Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Pseudomonas coronafaciens sp. nov., a new phytobacterial species diverse from Pseudomonas syringae

  • Bhabesh Dutta ,

    Roles Data curation, Formal analysis, Investigation, Methodology, Supervision, Validation, Writing – original draft, Writing – review & editing

    bhabesh@uga.edu

    Affiliation Department of Plant Pathology, Coastal Plain Experiment Station, University of Georgia, Tifton, GA, United States of America

  • Ronald Gitaitis,

    Roles Conceptualization, Formal analysis, Writing – review & editing

    Affiliation Department of Plant Pathology, Coastal Plain Experiment Station, University of Georgia, Tifton, GA, United States of America

  • Gaurav Agarwal,

    Roles Software, Writing – review & editing

    Affiliation Department of Plant Pathology, Coastal Plain Experiment Station, University of Georgia, Tifton, GA, United States of America

  • Teresa Coutinho,

    Roles Methodology, Writing – review & editing

    Affiliation Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria, South Africa

  • David Langston

    Roles Funding acquisition, Project administration

    Affiliation Department of Plant Pathology, Physiology and Weed Science, Tidewater Agricultural Research and Extension Center, Virginia Tech, Suffolk, VA, United States of America

Abstract

We propose Pseudomonas coronafaciens sp. nov. as a new species in genus Pseudomonas, which is diverse from P. syringae. We also classified strains from onions which are responsible for yellow bud (YB) disease as P. coronafaciens. Sequencing of 16S rRNA gene and multi-locus sequence analysis (MLSA) of housekeeping genes (gyrB, rpoD, gltA and gap1 genes) for the P. syringae pv. coronafaciens strains along with other strains of P. syringae pathovars resulted in a distinct cluster separate from other P. syringae pathovars. Based on DNA-DNA relatedness, pathotype strain of P. syringae pv. coronafaciens (CFBP 2216PT) exhibited ≤35.5% similarity with the pathotype strains of P. syringae pv. syringae (CFBP 1392PT, 4702T) but exhibited ≥90.6% with the YB strains (YB 12–1, YB 12–4, YB 09–1). Also, the YB strains (YB 12–1, YB 12–4, YB 09–1) were able to infect only onion but not oat, rye and Italian ryegrass (common hosts for P. syrinage pv. coronafaciens). Contrastingly, P. syringae pv. coronafaciens strains (NCPPB 600PT, ATCC 19608, Pcf 83–300) produced typical halo blight symptoms on oat, rye and Italian rye grass but did not produce any symptoms on onion. These results provide evidence that P. syringae pv. coronafaciens should be elevated to a species level and the new YB strains may potentially be a novel pathovar of hereto proposed P. coronafaciens species.

Introduction

The taxonomy of Pseudomonas syringae sensu lato and its pathovars has evolved and been a matter of debate for last 34 years [1]. In the 8th edition of Bergey’s Manual of Determinative Bacteriology, P. syringae was widely accepted as a species and was comprised of fluorescent phytopathogenic Pseudomonas nomenspecies [2,3]. Furthermore, a revised taxonomic classification placing 41 nomenspecies of P. syringae as pathovars, was proposed in the 1st edition of Bergey’s Manual of Systematic Bacteriology [4]. This proposal was supported by the International Society for Plant Pathology, subcommittee on taxonomy of plant pathogenic bacteria [5]. The descriptions of most P. syringae pathovars were based on limited cross-pathogenicity tests on different hosts. As a result, overlap in host-range among different P. syringae pathovars often occur. Moreover, routine biochemical tests do not differentiate many of the P. syringae pathovars creating problems in correct identification of pathogens [6,7]. Gardan et al. (1999) [8] identified nine ‘genomospecies’ of the P. syringae complex in a comprehensive DNA-DNA re-association study. Among different genomospecies, genomospecies 4 (also called phylogroup 4) included pathovars of graminaceous species [P. syringae pv. coronafaciens (Elliott) Young et al., P. syringae pv. atropurpurea, P. syringae pv. striafaciens, P. syringae pv. oryzae, and P. syringae pv. zizaniae,], P. syringae pv. garcea [coffee (Coffea arabica; Rubiaceae)], and P. syringae pv. porri [leek (Allium ampeloprasum; Liliaceae)]. However, genomospecies classifications of P. syrinage pathovars were not supported by their ribotyping or substrate utilization studies. Detailed polyphasic study using genetic approaches were not conducted. Hence, Gardan et al. (1999) [8] refrained from making a formal proposal to elevate P. coronafaciens to species level and it remained as a pathovar of P. syringae (P. syringae pv. coronafaciens). Prior to study by Gardan et al. [8], Schaad and Cunfer (1979) [9] tried to differentiate P. syringae pv. coronafaciens, P. syringae pv. zea, P. syringae pv. atropurpurea and P. syringae pv. striafaciens; however, they later concluded that these bacterial species/pathovars are synonymous. These strains did not differ in their physiological, immunological and substrate utilization tests. In addition, little to no differences in their host range was reported as these strains were able to infect oat (Avena sativa), rye (Secale cerale), wheat (Triticum aestivum), barley (Hordeum vulgare), smooth bromegrass (Bromus inermis), Japanese brome (B. japonicas), chess brome (B. secalinus), cheatgrass (B. tectorum), quackgrass (Agropyron repens), maize (Zea mays).

In this paper, we propose the elevation of P. syringae pv. coronafaciens to a species level as P. coronafaciens, which was confirmed by various molecular and biochemical methods including sequencing of the 16S rRNA gene, and multi-locus sequence analysis (MLSA) based on sequences of housekeeping genes gyrB, rpoD, gltA, and gap1, substrate utilization tests (BIOLOG), polymerase chain reaction (PCR) analysis using plasmid (pCOR1), coronafactate ligase (cfl) and HrpZ effectors genes-specific primers, and DNA-DNA-hybridization. We also characterized strains from onion which are responsible for yellow bud (YB) disease [10] and concluded that they may potentially be a novel pathovar of hereto proposed P. coronafaciens species.

Materials and methods

Bacterial strains used in this study

Bacterial strains used in this study included P. syringae pv. coronafaciens NCPPB 600PT = CFBP 2216 PT (pathotype strain) and ATCC 19608, P. syringae pv. syringae NCPPB 281 PT = CFBP 4702 PT (pathotype strain) and NCPPB 1770, and P. syringae pv. aptata NCPPB 3539, P. coronafaciens pv. garcea NCPPB 588 PT (pathotype strain), P. coronafaciens pv. oryzae NCPPB 3683 PT (pathotype strain), P. coronafaciens pv. porri NCPPB 3364 PT (pathotype strain), P. coronafaciens pv. striafaciens NCPPB 1898 PT (pathotype strain), P. cannabina NCPPB 1437, and P. savastanoi NCPPB 639 PT (pathotype strain). The strains were recovered following instructions given by the NCPPB and ATCC culture collections. Other bacterial strains used in this study are listed in Table 1. The YB strains from onion were maintained on nutrient agar (NA) supplemented with 0.5% yeast extract (NA+).

thumbnail
Table 1. List of bacterial strains used in this study.

https://doi.org/10.1371/journal.pone.0208271.t001

Phylogenetic analysis based on 16S rRNA, gap1, gyrB, gltA and rpoD gene sequences

Total microbial genomic DNA from bacterial strains was extracted using an UltraClean Microbial DNA Kit (MO BIO, Carlsbad, CA) according to the manufacturer’s instructions. Two microliters of bacterial DNA (1 ng/ μl) were amplified in 25 μl of a PCR master mix using the 16S rRNA primer pair (fD1 AGAGTTTGATCCTGGCTCAG and rD1 AAGGAGGTGATCCAGCC) as described by Weisburg et al. (1991) [11]. For sequencing, the PCR amplicon from these bacterial strains were purified using an affinity column (Wizard PCR Preps DNA Purification System, Promega) and sequenced (Eurofins Genomics, Huntsville, AL, USA). ClustalW [12] was used for sequence alignment and overhangs were trimmed. PAUP*4.0b.10 [13] was used for phylogenetic analyses. Phylogenetic trees were created using parsimony analysis. Bootstrap analysis (10,000 replications) was performed for the parsimony tree using stepwise addition with the tree-bisection reconnection (TBR) branch-swapping option. As an outgroup, P. putida was included in the analysis.

Purified DNA from four YB strains (12–1, 09–1, 12–4, 12–5) along with pathotype strains of P. syringae pv. syringae, P. syringae pv. coronafaciens, P. syringae pv. garcea, P. syringae pv. oryzae, P. syringae pv. striafaciens, and P. syringae pv. porri (NCPPB 3539) were extracted using an UltraClean Microbial DNA Kit (MO BIO, Carlsbad, CA) according to the manufacturer’s instructions. DNA extraction from additional P. syringae pathovars (P. syringae pv. tomato, P. syringae pv. maculicola, P. syringae pv. lachrymans, P. syringae pv. glycinea, P. syringae pv. morsprunorum, and P. syringae pv. phaseolicola) strains was also conducted. Four housekeeping genes (gap1, gltA, gyrB, and rpoD) were amplified for each bacterial strain stated above with primers described by Hwang et al. (2005) [14] and PCR products were sequenced as described by Yan et al. (2008) [15]. Sequence analysis and tree construction were performed on concatenated sequences as described above.

PCR assay for the detection of plasmid pCOR1 and coronafactate ligase gene

The detection of pCOR1 plasmid in YB strains were conducted as per the conventional PCR protocol described by Takahashi et al. (1996) [16] using primer pairs P1(5’ GGGCTGCAGGAGAGTCCCAATGGA-3’) and P2 (5’-TTCCTGCAGAGCTATGGCCACTTG-3’). Four YB strains (12–1, 09–1, 12–4, 12–5) along with a pathotype strain (NCPPB 600PT) and a strain (ATCC 19608) of P. coronafaciens, a pathotype strain (NCPPB 281 PT) and a strain (NCPPB 1770) of P. syringae pv. syringae and one strain each of P. syringae pv. phaseolicola, P. syringae pv. glycinea, P. syringae pv. lachrymans, P. syringae pv. maculicola, P. syringae pv. tomato, P. syringae pv. syringae, and P. syringae pv. aptata were used in this assay. The gene, coronafactate ligase encodes the coupling of coronafacic acid and coronamic acid in a coronatine (phyotoxin) biosynthetic pathway [1]. For coronafactate ligase PCR, microbial DNA were amplified using a primer pair, CFL F 5’-GGCGCTCCCTCGCACTT-3’ and CFL R 5’-GGTATTGGCGGGGGTGC-3’ following conditions described by Bereswill et al. (1991) [17]. The PCR detection assay for the cfl gene was conducted with the strains described above.

The gene, hrpZ based PCR assay

The hrpZ based PCR assays with group I-IV specific primers were conducted for the YB strains (12–1, 09–1, 12–4, 12–5) as described previously by Inoue and Takikawa (2006) [18]. Known strains of P. syringae pv. phaseolicola, P. syringae pv. lachrymans, P. syringae pv. tomato, P. syringae pv. syringae, and P. syringae pv. coronafaciens (NCPPB 600 PT and ATCC 19608) were used as positive controls for hrpZ group Ia, Ib, II, III, and IV-based PCR assays, respectively.

PCR assay for the detection of effector genes (avrPto, avrD1, avrAE1, hopA1, hopB1, hopC1, hopD1, hopF2, hopG1, hrpK1, hopAF1, and hopAN1)

The presence of 12 effector genes (avrPto, avrD1, avrAE1, hopA1, hopB1, hopC1, hopD1, hopF2, hopG1, hrpK1, hopAF1, and hopAN1) were assayed by PCR amplification using specific primers under conditions described by Ferrante and Scortichini [19]. Two YB strains (12–1, 09–1 and 12–4) and the strains of P. syringae pv. syringae (NCPPB 281 PT and NCPPB 1770) and P. syringae pv. coronafaciens (NCPPB 600 PT and ATCC 19608) were used.

DNA-DNA hybridization and determination of DNA G+C content

High-quality DNA for DNA–DNA hybridization was prepared by the method of Wilson (1987), with minor modifications [20,21]. DNA–DNA hybridization was performed using the microplate method with some modifications [20, 21]. The hybridization temperature was 45±1°C. The strains were labeled with 4-methylumbelliferyl-beta-D-galactoside and the fluorescence intensity was measured. Reciprocal reactions were performed for select hybridization pairs and variation within the limits of this method [22]. The DNA G+C contents for the pathotype strain of P. syringae pv. coronafaciens (NCPPB 600 PT) and an onion strain (YB 12–1) was measured by HPLC [23,24].

Phenotypic characteristics

Physiological and biochemical tests were performed on the pathotype strain of P. syringae pv. coronafaciens strains (NCPPB 600PT) along with onion strains (12–1, 09–1, 12–4, 12–5), rye strain (P. syringae pv. coronafaciens 83–300), and oat strain (P. syringae pv. coronafaciens 93–2). Results were compared with P. syringae pv. syringae strains (NCPPB 1770, P. syringae pv. syringae 87–300, P. syringae pv. syringae 88–306). The phenotypic characteristics of additional P. syringae pathovar strains (P. syringae pv. aptata, P. syringae pv. glycinea, P. syringae pv. lachrymans, P. syringae pv. maculicola, P. syringae pv. morsprunorum, P. syringae pv. phaseolicola, and P. syringae pv. tomato) were adopted from the literature [25] for comparison. BIOLOG GN2 plates were used to test substrate utilization patterns for the strains characterized. Additional tests included utilization of trigonelline, mannitol, erythritol, sorbitol, inositol, D-tartarate, L-lactate, ability to reduce nitrate to nitrite, ability to form pits on crystal violet pectate (pectinolytic) and carboxymethy cellulose media (cellulolytic), ability to hydrolyze starch, esculin and gelatin, indole reaction, LOPAT test (levan production, oxidase activity, pectinolytic (potato rot) activity, arginine dihydrolase, tobacco hypersensitivity), fluorescence on King’s B medium (KMB) and ice-nucleation activity tests [25].

Fatty acid analysis

The whole-cell fatty acid methyl ester (FAME) composition was determined for the type strain of P. coronafaciens (NCPPB 600 PT) and an onion strain (YB 12–1). Strains were cultured on tryptic soy broth agar for 24 h at 28°C, and whole-cell fatty acids were saponified, methylated, and extracted as described previously by Miller and Berger (1985) [26]. FAME analysis was conducted using the Microbial Identification System, Sherlock version 3.10 (MIDI).

Pathogenicity test

Three YB strains (12–1, 09–1, 12–4) and P. syringae pv. coronafaciens (NCPPB 600 PT, ATCC 19608, Pcf 83–300), P. syringae pv. porri (NCPPB 3364 PT) and P. syringae pv. syringae (NCPPB 281 PT, Pss 87–300) were grown overnight at 28°C in nutrient broth on a rotary shaker (Innova; New Brunswick Scientific Co., Edison, NJ) at 150 rpm. After overnight incubation, bacterial cultures were centrifuged at 5,000 × g (Allegra 25R, Beckman Coulter, Fullerton, CA) for 3 min and the supernatant was decanted leaving a pellet of bacterial cells. The pellet was resuspended in 0.1 M PBS and the concentration of each bacterial strain was adjusted using a spectrophotometer (Spectronic 20, Bausch and Lomb, Rochester, NY) to an optical density of 0.3 at 600 nm (≈1 × 108 CFU/ml). Seedlings of rye (cv. Wren Abruzzi), oat (cv. Gerard 229), Italian ryegrass (cv. Attain) and onion seedlings (cv. Century) were planted in 10 cm × 8 cm (diameter × height) pots (Hummert International, Earth City, MO) in a commercial potting mix (Sunshine LP5 Plug Mix; Sun Gro Horticulture Industries, Bellevue, WA) in the greenhouse and maintained at 22–24°C and 70–75% RH with a 12L:12D photoperiod. Three weeks-old seedlings (n = 10/strain/experiment) of each host type were inoculated using a hypodermic syringe and needle to inject a 1.0 ml suspension containing 1 × 108 CFU/ml of each bacterial strain in the leaf. Seedlings inoculated with PBS served as a negative control. Inoculated seedlings were evaluated for development of symptoms up to 15 days post inoculation (DPI).

Results

Phylogenetic analysis based on 16S rRNA, gap1, gyrB, gltA and rpoD gene sequences

Based on 16S rRNA gene sequences, strains of P. syringae pv. coronafaciens [NCPPB 600 PT, ATCC 19608, 93–2, 83–300] and YB from onion (09–1, 12–1, 12–4, and 12–5), and the pathotype strains of P. syringae pv. porri (NCPPB 3364 PT), P.syringae pv. oryzae (NCPPB 3683PT), and P.syringae pv. garcea (NCPPB 588PT) formed a clade that was distinct from other P. syringae pathovars (Fig 1).

thumbnail
Fig 1. Maximum parsimony tree based on nucleotide sequences of the 16S rRNA gene of Pseudomonas species and pathovars obtained from heuristic parsimony search and bootstrap analysis.

Bootstrap values are shown at the nodes based on 10,000 replications. Gaps were treated as missing data. The 16S rRNA gene sequence of Pseudomonas putida obtained from NCBI database was treated as an outgroup. Bar, 0.001 substitutions per nucleotide position. The accession numbers are listed adjacent to the respective bacterial strain. The “*” in the figure represents a pathotype strain.

https://doi.org/10.1371/journal.pone.0208271.g001

Sequences of the four housekeeping gene loci gltA, gap1, gyrB, and rpoD [15] were concatenated for the strains described above (Fig 2). The four YB strains (12–1, 09–1, 12–4, 12–5) along with the pathotype strain of P. syringae pv. coronafaciens (NCPPB 600 PT) and a strain (ATCC 19608) formed a distinct clade. This clade also contained the pathotype strains of P. syringae pv. porri (NCPPB 3364 PT), P.syringae pv. oryzae (NCPPB 3683PT), P.syringae pv. striafaciens (NCPPB 1898PT) and P.syringae pv. garcea (NCPPB 588PT) separate from other P. syringae pathovars (Fig 2). These results suggest that strains from P. syringae pv. coronafaciens clade are closely related and different from other P. syringae pathovars.

thumbnail
Fig 2. Maximum parsimony tree based on nucleotide sequences of housekeeping genes gltA, gap1, gyrB, and rpoD of Pseudomonas species and pathovars obtained from heuristic parsimony search and bootstrap analysis.

Bootstrap values are shown at the nodes based on 10,000 replications. Gaps were treated as missing data. Bar, 0.01 substitutions per nucleotide position. The accession numbers in the figure are in following order for each strain: rpoD, gap1, gltA and gyrB. The “*” in the figure represents a pathotype strain.

https://doi.org/10.1371/journal.pone.0208271.g002

PCR assay for the detection of plasmid pCOR1 and coronafactate ligase (cfl) gene

As expected, PCR amplification of both pathotype (NCPPB 600 PT) and a strain of P. syringae pv. coronafaciens (ATCC 19608) with pCOR1-specific primers resulted in a 600 base pair (bp) amplicon (Table 2). One hundred percent of the YB strains (12–1, 09–1, 12–4, 12–5) also produced an amplicon of same size indicating a presence of indigenous plasmid (pCOR1) which is responsible for biosynthesis of coronatine toxin. None of the bacterial strains of P. syringae pathovars including strains of P. syringae pv. syringae (NCPPB 281 PT) and P. syringae pv. aptata (NCPPB 3539 PT) were amplified by the pCOR1-based PCR assay (Table 2). These results also suggest that the YB strains are closely related to P. syringae pv. coronafaciens and both are different from the P. syringae pathovars tested. The cfl gene was detected from all four YB strains (12–1, 09–1, 12–4, 12–5), P. coronafaciens (NCPPB 600 PT and ATCC 19608), P. syringae pv. glycinea, P. syringae pv. maculicola, and P. syringae pv. tomato with an expected amplicon size of 600 bp (Table 2). This gene was not detected from other P. syringae pathovars (P. syringae pv. phaseolicola, P. syringae pv. lachrymans, P. syringae pv. syringae, and P. syringae pv. aptata) tested (Table 2).

thumbnail
Table 2. Polymerase chain reaction screening of bacterial strains using of plasmid (pCOR1)- and coronafacate ligase (cfl) gene-specific primers.

https://doi.org/10.1371/journal.pone.0208271.t002

The gene, hrpZ based PCR assay

Only YB strains (12–1, 09–1, 12–4, 12–5) and P. syringae pv. coronafaciens strains (NCPPB 600 PT and ATCC 19608) were amplified with hrpZ group IV based PCR primers and produced an amplicon of 780 bp (Table 3). In contrast, amplicons were not produced by any of the P. syringae pv. coronafaciens strains, including the YB strains with hrpZ group Ia-III-based PCR assays. P. syringae pv. phaseolicola, P. syringae pv. lachrymans, P. syringae pv. tomato, and P. syringae pv. syringae, were only amplified by PCR assays with hrpZ group Ia (880 bp), Ib (850 bp), II (1000 bp), and III (750 bp) primers, respectively (Table 3). These results indicate that the YB strains belong to hrpZ group IV have a close relationship with P. syringae pv. coronafaciens strains. These results also indicate that P. syringae pv. coronafaciens strains group differently from P. syringae pathovars.

thumbnail
Table 3. Polymerase chain reaction screening of bacterial strains using hrpZ Group I-IV specific primers.

https://doi.org/10.1371/journal.pone.0208271.t003

PCR assay for the detection of effector genes (avrPto, avrD1, avrAE1, hopA1, hopB1, hopC1, hopD1, hopF2, hopG1, hrpK1, hopAF1, and hopAN1)

Both YB and P. syringae pv. coronafaciens strains were positive by PCR assay for avrPto, avrD1, avrAE1, hopA1, hopB1, hopD1, and hopAF1 genes. These bacterial strains were negative for hopC1, hopF2, hopG1, hrpK1, and hopAN1 genes (Table 4). P. syringae pv. syringae was also positive for the effector genes (avrPto, avrD1, avrAE1, hopC1, and hopAN1) whereas it was negative for hopA1, hopB1, hopD1, hopF2, hopG1, hrpK1, and hopAF1 genes (Table 4).

thumbnail
Table 4. List of effector proteins and aviruluence genes screened by polymerase chain reaction for the bacterial strains of Pseudomonas coronafaciens and Pseudomonas syringae pv. syringae.

https://doi.org/10.1371/journal.pone.0208271.t004

DNA-DNA hybridization and determination of DNA G+C content

Three representative YB strains (09–1, 12–1 and 12–4) exhibited high levels of DNA–DNA relatedness to each other (≥94.9%) (Table 5). In contrast, DNA-DNA relatedness of the three YB strains with a pathotype strain of P. syringae pv. syringae (CFBP 4702PT = NCPPB 281PT) displayed ≤40.8% similarity (Table 5). Additionally, the type strain of P. syringae pv. coronafaciens (CFBP 2216PT = NCPPB 600PT) exhibited 34.2% similarity with the type strain of P. syringae pv. syringae (CFBP 4702PT = NCPPB 281PT). Furthermore, DNA-DNA relatedness of a representative strain of YB (12–1) when compared with the pathotype strains of P. syringae pv. coronafaciens (CFBP 2216PT) and P. syringae pv. syringae (4702), exhibited 90.6% and 36.2% similarity, respectively (Table 5). The DNA G+C% for NCPPB 600 PT and YB 12–1 was 58.2 and 57.8 mol%, respectively.

thumbnail
Table 5. DNA relatedness among Pseudomonas coronafaciens and P. syringae pv. syringae.

https://doi.org/10.1371/journal.pone.0208271.t005

Phenotypic characteristics

The most useful phenotypic characteristics for the differentiation of the P. syringae pv. coronafaciens strains from P. syringae pathovars are listed in Table 6. Trigonelline is a key substrate that differentiates P. syringae pv. coronafaciens from P. syringae pathovars with the latter being able to utilize the substrate.

thumbnail
Table 6. Phenotypic characteristics that distinguish P. coronafaciens from P. syringae and P. syringae pathovars.

Data for reference taxa for column 3–7 were taken from Schaad et al. (2001).

https://doi.org/10.1371/journal.pone.0208271.t006

Fatty acid analysis

The fatty acid profile of the P. syringae pv. coronafaciens (pathotype strain: NCPPB 600PT) was similar to that of onion strain (YB 12–1). The most abundant fatty acids identified were C16 : 0, C16 : 1 ɷ7c and/or C16 : 1 ɷ6c (summed feature 3) and C18 : 1 ɷ7c and/or C18 : 1 ɷ 7c (summed feature 8).

Pathogenicity test

Seedlings (of tested hosts) inoculated with PBS did not produce symptoms at 15 DPI. One hundred percent of the seedlings of oat, rye and Italian ryegrass produced halo blight symptoms when inoculated with the strains of P. syringae pv. coronafaciens (NCPPB 600PT, ATCC 19608, Pcf 83–300) (Table 7). However, symptoms were not produced when strains of P. syringae pv. coronafaciens were inoculated on onion seedlings. In contrast, 100% of the onion seedlings displayed symptoms, when inoculated with the YB strains (12–1, 09–1, 12–4) or P. syringae pv. porri (NCPPB 3364PT) (Table 7). However, symptoms produced by YB strains were different (intense chlorosis in emerging leaves and severe blight in the older leaves) than those produced by P. syringae pv. porri (NCPPB 3364PT) (water-soaked necrotic lesions on younger leaves). Unlike P. syringae pv. coronafaciens, YB strains or P. syringae pv. porri (NCPPB 3364PT) strain did not produce any symptoms on the seedlings of oat, rye and Italian ryegrass. P. syringae pv. syringae strains (NCPPB 281PT, Pss 87–300) did not produce symptoms on any of the inoculated plants (Table 7). Subsequent bacterial isolation and re-identification for all bacterial strain-plant species inoculation combination reconfirmed the association of symptoms with typical bacterial strain inoculated.

thumbnail
Table 7. Pathogenicity test of Pseudomonas coronafaciens, Pseudomonas syringae pv. syringae and yellow bud strains on cereals, grasses and onion.

https://doi.org/10.1371/journal.pone.0208271.t007

Discussion

The taxonomy of Pseudomonas syringae and its pathovars has changed and been a matter of confusion for three decades [1]. Among the identified nine ‘genomospecies’ of the P. syringae complex, genomospecies 4 comprised of pathovars [pv. coronafaciens, pv. atropurpurea, pv. striafaciens, pv. oryzae, and pv. zizaniae, pv. garcea, pv. porri that infect small grains, grasses, leek, onion and coffee] [6,8]. An attempt was made by Schaad and Cunfer (1979) [9] to differentiate P. syringae pv. coronafaciens, P. syringae pv. zea, P. syringae pv. atropurpurea and P. syringae pv. striafaciens; however, the authors found these bacterial species/pathovars to be synonymous. The authors couldn’t differentiate these strains based on physiological, immunological, substrate utilization and host-range tests. Apart from these two studies, detailed investigation is lacking on characterization of P. syringae pv. coronafaciens and P. syringae pv. syringae. Despite being in genomospeies 4, “Pseudomonas syringae pv. coronafaciens” was not included in the Approved List of Bacterial Names and hence is not recognized as a valid species name [27]. Polyphasic approach of taxonomic classification was not adopted when species designations were made. The current study adopted a polyphasic approach to re-characterize P. syringae pv. coronafaciens strains (hosts: oat, rye and onion; and also a pathotype strain) and observed them to be distinct from the pathotype strains of P. syringae and P. syringae pathovars. Hence, it is recommended to elevate P. syringae pv. coronafaciens to a species level as P. coronafaciens. Furthermore, polyphasic approach was also used to identify an unknown bacterial pathogen that was responsible for a new disease in onion (yellow bud), to a species (P. coronofaciens).

Phylogenetic analysis based on 16S rRNA sequences indicate that strains of P. syringae pv. coronafaciens [NCPPB 600 PT, ATCC 19608, 93–2, 83–300] and YB from onion (09–1, 12–1, 12–4, and 12–5), and the pathotype strains of P. syringae pv. porri (NCPPB 3364 PT), P.syringae pv. oryzae (NCPPB 3683PT), and P.syringae pv. garcea (NCPPB 588PT) formed a clade that was distinct from other P. syringae pathovars. Sequencing and concatenation of four housekeeping gene loci gltA, gap1, gyrB, and rpoD resulted in a distinct clade that comprised of four YB strains (12–1, 09–1, 12–4, 12–5) and P. syringae pv. coronafaciens strains [NCPPB 600 PT, ATCC 19608, 93–2, 83–300]. The pathotype strains of P. syringae pv. porri (NCPPB 3364 PT), P.syringae pv. oryzae (NCPPB 3683PT), P.syringae pv. striafaciens (NCPPB 1898PT) and P.syringae pv. garcea (NCPPB 588PT) were also grouped in this clade, and were separated from other P. syringae pathovars. These results suggest that strains from P. syringae pv. coronafaciens clade are closely related and are different from other P. syringae pathovars. Similar observations were made by Gomila et al. (2017) [28] where the authors compared whole genomes and pan-genomes of 139 Pseudomonas pathovars. They observed that P. syringae pv. coronafaciens along with P. syringae pv. garcea, P. syringae pv. oryzae, P. syringae pv. striafaciens, and P. syringae pv. porri formed a distinct cluster different from other P. syringae pathovars [28]. Rombouts et al., (2015) [29] also demonstrated separate grouping of P. syringae pv. garcea, P. syringae pv. oryzae, P. syringae pv. striafaciens, and P. syringae pv. porri strains from the P. syringae pathovars using rpoD based sequencing and DNA fingerprinting by BOX-PCR. Although in above studies MLSA or 16S rRNA sequencing were not used but the conclusions derived from these independent studies were similar.

Plasmids not only govern bacterial host range, and microbial evolution but in some cases can be utilized in bacterial taxonomy. The knowledge of plasmid profile (quantity and type) may help in understanding bacterial phylogeny and taxonomy. However, sole or heavy reliance of plasmid diversity in bacterial taxonomy can be misleading as it can be easily transferred or lost [30]. Nevertheless, plasmid pCOR1 is common among the coronatine (a chlorosis producing phytotoxin) producing Pseudomonas sp. including P. syringae pv. coronafaciens and P. syringae pathovars (pvs. atropurpurea, maculicola, glycinea and morsprunorum) [16]. Further characterization of P. syringae pv. coronafaciens strains using pCOR1- based PCR assay resulted in a positive amplification from the YB strains along with pathotype strain of P. syringae pv. coronafaciens (NCPPB 600PT). However, P. syringae pathovars used in this study were not amplified indicating close relationship of the YB strains to P. syringae pv. coronafaciens. Based on hrpZ group specific PCR assay, it was observed that the YB strains along with P. syringae pv. coronafaciens strains belonged to group IV, which is distinct from P. syringae and P. syringae pathovars. These results indicate that the YB strains have a close relationship with the pathotype strain of P. syringae pv. coronafaciens (NCPPB 600) and also they are different from P. syringae pathovars. However, we acknowledge that PCR based assays reported above reflect mere presence/absence of gene or genes but they do not truly reflect their functionality.

Profile of effector genes (type) tend to be similar to some extent in closely related phytopathogenic bacterial species. The YB and P. syringae pv. coronafaciens strains possessed similar effector genes; avrPto, avrD1, avrAE1, hopA1, hopB1, hopD1, and hopAF1 genes. In contrast, P. syringae pv. syringae possessed effector genes (avrPto, avrD1, avrAE1, hopC1, and hopAN1) whereas it lacked genes; hopA1, hopB1, hopD1, hopF2, hopG1, hrpK1, and hopAF1. These results suggest that the YB strains were similar to P. syringae pv. coronafaciens with respect to the presence of effector genes. Despite differences in effector profile between P. syringae pv. coronafaciens and P. syringae pv. syringae, we acknowledge that such differences may not truly reflect species level distinction. Further detailed investigation on determining effector profiles of multiple P. syringae pv. coronafaciens and P. syringae pv. syringae may throw some light on this perspective.

DNA-DNA hybridization values have been widely used by bacterial taxonomist for determining bacterial species especially in Pseudomonas [31]. In this study, DNA-DNA relatedness of YB strains when compared with the pathotype strains of P. syringae pv. coronafaciens (CFBP 2216PT = NCPPB 600PT) exhibited ≥90.6% similarity. These results indicate that the YB and P. syringae pv. coronafaciens strains meet the criteria established for a bacterial species. Furthermore, DNA-DNA relatedness of a YB strain (12–1) and a pathotype strain of P. syringae pv. coronafaciens (CFBP 2216PT = NCPPB 600PT) when compared with a pathotype strain of P. syringae pv. syringae (CFBP 4702PT = NCPPB 281PT), similarity index of 36.2% and 34.2%, respectively were observed. These observations suggest that the YB and P. syringae pv. coronafaciens strains do not belong to the species P. syringae. Gardan et al. (1999) [8] also made similar observations where ≤45% DNA-DNA relatedness was observed when P. syringae CFBP 1392PT was compared with P. syringae pv. porri, P. syringae pv. garcea, P. syringae pv. striafaciens, P. syringae pv. coronafaciens, P. syringae pv. atropurpurea, P. syringae pv. oryzae, and P. syringae pv. zizaniae.

DNA-DNA relatedness is a good indicator of species delineation and in some cases is better than 16S rRNA and MLSA. Moreover, DNA-DNA relatedness has been demonstrated to carry similar weight as that of whole genome sequencing [22]. Goris et al. (2007) [22] examined the quantitative relationship between DNA-DNA relatedness values and genome sequence-derived parameters, such as the average nucleotide identity (ANI) of common genes and the percentage of conserved DNA. The authors observed a close relationship between DNA-DNA relatedness values and ANI and the percentage of conserved DNA for each pair of strains. The authors recommended that cut-off point of 70% DNA-DNA relatedness values for species delineation more likely corresponds to 95% ANI and 69% conserved DNA. It would be interesting to evaluate relationships among the pathotype strains in genomospecies 1 including P. syringae pv. syringae and pathotype strains of genomospecies 4 including P. syringae pv. coronafaciens strains using genome sequence-derived parameter like ANI of common genes. Future studies should include comparative genomics of pathotype strains of genomospecies 1 and 4.

Pathovar is a bacterial classification that plant pathologist and applied plant microbiologists often use to differentiate bacterial strains based on their ability to cause infection on different plant host/hosts [5,19]. In this study, host range for the YB strains was determined on common hosts known for P. syringae pv. coronafaciens (oat, rye and Italian ryegrass) and also on an isolated host ‘onion’. As expected P. coronafaciens strains (NCPPB 600PT, ATCC 19608, Pcf 83–300) produced typical halo blight symptoms on oat, rye and Italian rye grass but did not produce any symptoms on onion. Contrastingly, the YB strains (12–1, 09–1, 12–4) and a pathotype strain of P. syringae pv. porri (NCPPB 3364PT) produced symptoms on onion but did not produce symptoms on any of the other tested hosts (oat, rye and Italian ryegrass). However, symptoms produced by YB strains were different (intense chlorosis in emerging leaves and severe blight in the older leaves) than those produced by P. syringae pv. porri (NCPPB 3364PT) (water-soaked necrotic lesions on younger leaves). These observations suggest that the YB strains, although belong to P. syringae pv. coronafaciens (identified in this study), did not share the common host range (oat, rye, Italian ryegrass). Also, these results indicate that the YB strains can potentially be a novel pathovar of P. syringae pv. coronafaciens infecting onion. This is the first report that of any P. syringae pv. coronafaciens infecting a member of Alliacea family (onion).

The “P. syringae pv. coronafaciens” strains belong to genomospecies 4 according to Garden et al. [8]. The species “P. syringae pv. coronafaciens” has been proposed by Schaad and Cunfer (1979) [9] based on phenotypic characteristics. Recently, whole genome and pan-genome comparison of 139 Pseudomonas pathovars revealed that P. syringae pv. coronafaciens belonged to a distinct cluster different from other P. syringae pathovars and hence the authors proposed to revive “P. syringae pv. coronafaciens” as a nomenspecies [28]. However, the study by Gomila et al. (2017) [28] lacked relevant information on phenotypic and genotypic characterization of P. syringae pv. coronafaciens strains that we provide in the current study and thereby proposing to designate and revive P. coronafaciens as a separate species.

In conclusion, the genotypic and phenotypic data presented in this study demonstrate that the P. syringae pv. coronafaciens strains along with the YB strains from onion belong to a separate species from P. syringae. We therefore propose to elevate P. syringae pv. coronafaciens to a species level as P. coronafaciens sp. nov., nom. rev.

Description of Pseudomonas coronafaciens sp. nov., (co.ro.na.faʹci.ens. L. corona crown; L. facio to make; M.L. part. adj. coronafaciens halo-producing)

Bacterial cells are gram-negative, short rods, non-capsulated, motile and non-spore-forming. Colonies are cream-colored, smooth, round and convex with entire margins on nutrient agar supplemented with 0.5% yeast extract. Growth occurs at 24–30°C, but not at 4 or 40°C. The bacterium is strictly aerobic and negative for indole activity. It produces levan, is negative for oxidase, does not cause a rot in potato, negative for arginine dihydrolase, but produces a hypersensitive reaction in tobacco (LOPAT reaction: +—+). The bacterium is ice-nucleation positive and is variable for the production of a water-soluble, fluorescent pigment when grown on KMB. P. coronafaciens sp. nov., nom. rev. can hydrolyze aesculin and gelatin and utilize the following substrates at 24°C: tween 40, tween 80, L-arabinose, D-arabitol, I-erythritol, D-fructose, D-galactose, α-D-glucose, sucrose, methyl pyruvate, mono-methyl succinate, acetic acid, cis-aconitic acid, formic acid, D-galactonic acid lactone, D-galacturonic acid, D-gluconic acid, D-glucosaminic acid, D-glucuronic acid, α-keto-glutaric acid, malonic acid, propionic acid, quinic acid, D-saccharic acid, succinic acid, succinamic acid, glucuronamide, D-alanine, L-alanyl-glycine, L-asparagine, L-aspartic acid, L-Glutamic acid, glycyl-L-glutamic acid, L-proline, L-serine, L-thronine, γ-amino butyric acid, inosine, uridine, thymidine, glycerol, and D, L- α-glycerol phosphate. The bacterium cannot utilize trigonelline, L-lactate, and D-tartarate.

The type strain of P. coronafaciens sp. nov. is NCPPB 600T = CFPB 2216 T = LMG 5060 T = ICMP 3316 T. The most abundant fatty acids are C16 : 0, C16 : 1 ɷ7c and/or C16 : 1 ɷ6c (summed feature 3) and C18 : 1 ɷ7c and/or C18 : 1 ɷ 7c (summed feature 8). The DNA G+C% for P. coronafaciens type strain (NCPPB 600PT) and onion strain (YB 12–1) were 58.2 and 57.8 mol%, respectively. The NCBI accession number for the type strain is 16S rRNA gene is HM032070.

Acknowledgments

We thank Mr. Jonathon Van Keith Searcy, Mr. Kyle Parris and Ms. Erin Holliman for their technical assistance. This work was supported in part by the Vidalia Onion Committee. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The authors have declared that no competing interests exist.

References

  1. 1. Young JM, Takikawa Y, Gardan L, Stead DE. Changing concepts in the taxonomy of plant pathogenic bacteria. Annu Rev Phytopathol. 1992; 30: 67–105.
  2. 2. Cleenwerck I, Vandemeulebroecke K, Janssens D, Swings J. Re-examination of the genus Acetobacter, with descriptions of Acetobacter cerevisiae sp. nov. and Acetobacter malorum sp. nov. Int J Syst Evol Microbiol. 2002; 52: 1551–1558. pmid:12361257
  3. 3. Doudoroff M, Palleroni NJ. Bergey’s Manual of Determinative Bacteriology. Genus I Pseudomonas Migula. In: Buchanan RE, Gibbons NE, editors. The Proteobacteria, Part B: The Gammaproteobacteria. Baltimore, MD. 1984. pp. 217–243.
  4. 4. Palleroni NJ. Bergey’s Manual of Systematic Bacteriology. Genus I Pseudomonas Migula. In: Krieg NR et al. (editors). The Proteobacteria, Part B: The Gammaproteobacteria. Baltimore, MD. 1984; pp. 141–199.
  5. 5. Dye DW, Bradbury JF, Goto M, Hayward AC, Lelliott RA. International standards for naming pathovars of phytopathogenic bacteria and a list of pathovar names and pathotype strains. Rev Plant Pathol. 1980; 59: 153–158.
  6. 6. Gardan L, Cottin S, Bollet C, Hunault G. Phenotypic heterogeneity of Pseudomonas syringae. Res Microbiol. 1991; 142: 995–1003. pmid:1805313
  7. 7. Hildebrand DC, Schroth MN, Sands DC. Pseudomonads. In: Laboratory Guide for Identification of Plant Pathogenic Bacteria, Edited by Schaad N. W. St Paul, MN: American Phytopathological Society Press. 1988. pp. 60–80.
  8. 8. Gardan L, Shafik H, Belouin S, Broch R, Grimont F. DNA relatedness among the pathovars of Pseudomonas syringae and description of Pseudomonas tremae sp. nov. and Pseudomonas cannabina sp. nov. (ex Sutic and Dowson 1959). Int J Syst Bacteriol. 1999; 49: 69–478.
  9. 9. Schaad NW, Cunfer BM. Synonymy of Pseudomonas coronafaciens, Pseudomonas coronafaciens pathovars zeae, Pseudomonas coronafaciens subsp. atropurpurea, and Pseudomonas striafaciens. Int J Syst Bacteriol. 1979; 29:213–221.
  10. 10. Gitaitis RD, Mullis S, Lewis K, Langston D, Watson AK. First report of a new disease of onion in Georgia caused by a non-fluorescent Pseudomonas sp. Plant Dis. 2012; 96: 285.
  11. 11. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 1991; 173: 697–703. pmid:1987160
  12. 12. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acid Res. 1994; 22: 4673–4680. pmid:7984417
  13. 13. Swofford DL. PAUP*: Phylogenetic analysis using parsimony (and other methods), version 4. 2000; Sunderland, MA: Sinauer Associates.
  14. 14. Hwang MSH, Morgan RL, Sarkar SF, Wang PW, Guttman DS. Phylogenetic characterization of virulence and resistance phenotypes of Pseudomonas syringae. Appl Environ Microbiol. 2005; 71: 5182–5191. pmid:16151103
  15. 15. Yan S, Liu H, Mohr TJ, Jenrette J, Chiodini R, Zaccardelli M et al. Role of recombination in the evolution of the model plant pathogen Pseudomonas syringae pv. tomato DC3000, a very atypical tomato strain. Appl Environ Microbiol. 2008; 74: 3171–3181. pmid:18378665
  16. 16. Takahashi Y, Omura T, Hibino H, Sato, M. Detection and identification of Pseudomonas syringae pv. atropurpurea by PCR amplification of specific fragments from an indigenous plasmid. Plant Dis. 1996; 80: 783–788.
  17. 17. Bereswill S, Bugert P, Volksch B, Ullrich M, Bender CL. Identification and relatedness of coranatine producing Pseudomonas syringae pathovars by PCR analysis and sequence determination of the amplification product. Appl Environ Microbiol. 1994; 60: 2924–2930. pmid:7916181
  18. 18. Inoue Y, Takikawa Y. The hrpZ and hrpA genes are variable, and useful for grouping Pseudomonas syringae bacteria. J Gen Plant Pathol. 2006; 72: 26–33.
  19. 19. Ferrante P, Scortichini M. Molecular and phenotypic features of Pseudomonas syringae pv. actinidiae isolated during recent epidemics of bacterial canker on yellow kiwifruit (Actinidia chinensis) in central Italy. Plant Pathol. 2010.
  20. 20. Cleenwerck I, Vandemeulebroecke K, Janssens D, Swings J. Re-examination of the genus Acetobacter, with descriptions of Acetobacter cerevisiae sp. nov. and Acetobacter malorum sp. nov. Int J Syst Evol Microbiol. 2002; 52: 1551–1558. pmid:12361257
  21. 21. Ezaki T, Hashimoto Y, Yabuuchi E. Fluorometric deoxyribonucleic acid- deoxyribonucleic acid hybridization in microdilution wells as an alternative to membrane filter hybridization in which radioisotopes are used to determine genetic relatedness among bacterial strains. Int J Syst Bacteriol. 1989; 39: 224–229.
  22. 22. Goris J, Suzuki K, De Vos P, Nakase T, Kersters K. Evaluation of a microplate DNA–DNA hybridization method compared with the initial renaturation method. Can J Microbiol. 1998; 44: 1148–1153.
  23. 23. Mesbah M, Premachandran U, Whitman WB. Precise measurement of the G+C content of deoxyribonucleic acid by high performance liquid chromatography. Int J Syst Bacteriol. 1989; 39: 159–167.
  24. 24. Wilson K. Preparation of genomic DNA from bacteria. In Current Protocols in Molecular Biology, Edited by Ausubel F. M., Brent R., Kingston R. E., Moore D. D., Seidman J. G., Smith J. A. & Struhl K. New York: Green Publishing & Wiley-Interscience. 1987. pp. 2.4.1–2.4.5.
  25. 25. Schaad NW, Jones JB, Lacy GH. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. St. Paul, MN, USA: American Phytopathological Society APS Press. 2001.
  26. 26. Miller L, Berger T. Bacteria identification by gas chromatography of whole cell fatty acids. Hewlett-Packard application note. 1985. pp. 228–241.
  27. 27. Bull CT, De Boer SH, Denny TP., Firrao G, Fischer-Le Saux, M, Saddler GS, et al. Comprehensive list of names of plant pathogenic bacteria, 1980–2007. J Plant Pathol. 2010a; 92:551–592.
  28. 28. Gomila M, Busquets A, Mulet M, García-Valdés E, Lalucat J. Clarification of Taxonomic Status within the Pseudomonas syringae Species Group Based on a Phylogenomic Analysis. Front. Microbiol. 2017; 8:2422. pmid:29270162
  29. 29. Rombouts S, Vaerenbergh JV, Volckaert A, Baeyen S, De Langhe T, Declercq B, et al. Isolation and characterization of Pseudomonas syringae pv. porri from leek in Flanders. Eur J Plant Pathol. 2016; 144:185–198.
  30. 30. Shintani M, Sanchez ZK, Kimbara K. Genomics of microbial plasmids: classification and identification based on replication and transfer systems and host taxonomy. Front. Microbiol. 2015; 6:242. pmid:25873913
  31. 31. Bull CT, Manceau C, Lydon J, Kong H, Vinatzer BA, Fischer-Le Saux M. Pseudomonas cannabina pv. cannabina pv. nov., and Pseudomonas cannabina pv. alisalensis (Cintas Koike and Bull 2000) comb. nov., are members of the emended species Pseudomonas cannabina (ex Šutič & Dowson 1959) Gardan, Shafik, Belouin, Brosch, Grimont & Grimont 1999. Syst. Appl. Microbiol. 2010b; 33: 105–115.