical axis of the graph represents percentage, while the horizontal axis represents HCV subtypes (1a, 3a and 5a found in the study).
https://doi.org/10.1371/journal.pone.0210724.s001
(DOCX)
Acknowledgments
We sincerely appreciate HIV laboratory of the Department of Virology, College of Medicine, University of Ibadan, for making the samples available for this study.
References
- 1. Mora N, Adams WH, Kleithermes S, Dugas L, Balagubramanian N, Sandhu J et al. A Synthesis of Hepatitis C prevalence estimate in Sub-Saharan Africa: 2000–2013, BMC Infect Dis: 2016 June 13, 160; 283
- 2. Ashfaq UA, Javed T, Rehman S, Nawaz Z, Riazuddin S. An overview of HCV molecular biology, replication and immune responses. Virology Journal 2011, 8; 161 pmid:21477382
- 3. Kapoor A, Simmonds P, Gerold G, Qaisar N, Jain K, Henriquez JA et al. Characterization of a canine homolog of hepatitis C virus. Proc Natl Acad Sci USA. 2011, 12;108 (28): 11608–13. epub 2011 May 24 pmid:21610165
- 4. Simmonds P. Genetic diversity and evolution of hepatitis C virus-15 years on. Journal of General Virology, 2004; 85, 3173–3188. http://vir.sgmjournals.org. pmid:15483230
- 5. Hernandez MD and Sherman KE. HIV/HCV Coinfection Natural History and Disease Progression: A Review of the Most Recent Literature. Curr Opin HIV/AIDS. 2011 November; 6(6): 478–482. pmid:22001892
- 6. Codes L,. de Freitas LAR, Santos- Jesus R, Vitvitski L, Silva LK, Trepo C et al. Comparative Study of Hepatitis C Virus. Brazilian Journal of Infectious Diseases 2003; 7
- 7.
Mukherjee S. Hepatitis C. Medscape. August, 2012. www.emedicine.medscape.com
- 8.
Dhawan VK. Hepatitis C. Medscape, Updated July 2016; p1-48 www.emedicine.medscape.com.
- 9. Ly KN, Xing J, Klevens RM, Jiles RB, Ward JW, Holmberg SD. The increasing burden of mortality from viral hepatitis in the United States between 1999 and 2007. Ann Intern Med. 2012 Feb 21.156(4): 271–8. pmid:22351712
- 10. Davis GL, Balart LA, Schiff ER, Lindsay K, Bodenheimer HC Jr, Perrillo RP et al. Treatment of chronic hepatitis c with recombinant interferon alfa. A multicenter randomized, controlled trial. Hepatitis Intervention Therapy Group. N Engl J Med. 1989 Nov. 321(22)151–6.
- 11.
World Health Organization. Viral Hepatitis Factsheet 2012.www.who.int
- 12. Thomson EC, Nastouli E, Main J, Karayiannis P, Eliahoo J, Muir D et al. Delayed anti-HCV response in HIV-positive men acutely infected with HCV. AIDS 2009 Jan 2; 23(4): 89–93.
- 13. Graham CS, Baden LR, Yu E, Mrus JM, Carnie J, Heeren T et al. Influence of Human Immunodeficiency Virus Infection on the course of hepatitis C virus infection: a meta-analysis. Clin Infect Dis. 2001 Aug 15; 33(4): 562–569. pmid:11462196
- 14. Otegbayo JA, Taiwo BO, Akingbola TS, Odaibo GN, Adedapo KS, Penugonda S et al. Prevalence of hepatitis B and C Seropositivity in Nigerian Cohort of HIV-infected Patients. Annals of Hepatology 2008; 7(2): April–June: 152–156. pmid:18626434
- 15. Kazmierczak J, Pawelczyk A, Cortes KC, Radkowski M. Seronegative Hepatitis C Virus Infection. Arch.Immunol. Ther.Exp. 2013; pmid:24202543
- 16. Sajadi MM, Shakeri N, Redfield RR. Hepatitis C infection in HIV-1 natural viral suppressors. AIDS. 2010; 24: 1689–1695. pmid:20467290
- 17. Rohrbach J, Robinson N, Harcourt G, Hammond E, Gaudieri S, Gorgievski M et al. Cellular Immune responses to HCV core increase and HCV RNA levels decrease during successful antiretroviral therapy. GUT 2010; 59: 1252–1258 pmid:20660698
- 18. Kato N. Genome of Human hepatitis virus (HCV): gene organization, sequence diversity, and variation. Microb. Comp. Genomics 2000; 5 (3): 129–51. pmid:11252351
- 19. Lindenbach BD, Rice CM. Unravelling hepatitis C Virus replication from genome to function. Nature 2005; 436: 933–938. pmid:16107832
- 20. Gededzha MP, Selabe SG, Kyaw T, Rakgole JN, Blackard JT, Mphahlele MJ. Introduction of new subtypes and variants of hepatitis C virus genotype 4 in South Africa. J Med Virol. 2012 Apr; 84 (4):601–7. pmid:22337299
- 21. Penin F, Dubuisson J, Rey FA, Moradpour D, Pawlotsky JM: Structural biology of hepatitis C virus. Hepatology 2004; 39(1):5–19. pmid:14752815
- 22. Simmonds P, Bukh J, Combet C, Deleage G, Enomoto N, Feinstone S et al. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 2005; 42:962–973. pmid:16149085
- 23. Ohno O, Mizokami M, Wu RR, Saleh MG, Ohba K, Orito E et al. New hepatitis C virus (HCV) genotyping system that allows for identification of HCV genotypes Ia, 1b, 2a, 2b,3a, 3b 4,5 and 6a. J Clin Microbiol, 2007; 35 (1): 201–207.
- 24. Messina JP, Humphreys I, Flaxman A, Brown A, Cooke GS, Pybus OG et al. Global distribution and prevalence of hepatitis C virus genotypes. Hepatology 2015 Jan; 61 (1): 77–87. Epub July 28, 2014. pmid:25069599
- 25. Ramia S and Eid-Fares J. Distribution of hepatitis C virus genotypes in the Middle East.Int J Infect Dis 2006, 10(4):272–277. pmid:16564719
- 26. Forbi JC, Purdi MA, Campo DS, Vaughan G, Dimitrova GE, Ganova-Raeva LM et al. Epidemic history of hepatitis C virus infection in two remote communities in Nigeria, West Africa. J Gen Virol. 2012 Jul; 93 (Pt 7):1410–21. pmid:22456613
- 27. Markov PV, Pepin J, Frost E, Deslandes S, Labbe A, Pybus OG. Phylogeography and Molecular Epidemiology of Hepatitis C Virus genotype 2 in Africa. Journal of General Virology 2009; 90, 2086–2096. pmid:19474244
- 28. Murphy DG, Sablon E, Chamberland J, Fournier E, Dandavino R, Tremblay CL. Hepatitis C virus genotype 7, a new genotype originating from Central Africa. J Clin Microbiol 2015; 53 (3): 967–972 pmid:25520447
- 29. Ghany MG, Strader DB, Thomas DL,Seef LB; American Association for the Study of Liver Diseases. Diagnosis, management and treatment of hepatitis c: an update. Hepatology. 2009 Apr; 49 (4): 1335–1374 pmid:19330875
- 30.
Rodriguez-Torres M, Slim J, Bhatti L, Sterlin RK, Hassanien T, Clotet B et al. Standard versus high dose ribavirin in combination with Peg-interferon alfa-2a (40KD) in genotype 1(G1) HCV patients co-infected with HIV: final results of the PARADIGM study In: Program and abstract of 60th Annual meeting of the American Association for the Study of Liver Diseases; October 30-November 3, 2009, Boston, Abstract 1561.
- 31. Balogun TM, Emmanuel S, Wright KO. Hepatitis C virus co-infection in HIV positive patients. Nig QJ Hosp Med 20, 117–120.
- 32. Nwankiti OO, Ndako JA, Echeonu GO, Olabode AO, Nwosuh CI, Onovoh EM et al. Hepatitis C virus infection in apparently healthy individuals with family history of diabetes in Vom, Plateau state Nigeria. Virol J 2009; 6, 110. pmid:19619316
- 33. Adewole OO, Anteyi E, Ajuwon Z, Wada I, Elegba F, Ahmed P et al. Hepatitis B and C co-infection in Nigerian patients with HIV infection. J Infect Dev Ctries 2009; 3, 369–375. pmid:19759507
- 34. Mustapha SK, Bolori MT, Ajayi NA, Nggada HA, Pindiga UH, Gashau W et al. Hepatitis C virus antibodies in Nigerians with hepatocellular carcinoma. The Internet Journal of Oncology 2007; (4): 2.
- 35. Laraba A, Wadzali G, Sunday B, Abdulfatai O, Fatai S. Hepatitis C virus infections in Nigerians with chronic liver disease. The Internet Journal of Gastroenterology 2010
- 36. Le Guillou-Guillemette H, Vallet S, Gaudy-Graffin C, Payan C, Pivert A, Goudeau A et al. Genetic diversity of the hepatitis C virus: Impact and issues in the antiviral therapy. World J Gastroenterol 2007; 13(17): 2416–2426. http://www.jgnet.com/1007-9327/13/2416.asp pmid:17552024
- 37. Kumar S, Stecher G, Tamura . MEGA 7: Molecular Evolutionary Genetic Analysis version 7.0(MEGA 7). Molecular Biology and Evolution 2015, version 7.0
- 38. Saitou N, Nei M. The Neighbor-Joining Method-a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4: 406–425. pmid:3447015
- 39. Tamura K and Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpazees. Molecular Biology and Evolution 1993; 10: 512–526. pmid:8336541
- 40. Tamura K., Nei M., and Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences (USA) 2004; 101:11030–11035.
- 41. Shenge J.A, Odaibo G.N, Olaleye D.O. Genetic Diversity of Hepatitis C Virus among Blood Donors and Patients with Clinical Hepatitis in Ibadan Nigeria. Arch.Bas.App.Med, 2018 Feb; 6 (1): 79–85.
- 42. Okwuraiwe A.P., Salu O.B., Anomneze E. Audu R.A., Ujah I.A.O. Hepatitis C virus genotypes and viral ribonucleic acid titers in Nigeria. Nigerian Journal of Gastroenterology and Hepatology, vol 4 No. 2, 2012.
- 43. Oni AO and Harrison TJ. Genotype of hepatitis C Virus in Nigeria. J Med Virol 1996; 49: 178–186. pmid:8818962
- 44. Rao IB, Johari N, du cros P, Messina J, Ford N, Cooke GS. Hepatitis C Seroprevalence &HIV Co-infection in Sub-Saharan Africa: a systematic review and meta-analysis. Lancet Infect Dis. 2015Jul: 15 (7): 8: 819–824 pmid:25957078
- 45. Naamani KAI, Sinani SAI, Deschenes M. Epidemiology and Treatment of Hepatitis C genotypes 5 and 6. Can J Gastroenterol 2013; Vol 27 No 1 January, 2013.
- 46. Sarrazin C, Hezode C, Zeuzem S, Pawlotsky JM. Antiviral strategies in hepatitis C virus infection. J Hepatol, 2012; 56(Suppl 1):S88–S100.
- 47. Simmonds P. The origin and evolution of hepatitis viruses in humans. 2000 Fleming Lecture. Journal of General Virology (2001), 82: 693–712 pmid:11257174
- 48.
World Health Organization. More than 2 million people co-infected with HIV and hepatitis C. www.who.int. 2016
- 49. Platt L, Easterbrook P, Gower E, McDonald B, Sabin K, McGowan C et al. Prevalence and burden of HCV co-infection in people living with HIV: a global systematic review and meta-analysis. The Lancet, 2016; volume 16, No. 7, p797–808.
- 50. Agwale SM, Tanimoto L, Womack C, Odama L, Leung K, Duey Det al. Prevalence of HCV co-infection in HIV-infected individuals in Nigeria and Characterization of HCV genotypes. J Clin Virol 2004 Dec; 31 suppl 1: S3–6.