Mitochondrial genome annotation and phylogenetic placement of Oreochromis andersonii and O. macrochir among the cichlids of southern Africa

Ian Bbole; Jin-Liang Zhao; Shou-Jie Tang; Cyprian Katongo

doi:10.1371/journal.pone.0203095

Abstract

Genetic characterization of southern African cichlids has not received much attention. Here, we describe the mitogenome sequences and phylogenetic positioning of Oreochromis andersonii and O. macrochir among the African cichlids. The complete mitochondrial DNA sequences were determined for O. andersonii and O. macrochir, two important aquaculture and fisheries species endemic to southern Africa. The complete mitogenome sequence lengths were 16642 bp and 16644 bp for O. andersonii and O. macrochir respectively. The general structural organization follows that of other teleost species with 13 protein–coding genes, 2 rRNAs, 22 tRNAs and a non-coding control region. Phylogenetic placement of the two species among other African cichlids was performed using Maximum Likelihood (ML) and Bayesian Markov-Chain-Monte-Carlo (MCMC). The consensus trees confirmed the relative positions of the two cichlid species with O. andersonii being very closely related to O. mossambicus and O. macrochir showing a close relation to both species. Among the 13 mitochondrial DNA protein coding genes ND6 may have evolved more rapidly and COIII was the most conserved. There are signs that ND6 may have been subjected to positive selection in order for these cichlid lineages to diversify and adapt to new environments. More work is needed to characterize the southern Africa cichlids as they are important species for capture fisheries, aquaculture development and understanding biogeographic history of African cichlids. Bio-conservation of some endangered cichlids is also essential due to the threat by invasive species.

Citation: Bbole I, Zhao J-L, Tang S-J, Katongo C (2018) Mitochondrial genome annotation and phylogenetic placement of Oreochromis andersonii and O. macrochir among the cichlids of southern Africa. PLoS ONE 13(11): e0203095. https://doi.org/10.1371/journal.pone.0203095

Editor: Paolo Ruggeri, Natural History Museum of London, UNITED KINGDOM

Received: August 12, 2018; Accepted: November 12, 2018; Published: November 27, 2018

Copyright: © 2018 Bbole et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All nucleotide sequence files are available from the NCBI database (accession numbers MG603674, MG603675). All other relevant data are within the manuscript and its Supporting Information files.

Funding: The laboratory work was supported by China Agriculture Research System (CARS-46) granted to IB. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Africa is the origin centre for cichlid diversity with well over 2000 species having diverse morphology, behaviour and ecology [1]. In Southern Africa Oreochromis andersonii (Castelnau 1861) and Oreochromis macrochir (Boulenger 1912) are two important mouth brooding endemic cichlid species in this region [2]. The former occurs in the upper Zambezi, Middle Zambezi, Kafue, Okavango and Cunene Rivers while the latter is distributed in the Upper Zambezi, Kafue, and Congo River systems [2–4]. Oreochromis macrochir (Green head or longfin tilapia) has further been introduced to the Hawaiian Islands, Okavango and Ngami region and Cunene River basin [4]. Oreochromis andersonii (Three-spot tilapia) and O. macrochir are important for both capture fisheries and aquaculture in Southern Africa [5]. However, due to the increase in fishing pressure as a result of an ever growing human population in this region as well as the introduction of Nile tilapia (O. niloticus) in almost all river systems where the native species occur, populations of these native species has greatly dwindled to vulnerable levels [6,7]. Nile tilapia hybridization with these native species and consequent decline in their population may as well make these species critically endangered in some Southern African rivers such as the Kafue River [8–10]. Despite Nile tilapia dominating aquaculture production in Southern Africa, efforts have been made to domesticate native species. This is partly as a result of the growing concern of ecosystem changes in most river systems due to Nile tilapia invasion. A number of studies in Zambia have shown potential for aquaculture of some native tilapia species [11–14]. In-fact, the Zambian Department of Fisheries have adopted O. andersonii as a candidate species for aquaculture development [15].

Molecular genetic studies on cichlids in Africa have focused primarily on phylogenetics of East African Lakes because of the spectacular adaptive radiation and explosive speciation in these lakes (for example, [16–19]). Nile tilapia has also received global attention because of its importance as an edible fish [20]. A few peer reviewed scientific papers have reported the use of molecular genetics in the study of endemic Southern African cichlids commercially important for fisheries and aquaculture. Phylogenetic relationships have been inferred among and between cichlid species based on selected mitochondrial DNA regions and some allozymes [21–26]. However, none of these phylogenetic analyses were based on complete mitogenome sequences.

Among the important cichlids for aquaculture in Southern Africa (O. andersonii, O. macrochir, O. mossambicus, O. niloticus, and Tilapia rendalli) complete mitogenome sequence have only been determined for O. mossambicus and O. niloticus.

In this study we describe the complete mitogenome sequences of O. andersonii and O. macrochir deposited in the GenBank with accession numbers MG603674 and MG603675 respectively. Based on the mitogenome sequences of these two species and other cichlids we confirm the position of these species among the cichlid species of Africa and analyse the evolutionary rates of the protein coding genes.

Materials and methods

Sample collection and DNA extraction

The Key Laboratory of Aquatic Genetic Resources and Utilization of Shanghai Ocean University approved the study protocol. All applicable international guidelines for the care and use of animals were followed. Three tissue samples (fin clips) each of O. andersonii and O. macrochir were collected from the Upper Zambezi River (16.10 S, 23.295 E) and Lake Bangweulu (11.35 S, 29.58 E) in Zambia respectively. This was conducted with approval from the Zambian Department of Fisheries. They were collected using gill nets and anaesthetized using clove oil (2–3 drops clove oil in a litre of water). The fin clips were obtained from each fish sample and preserved in absolute ethanol placed in 1.5 μL microtubules. These areas had no report of O. niloticus presence at the time of collecting the tissues. DNA was extracted from fin clips using a TIANamp Marine Animals DNA Kit using the manufacturer’s instructions (Tiangen, China).

PCR amplification and sequencing

Thirty primers were designed for both O. andersonii and O. macrochir and 2 other primers for each species (S1 Table). The primers were designed using aligned complete mitogenomes of O. mossambicus (Accession number: AY597335.1) and O. niloticus (Accession number: GU370126.1). PCR was performed using an Eppendorf Thermal Cycler (Eppendorf, Germany). The total reaction mixture of 25.0 μl containing 17.5 μl distilled water, 4.5 μl PCR mix (Tiangen, China), 1.0 μl forward primer, 1.0 μl reverse primer, and 1.0 μl template DNA (50 ng/ μl) were used. The reaction was denatured at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 48–53°C for 30 seconds and elongation at 72°C for 45 seconds; the last extension step was carried out at 72°C for 7 minutes. Agarose (1.0%) electrophoresis was performed to visualize the PCR products. The PCR products were purified using the 3S Spin PCR product Purification Kit (Biocolor Inc., Shanghai, China). The purified DNA was sequenced on an ABI 3730 xl capillary sequencer employing the same primers as for PCR. The various regions of mitochondrial DNA were sequenced and projected as electronic outputs by the computer connected to the sequencer.

Sequence editing, alignment and annotation

The raw sequences of the various regions of mitochondrial DNA of O. andersonii and O. macrochir were edited and assembled using BioEdit Version 7.2.6 [27]. They were further edited and aligned using complete mitogenomes of O. niloticus and O. aureus [28], O. variabilis [29] and O. mossambicus (accession number: AY597335.1). Blast database searches on NCBI site were performed to verify the target sequences amplified. Transfer RNA (tRNA) genes and their secondary structures were identified using tRNAScan-SE 2.0 [30]. MEGA Version 7.0.26 [31] was used to calculate the composition of amino acids, nucleotides and codon usage in the sequences. Annotation of the sequences were performed with DOGMA [32], MITOS [33], and MitoAnnotator [34]. Further verification was done with O. niloticus and O. mossambicus genome organization. The nucleotide composition skewness was measured following the formulas: AT skew [(A − T)/(A + T)] and GC skew [(G − C)/(G + C)] [35]. MEGA Version 7.0.26 was used to test for mode of selection in protein coding genes acting at non-synonymous sites using the ration non-synonymous/synonymous (dN/dS).

Phylogenetic analysis

To infer phylogeny, mitogenomes of 29 other cichlids mainly found in Southern Africa were obtained from the NCBI GenBank site (Table 1). The protein-coding genes were used for phylogenetic analysis (including the two novel genomes of O. andersonii and O. macrochir) except ND6 which is encoded by the opposite strand and considered to possess a distinct heterogeneous base composition from the other 12 protein-coding genes [36]. The concatenated protein sequences were aligned using MUSCLE with default settings [37]. Furthermore, we analysed the phylogenetic relations of the same 30 cichlid species including the 2 novel sequences of O. andersonii and O. macrochir using a complete mitochondrial NADH dehydrogenase subunit 2 (ND2) gene sequences obtained from the NCBI GenBank. In the analysis using mitochondrial locus ND2 we included another species Coptodon rendalli. The sequences were also aligned using MUSCLE with default settings performed in MEGA 7.0.26.

Download:

Table 1. List of species with their accession numbers used in phylogenetic analysis in this study.

https://doi.org/10.1371/journal.pone.0203095.t001

Phylogenetic analysis was performed using Maximum Likelihood (ML) in MEGA Version 7.0.26 [31] and Bayesian Markov-Chain-Monte-Carlo (MCMC) method in MrBayes (Version 3.2.6) [47]

The optimal nucleotide substitution model selected was based on the General Time Reversible model (GTR + G + 1) obtained from a Model test in MEGA X [48]. It was based on a non-uniformity of evolutionary rates modelled by using a discrete Gamma distribution (+G) with 5 rate categories and by assuming that a certain fraction of the sites are evolutionary invariable (+1). Maximum Likelihood analysis was based on this General Time Reversible model with bootstrap consensus tree inferred from 1000 replicates taken to represent the evolutionary history of the taxa analysed. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. Using the same nucleotide substitution model the Bayesian posterior probabilities were estimated using 1,000,000 generations, sampling every 100 generations at which point the standard deviation of split frequencies of the two independent runs was below 0.01. A consensus tree was constructed from the saved trees after discarding the first 25% trees as burn-in.

Relative rate of protein coding gene evolution

To understand the measure of strength and mode of selection acting on protein coding genes we measured the ratio of non-synonymous to synonymous substitutions (dN/dS). This is because this ratio tends to differ over evolutionary time in protein coding genes. All 13 protein coding gene sequences were obtained from 20 different cichlid species and were aligned using a codon-based model in MUSCLE module of MEGA Version 7.0.26 [31]. Each gene was aligned separately. The rate of dN/dS was calculated using Maximum Likelihood computations conducted using HyPhy software package [49] in MEGA. Codon positions included were 1^st + 2^nd + 3^rd + Noncoding. All positions containing gaps and missing data were eliminated. The overall p-genetic distance calculation was performed on the 1^st and 2^nd, 3^rd and whole sequence codon positions. Evolutionary analyses were conducted in MEGA X [48]

Results and discussion

Mitogenome annotation

Annotation results of O. andersonii and O. macrochir using three methods; DOGMA, MITOS and MitoAnnotator [32–34] revealed some differences in sizes of the protein coding genes and the two rRNAs. However, annotation results using the three methods were similar for all tRNAs (S2 Table). The largest difference was observed in gene ND5 were DOGMA and MITOS differed from MitoAnnotator in the end position because of omission of stop codon bases in the annotation provided by MitoAnnotator (S2 Table). The gene sizes for O. andersonii and O. macrochir were similar in all the three annotation methods used except ND2 final position with a difference of 7 bp and ND5 initial position with a difference of 3 bp (S2 Table). Comparing the results obtained, annotation from Mitoannotator was selected for submission to the GenBank (Table 2).

Download:

Table 2. Complete automated annotated sequences of O. andersonii (16642 bp) and O. macrochir (16644 bp) generated in MitoAnnotator.

https://doi.org/10.1371/journal.pone.0203095.t002

Mitogenome organization

The complete mitogenome sequence size of O. andersonii and O. macrochir were 16642 bp (accession #: MG603674) and 16644 bp (accession #: MG603675) respectively. This was similar to the published mitogenomes sequences of other Oreochromis species i.e. O. niloticus with 16625 bp and O. aureus with 16628 bp [28]; Oreochromis variabilis with 16626 bp [29] and GenBank deposited sequence of O. mossambicus (AY597335.1). As anticipated, the general structural organization follows those of other teleost species with 13 protein coding genes, 2 rRNAs, 22 tRNAs, and a non-coding control region (Table 2 and Figs 1 and S1). Both species were observed to exhibit the Heavy (H) and Light (L) strand coding pattern previously observed in other teleosts. The L-strand was observed in one protein coding gene (NADH dehydrogenase subunit 6 (ND6)) and eight tRNAs (tRNA^Gln, tRNA^Ala, tRNA^Asn, tRNA^Cys, tRNA^Tyr, tRNA^Ser, tRNA^Glu, tRNA^Pro). The start codons for protein coding genes for both O. andersonii and O. macrochir were ATG except for gene CO1 which was GTG. The stop codons on the other hand were either TAG or TAA except for gene CO11, ND4, and Cyt b which had incomplete stop codons of T++. The incomplete codon stops observed for the two species is a common feature in most vertebrates including some fish species [50–52].

Download:

Fig 1. Mitogenome organisation of O. macrochir generated by MitoAnnotator.

The genes on the outer side of the circle are coded on the H-strand while those on the inner circle are coded with L-strand.

https://doi.org/10.1371/journal.pone.0203095.g001

The overall nucleotide base composition was very similar between the two species. For O. andersonii; T = 26.3%, C = 30.1%, A = 28.0%, G = 15.6% whereas O. macrochir T = 26.2%, C = 30.2%, A = 28.1%, G = 15.5%. Further, the GC% and AT% were the same for both species at 45.7 and 54.3 respectively (Table 3). This base composition is very similar to what has been reported for other Oreochromis species [28, 29] and other species as well [29,53]. The lower value for GC compared to AT is another common feature which has been observed in most vertebrate mitogenome resulting from anti-bias against G in the third codon position. The species in this study had lower values of G in all the three codon positions of protein coding genes and non-coding control region (Table 3). Furthermore, the GC-skew and AT-skew which describe the overall patterns of nucleotide composition in DNA sequences [35], were -0.317 and 0.031 for O. andersonii and -0.322 and 0.035 for O. macrochir respectively. This result shows an excess of C over G and excess of A over T on the heavy strand (Table 3).

Download:

Table 3. Base percent composition of complete mitogenome sequences of O. andersonii (16642 bp) and O. macrochir (16644 bp) generated in MEGA 7.0.26.

https://doi.org/10.1371/journal.pone.0203095.t003

Intergenic overlaps were observed in 4 genes and spacers in 10 genes in the mitogenome of O. andersonii and O. macrochir. The most significant overlap of 461 nucleotides was observed between ND5 and ND6. This large overlap is not a common feature among most reported teleost mitogenomes. Overlap of 10 nucleotides between ATPase 8 and ATPase 6 was also observed for both species followed by ND4L and ND4 gene with overlap of 7 nucleotides. Intergenic spacers totalled 56 bp in 10 regions for both O. andersonii and O. macrochir (see Table 2). The most significant intergenic spacers in both species were between tRNA^Asn and tRNA^Cys (33 nucleotides) followed by tRNA^Asp and COII (5 nucleotides). Again intergenic overlaps and spacers follow what has been reported for most vertebrate mitogenomes inclusive of different fish species except for the overlap between ND5 and ND6.

Protein coding genes

The nucleotide composition of the protein coding genes was very similar between O. andersonii and O. macrochir (Table 3). The total GC% composition was 46.3 and AT% was 53.7 for O. andersonii and 46.4 and 53.6 for O. macrochir. The GC-skew for O. andersonii and O. macrochir were -0.400 and -0.401 and the AT-skew values were -0.024 and -0.022 respectively. However, the L- strand gene ND6 had a positive GC-skew value for both species (Table 3). Again it showed overall anti-G bias supporting earlier findings in fish mitogenomes [50,52,54]. However, unlike many authors who report strong anti-G bias on third codon positions, both O. andersonii and O. macrochir were observed to have the strong anti-G bias on the second codon position (O. andersonii = 10.0, O. macrochir = 9.9).

The adaptive radiation of African cichlids is unparalleled so far among the vertebrates. To understand the role of mitogenome protein coding genes in the evolution of these cichlid species we analysed the rate of non-synonymous (dN) and synonymous (dS) nucleotide substitutions in 13 protein coding genes of 20 species. These included; Riverine, Lake Victoria, Lake Tanganyika and Lake Malawi species (Sarotherodon melanotheron, Coptodon zillii, Oreochromis aureus, O. niloticus, O. niloticus GIFT, O. mossambicus, O. variabilis, O. andersonii, O. macrochir, O. esculentus, Oreochromis sp ‘red tilapia’, Petrochromis trewavasae, Tropheus duboisi, Astatotilapia calliptera, Cynotilapia afra, Maylandia zebra, Pundamilia nyererei, Tylochromis polylepis, Haplochromis burtoni, Lethrinops lethrinus). The mean value of dN and dN/dS was highest in ND6 gene and lowest in COIII gene for all the 13 protein coding genes (Fig 2). Our findings indicate that all protein coding genes evolved under purifying selection except for ND6 gene which had an elevated rate of dN/dS of 1.860 indicative of evolution under positive selection. This indicates that various functional genes evolved under natural selection while ND6 gene shows signs of evolution by mutation and genetic drift. Since mitochondrial genome is involved in the production of ATP which provides energy for cellular activities and other cellular processes, it is possible that geographical isolation may have affected the nucleotide substitutions in the mitochondrial protein coding genes. We can conclude that ND6 gene may have evolved more rapidly than any other protein coding gene among these African cichlids.

Download:

Fig 2. The rate of non-synonymous substitution (dS), rate of synonymous substitution (dN) and the ratio of dS and dN for each protein coding gene.

https://doi.org/10.1371/journal.pone.0203095.g002

The overall p-genetic distance was used to measure the conservation of the protein coding genes in the mitogenome of these 20 cichlid species. Calculations were performed on the 1^st and 2^nd, 3^rd and whole sequence codon positions. On the 1^st and 2^nd codon positions, the highest overall mean p-distance was on gene ND6 (0.1581) followed by ATPase 6 (0.1268) and least was gene COIII (0.0193). For the whole sequence, the highest overall p-distance was recorded in ATPase 6 (0.1389) followed by ND6 (0.1288) and ATPase 8 (0.0990) had the least value (Fig 3). Based on these results ND6 likely may have the highest evolutionary rate and COIII been the most conserved gene among the mitogenome protein coding genes of these cichlid species which could have radiated into many species due to geographical isolation [1].

Download:

Fig 3. Estimates of average evolutionary divergence over all sequence pairs of 20 cichlid species for each of the 13 protein coding genes calculated based on codon positions 1^st + 2^nd, 3^rd and full sequence.

https://doi.org/10.1371/journal.pone.0203095.g003

Evidence of positive selection, though not very common, has been observed in some fishes [55,56], in horses [57,58] and in insects [59]. Other studies have shown the important role the mitogenome plays in adapting to new environments as reviewed in Castellana et al. 2011 [60]. The spectacular radiations of the East African rift valley Lakes Malawi and Tanganyika, Lake Victoria and surrounding smaller lakes and rivers may have driven the fixations of mutations in the mitogenome in such a way that the mitochondrial functions are guaranteed. This adaptation of some genes in the mitogenome involved in energy production could perhaps be exploited in aquaculture. The use of indigenous or autochthonous species may prove advantageous because they may have been selected to adapt to local environmental conditions.

Ribosomal and transfer RNAs

The tRNA genes for both O. andersonii and O. macrochir possessed anti-codons that match the vertebrate mitochondrial code. The average length of the tRNAs for both species ranged between 66–74 bp while the total length was 1554 bp for both O. andersonii and O. macrochir. For both species the⁾ inferred secondary structures for all the 22 tRNAs, with exception of tRNA^Ser(GCT), folded into cloverleaf model. The common features of the secondary structures were: a 7 bp aminoacyl stem and anticodon loop, 5 bp TΨC and anticodon arms, and 4 bp DHU arm (S2 Fig). Similar results have been reported on South American catfish and Asian arowana [52,54]. However, non-complementary pairing and size variations in the secondary structures were observed in both species.

The two rRNAs for both species had a total length of 944 bp and 1694 bp which was within the range reported for vertebrate mitogenomes. The nucleotides percent compositions of rRNAs of O. andersonii (T = 20.5, C = 26.8, A = 32.3, G = 20.5) and O. macrochir (T = 20.4, C = 26.8, A = 32.4, G = 20.4) were very similar. They also showed a higher percentage of AT than GC pairs (52.7, 47.3 for O. andersonii; 52.8, 47.2 for O. macrochir) (Table 3)

Non-coding region

The mitochondrial non-coding region or control region of O. andersonii and O. macrochir was located between tRNA^pro and tRNA^phe typical for vertebrate mitogenomes. Its length was 925 bp for O. andersonii and 927 bp for O. macrochir. The nucleotide base composition was similar between the two species although more variable compared to other regions of the mitogenome (Table 3). The AT% (35.2:34.8, O. andersonii: O. macrochir) composition to GC% (64.8:65.2, O. andersonii: O. macrochir) was also more highly skewed towards AT compared to other regions of the mitogenome due to anti-G bias on the third codon position.

Oreochromis andersonii and O. macrochir control regions were aligned with four other species from the same genus to characterize the control region. Domain 1 consisted of a hypervariable region with a length of 281 bp for both species including a Termination -Associated Sequence (TAS) with motif- ATGCAT similar to a putative TAS of O. aureus [28]. Domain II or central conserved region was identified with three conservative sequence blocks (CSB) which are involved in heavy-H strand replication [61]. The first was CSB-F (ATGTAGTAAGAGCCCACC) followed by CSB-E (AAGGACAGTACTTGTGGGGGT) and then CBS-D (TATTCCTGGCATCTGGTTCCT) to complete domain II for both species. The third domain at the 3' end of the control region consisted of CBS-1 (O. andersonii—ATTACATAACTGATATCAAGAGCATA; O. macrochir- ACCACATAACTGATATCTAGAGCATA) and CBS-2 (AAACCCCCCCTACCCCC). The last conservative block observed was CBS-3 (TGCAAACCCCCCGGAAACAG) (Fig 4)

Download:

Fig 4. Different parts of the control region of O. andersonii and O. macrochir.

https://doi.org/10.1371/journal.pone.0203095.g004

Amino acid composition

For both O. andersonii and O. macrochir leucine, proline, serine, threonine, asparagine were the most frequently translated amino acids from the mitochondrial genome (Fig 5 and S3 Table). This is similar to the findings on other fish species [52,54]. The relative synonymous codon usage (RSCU) indicated that the most frequently used codon in the mitogenome of the two species was GCC for alanine with O. andersonii having an RSCU value of 1.74 while O. macrochir had 1.67. The second highest codon usage values were for serine (UCU) for O. andersonii having RSCU = 1.54 and Arginine (CGC) for O. macrochir having an RSCU = 1.58. RSCU values of 0.40 and 0.43 were observed to be the least for alanine (GCG) for O. andersonii and macrochir respectively.

Download:

Fig 5. Amino acid frequency in the complete mitogenome of O. andersonii and O. macrochir.

https://doi.org/10.1371/journal.pone.0203095.g005

Phylogenetic analysis

Phylogenetic analysis using 12 concatenated protein coding genes and another analysis using a mitochondrial locus ND2 from 29 cichlid species were used to examine the phylogenetic placement of O. andersonii and O. macrochir among the cichlids of Africa. The consensus tree separates the species into clear clades or tribes; Haplochromini, Coptodomini, Lamprologini, Tropheini, Oreochromini and Tylochromini. This is consistent with recent classifications of the haplotilapiine cichlids of Africa [62] (Figs 6 and S3). However, the 12 concatenated protein coding gene sequences grouped Coptodon zillii (Coptodoini) with species from the Oreochromini tribe rendering the clade paraphyletic (Fig 7). This may probably have been due to misidentification of C. zillii because the other species clearly separate into their clades or tribes. The close relationship of Sarotherodon melanotheron to Oreochromis species rather forming a monophyletic clade is not yet certain and has been questioned by some authors such as Klett and Meyer [63] and previous authors even suggested the need to redefine the genus [64,65].

Download:

Fig 6. A phylogenetic tree of African cichlids showing the relative positions of O. andersonii and O. macrochir based on protein-coding gene ND2.

The red letters ‘a’ to ‘z’ indicate the Bayesian posterior probability and maximum likelihood values for each node, while the asterisk ‘*’ indicate 100% value.

https://doi.org/10.1371/journal.pone.0203095.g006

Download:

Fig 7. The phylogenetic tree showing the position of O. andersonii and O. macrochir with 29 other cichlid species based on Bayesian posterior probabilities of 12 concatenated protein genes (without ND6).

All the node values not indicated recorded a 100% Bayesian posterior probability.

https://doi.org/10.1371/journal.pone.0203095.g007

The three Oreochromis species (O. macrochir, O. andersonii and O. mossambicus) from Southern Africa in this phylogenetic tree seem to have evolved later compared to the west and east African species. Data from the consensus tree in this study placed O. andersonii closely related to O. mossambicus (Figs 6 and 7). This is in agreement with other previous phylogenetic trees [21, 63]. The close relatedness of these two species though not sharing the same habitat may indicate that they may have had separated most recently. On the other hand, O. macrochir clusters with both O. mossambicus and O. andersonii indicative of a closer phylogenetic relationship among these species of Southern Africa.

Conclusion

This study has determined the complete mitochondrial DNA sequences of O. andersonii (16623 bp) and O. macrochir (16624 bp) and further characterization has confirmed their similarity to vertebrate mitochondrial DNA. Using Bayesian posterior probabilities and Maximum likelihood analysis of concatenated mitochondrial genome of 12 protein coding genes and ND2 gene, consensus trees have revealed a close phylogenetic relationship between O. andersonii and O. mossambicus. Further, O. macrochir was found to be closely related to both O. andersonii and O. mossambicus. The protein coding genes evolved under purifying selection except for ND6 which indicated evolution under positive selection. Gene ND6 likely may have the highest evolutionary rate and COIII been the most conserved gene. This may indicate that there was a high adaptation level at the ND6 gene in response to changing environments among these African cichlid species. More work is needed to characterize the southern Africa cichlids as they are important species especially for capture fisheries, aquaculture development and understanding biogeographic history of African cichlids.

Supporting information

S1 Fig. Mitogenome organisation of O. andersonii generated by MitoAnnotator.

The genes on the outer side of the circle are coded on the H-strand while those on the inner circle are coded with L-strand.

https://doi.org/10.1371/journal.pone.0203095.s001

(PDF)

S2 Fig.

Secondary structures of 22 tRNAs of mitochondrial genome of O. andersonii (A) and O. macrochir (B) generated by tRNAScan-SE 2.0

https://doi.org/10.1371/journal.pone.0203095.s002

(PDF)

S3 Fig. The phylogenetic tree showing the relative positions of O. andersonii and O. macrochir among 29 African cichlids based on Maximum Likelihood bootstrap consensus tree inferred from 1000 replicates of ND2 gene.

https://doi.org/10.1371/journal.pone.0203095.s003

(PDF)

S1 Table. Designed primers used for amplification and sequencing of complete mitogenome of O. andersonii and O. macrochir.

https://doi.org/10.1371/journal.pone.0203095.s004

(PDF)

S2 Table. Complete automated annotation of O. andersonii and O. macrochir mitochondrial genome.

https://doi.org/10.1371/journal.pone.0203095.s005

(PDF)

S3 Table. Codon usage of complete mitogenome sequences of Oreochromis andersonii (16642 bp) and O. macrochir (16644 bp).

https://doi.org/10.1371/journal.pone.0203095.s006

(PDF)

Acknowledgments

We thank the Department of Fisheries–Zambia staff for support during sample collection.

References

1. Brawand D, Wagner CE, Li YI, Malinsky M, Keller I, Fan S, et al. The genomic substrate for adaptive radiation in African cichlid fish. Nature. 2014; 513:375–381. pmid:25186727
- View Article
- PubMed/NCBI
- Google Scholar
2. Trewavas E. Tilapiine fishes of the Genera Sarotherodon, Oreochromis, and Danakilia. London: British Museum (Natural History); (1983).
3. Skelton P. Freshwater Fishes of Southern Africa. Second edition. South Africa: Struik Publishers (Pty) Ltd; 2001.
4. Froese R, Pauly D; 2016 [cited 2018 Jan 6]. Database: FishBase [Internet]. Available from: http://www.fishbase.org
5. Lind CE, Brummett RE, Ponzoni RW. Exploitation and conservation of fish genetic resources in Africa: issues and priorities for aquaculture development and research. Reviews in Aquaculture. 2012; 4:125–141.
- View Article
- Google Scholar
6. Tweddle D, Marshall BE; 2007. [cited 2017 Oct 23]. Database: Oreochromis andersonii. The IUCN Red List of Threatened Species [Internet]. Available from: https://doi.org/10.2305/IUCN.UK.2007.RLTS.T60623A12385801.en
7. Tweddle D, Peel RA, Weyl OLF. Challenges in fisheries management in the Zambezi, one of the great rivers of Africa. Fisheries Management and Ecology. 2015; 22:99–111.
- View Article
- Google Scholar
8. Canonico GC, Arthington A, McCrary JF, Thiem ML. The effects of introduced tilapias on native biodiversity. Aquatic Conserv: Mar Freshw Ecosyst. 2005; 15:463–483.
- View Article
- Google Scholar
9. Deines AM, Bbole I, Katongo C, Feder JL and Lodge DM. Hybridisation between native Oreochromis species and introduced Nile tilapia O. niloticus in the Kafue River, Zambia. Afr J Aquat Sci. 2014; 39:23–34.
- View Article
- Google Scholar
10. Bbole I, Katongo C, Deines AM, Shumba O, Lodge DM. Hybridization between non-indigenous Oreochromis niloticus and native Oreochromis species in the lower Kafue River and its potential impacts on fishery. J. Ecol. Nat. Environ. 2015; 6(6):215–225.
- View Article
- Google Scholar
11. Crayon-Thomas E. Background history on the research and use of Oreochromis niloticus in Zambia and their use on a private fish farm (Kalimba Farm) between 1985 and 1993. Technical Consultation on Species for Small Reservoir Fisheries and Aquaculture in Southern Africa. Livingstone, Zambia, 7–11 November 1994
12. Kefi AS, Kang’ombe J, Kassam D, Katongo C. Growth, reproduction and sex ratios in Oreochromis andersonii (Castelnau, 1861) fed with varying Levels of 17α-methyl testosterone. J Aquac Res Dev. 2012; 3:130–137.
- View Article
- Google Scholar
13. Musuka CG, Musonda FF. Current and future prospects of commercial fish farming in Zambia. Int J Bioflux Soc. 2012 5:79–87.
- View Article
- Google Scholar
14. Nsonga A. Indigenous fish species a panacea for cage aquaculture in Zambia: A case for Oreochromis macrochir (Boulenger, 1912) at Kambashi out-grower scheme. Int. j. fish. Aquat. 2014; 2(1):102–105.
- View Article
- Google Scholar
15. Kefi AS, Kang’ombe J, Kassam D, Katongo C. Optimal Dietary Plant Based Lipid on Growth of Oreochromis andersonii (Castelnau, 1861). Turk J Fish Aquat Sci. 2013; 13:503–508.
- View Article
- Google Scholar
16. Salzburger W, Meyer A, Baric S, Verheyen E, Sturmbauer C. Phylogeny of the Lake Tanganyika Cichlid Species Flock and Its Relationship to the Central and East African Haplochromine Cichlid Fish Faunas. Syst Biol. 2002; 51(1):113–135. pmid:11943095
- View Article
- PubMed/NCBI
- Google Scholar
17. Salzburger W, Meyer A. The species flocks of East African cichlid fishes: recent advances in molecular phylogenetics and population genetics. Naturwissenschaften. 2004; 91:277–290. pmid:15241604
- View Article
- PubMed/NCBI
- Google Scholar
18. Meyer BS, Matschiner M, Salzburger W. A tribal level phylogeny of Lake Tanganyika cichlid fishes based on a genomic multi-marker approach. Mol Phylogenet Evol. 2015; 83:56–71. pmid:25433288
- View Article
- PubMed/NCBI
- Google Scholar
19. Schwarzer J, Misof B, Tautz D, Schliewen U.K. The root of the East African cichlid radiations. BMC Evolutionary Biology. 2009; 9:186. pmid:19656365
- View Article
- PubMed/NCBI
- Google Scholar
20. Kocher TD, Lee W, Sobolewska H, Penman D, Andrew B. A genetic linkage map of a cichlid fish the tilapia (Oreochromis niloticus). Genetics. 1998; 148:1225–1232. pmid:9539437
- View Article
- PubMed/NCBI
- Google Scholar
21. Sodsuk PK, McAndrew BJ, Turner GF (1995) Evolutionary relationships of the Lake Malawi Oreochromis species: evidence from allozymes. J Fish Biol. 1995; 47:321–333.
- View Article
- Google Scholar
22. Feresu-Shonhiwa F, Howard JH. Electrophoretic identification and phylogenetic relationships of indigenous tilapiine species of Zimbabwe. J Fish Biol. 1998; 53:1178–1206.
- View Article
- Google Scholar
23. Katongo C, Koblmüller S, Duftner N, Makasa L, Sturmbauer C. Phylogeography and speciation in the Pseudocrenilabrus philander species complex in Zambian Rivers. Hydrobiologia. 2005; 542:221–233.
- View Article
- Google Scholar
24. D’Amato ME, Esterhuyse MM, Van der Waal BCW, Brink D, Volckaert FAM. Hybridization and Phylogeography of the Mozambique tilapia Oreochromis mossambicus in Southern Africa evidenced by mitochondrial and microsatellite DNA genotyping. Conserv. Genet. 2007; 8: 475–488.
- View Article
- Google Scholar
25. Katongo C, Koblmüller S, Duftner N, Mumba L, Sturmbauer C. Evolutionary history and biogeographic affinities of the Serranochromine cichlids in Zambian rivers. Mol. Phylogenetics Evol. 2007; 45:326–338. pmid:17400000
- View Article
- PubMed/NCBI
- Google Scholar
26. Egger B, Klaefiger Y, Indermaur A, et al. Phylogeographic and phenotypic assessment of a basal haplochromine cichlid fish from Lake Chila, Zambia. Hydrobiologia. 2015; 748: 171.
- View Article
- Google Scholar
27. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999; 41:95–98.
- View Article
- Google Scholar
28. He A, Luo Y, Yang H, Liu L, Li S, Wang C. Complete mitochondrial DNA sequences of the Nile tilapia (Oreochromis niloticus) and Blue tilapia (Oreochromis aureus): genome characterization and phylogeny applications. Mol Biol Rep. 2011; 38:2015–2021. pmid:20857213
- View Article
- PubMed/NCBI
- Google Scholar
29. Kinaro ZO, Xue L, Volatiana JA. Complete mitochondrial DNA sequences of the Victoria tilapia (Oreochromis variabilis) and Redbelly Tilapia (Tilapia zilli): genome characterization and phylogeny analysis. Mitochondrial DNA Part A. 2015; 27(4): 2455–2457.
- View Article
- Google Scholar
30. Lowe TM, Eddy SR. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucl Acids Res. 1997; 25:955–964. pmid:9023104
- View Article
- PubMed/NCBI
- Google Scholar
31. Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016; 33(7):1870–1874. https://doi.org/10.1093/molbev/msw054 pmid:27004904
- View Article
- PubMed/NCBI
- Google Scholar
32. Wyman SK, Jansen RK, Boore JL. Automatic annotation of organellar genomes with DOGMA. Bioinformatics. 2004; 20(17):3252–5. pmid:15180927
- View Article
- PubMed/NCBI
- Google Scholar
33. Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, et al. MITOS: improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol. 2013; 69(2):313–9. pmid:22982435
- View Article
- PubMed/NCBI
- Google Scholar
34. Iwasaki W, Fukunaga T, Isagozawa R, Yamada K, Maeda Y, Satoh TP, et al. MitoFish and MitoAnnotator: a mitochondrial genome database of fish with an accurate and automatic annotation pipeline. Mol Biol Evol. 2013; 30:2531–2540. pmid:23955518
- View Article
- PubMed/NCBI
- Google Scholar
35. Perna NT, Kocher TD. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J Mol Evol. 1995; 41:353–358. pmid:7563121
- View Article
- PubMed/NCBI
- Google Scholar
36. Miya M, Nishida M. The mitogenomic contributions to molecular phylogenetics and evolution of fishes: a 15- year retrospect. Ichthyol Res. 2015; 62:29–71.
- View Article
- Google Scholar
37. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004; 32:1792–1797. pmid:15034147
- View Article
- PubMed/NCBI
- Google Scholar
38. He A-Y, Tang S-J, Jiang Y-T, Li S-F, Wang C-H. Complete mitochondrial genome of blackchin tilapia Sarotherodon melanotheron (Perciformes, Cichlidae). Mitochondrial DNA. 2011; (5–6):171–3. pmid:22165831
- View Article
- PubMed/NCBI
- Google Scholar
39. Hulsey CD, Keck BP, Alamillo H, O’Meara BC. Mitochondrial genome primers for Lake Malawi cichlids. Molec Ecol Res. 2013b; 13:347–353.
- View Article
- Google Scholar
40. Azuma Y, Kumazawa Y, Miya M, Mabuchi K, Nishida M. Mitogenomic evaluation of the historical biogeography of cichlids toward reliable dating of teleostean divergences. BMC Evol Biol. 2008; 8:215. pmid:18651942
- View Article
- PubMed/NCBI
- Google Scholar
41. Hu XX, Lu J, He SY, Li XF, Liu HJ, Han LJ. The complete mitochondrial genome of Astatotilapia burtoni. Mitochondrial DNA. 2016; 27(4):2379–80. pmid:25962483
- View Article
- PubMed/NCBI
- Google Scholar
42. Chen L, Song X, Chen X, Dang X, Wang W. The complete mitochondrial genome of the Pundamilia nyererei (Perciformes, Cichlidae). Mitochondrial DNA. 2016; 27(5):3567–8. pmid:26260178
- View Article
- PubMed/NCBI
- Google Scholar
43. Qi DS, Zhang SC, Jiang J, Zhang LQ, Fu YY, Du ZM, et al. The complete mitochondrial genome of the Fossorochromis rostratus. Mitochondrial DNA. 2016; 27(6):4284–4285. pmid:26369669
- View Article
- PubMed/NCBI
- Google Scholar
44. Zhao J, Gao J. Complete mitochondrial genome of Aulonocara stuartgranti (Flavescent peacock cichlid). Mitochondrial DNA A DNA Mapp Seq Anal. 2017; 28(2):279–280. pmid:26713354
- View Article
- PubMed/NCBI
- Google Scholar
45. Mabuchi K, Miya M, Azuma Y, Nishida M. Independent evolution of the specialized pharyngeal jaw apparatus in cichlid and labrid fishes. BMC Evol Biol. 2007; 7:10. pmid:17263894
- View Article
- PubMed/NCBI
- Google Scholar
46. Fischer C, Koblmuller S, Gully C, Schlotterer C, Sturmbauer C, Thallinger GG. Complete mitochondrial DNA sequences of the threadfin cichlid (Petrochromis trewavasae) and the blunthead cichlid (Tropheus moorii) and patterns of mitochondrial genome evolution in cichlid fishes. PLoS One. 2013; 8(6):e67048. pmid:23826193
- View Article
- PubMed/NCBI
- Google Scholar
47. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003; 19:1572–1574. pmid:12912839
- View Article
- PubMed/NCBI
- Google Scholar
48. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 2018; 35:1547–1549 pmid:29722887
- View Article
- PubMed/NCBI
- Google Scholar
49. Sergei L, Kosakovsky P, Simon DWF, Spencer VM. HyPhy: hypothesis testing using phylogenies. Bioinformatics. 2005; 21:676–679. pmid:15509596
- View Article
- PubMed/NCBI
- Google Scholar
50. Liu Y, Cui Z. The complete mitochondrial genome sequence of the cutlassfish Trichiurus japonicas (Perciformes:Trichiuridae): Genome characterization and phylogenetic considerations. Mar Genomics. 2009; 2:133–142. pmid:21798182
- View Article
- PubMed/NCBI
- Google Scholar
51. Zhang X, Yue B, Jiang W, Song Z. The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications. Mol Biol Rep. 2009; 36:981–991. pmid:18496768
- View Article
- PubMed/NCBI
- Google Scholar
52. Villela LC, Alves AL, Varela ES, Yamagishi ME, Giachetto PF, da Silva NM, et al. Complete mitochondrial genome from South American catfish Pseudoplatystoma reticulatum (Eigenmann & Eigenmann) and its impact in Siluriformes phylogenetic tree. Genetica. 2017. 145:51–66. pmid:28160169
- View Article
- PubMed/NCBI
- Google Scholar
53. Wang C, Wang J, Yang J, Song X, Chen Q, Xu J, Yang Q, Li S. Complete mitogenome sequence of black carp (Mylopharyngodon piceus) and its use for molecular phylogeny of leuciscine fishes. Mol Biol Rep. 2012; 39:6337–6342. pmid:22350152
- View Article
- PubMed/NCBI
- Google Scholar
54. Yue GH, Liew WC, Orban L. The complete mitochondrial genome of a basal teleost, the Asian arowana (Scleropages formosus, Osteoglossidae). BMC Genomics. 2006; 7:242. pmid:16989663
- View Article
- PubMed/NCBI
- Google Scholar
55. Lv Y, Li Y, Ruan Z, et al. The Complete Mitochondrial Genome of Glyptothorax macromaculatus provides a Well-Resolved Molecular Phylogeny of the Chinese Sisorid Catfishes. Genes. 2018; 9:282. pmid:29867051
- View Article
- PubMed/NCBI
- Google Scholar
56. Li Y, Ren Z, Shedlock AM, et al. High altitude adaptation of the schizothoracine fishes (Cyprinidae) revealed by the mitochondrial genome analyses. Gene. 2013; 517: 169–178. pmid:23328645
- View Article
- PubMed/NCBI
- Google Scholar
57. Ning T, Xiao H, Li J, Hua S, Zhang YP. Adaptive evolution of the mitochondrial ND6 gene in the domestic horse. Genetics and Molecular Research. 2010; 9 (1): 144–150 pmid:20198570
- View Article
- PubMed/NCBI
- Google Scholar
58. Xu S, Luosang J, Hua S, He J, et al. High altitude adaptation and phylogenetic analysis of Tibetan horse based on the mitochondrial genome. J. Genet. Genomics. 2007; 34: 720–729. pmid:17707216
- View Article
- PubMed/NCBI
- Google Scholar
59. Bazin E, Glémin S, Galtier N. Population size does not influence mitochondrial genetic diversity in animals. New Phytol. 2006; 168(1):39–50.
- View Article
- Google Scholar
60. Castellana S, Vicario S, Saccone C. Evolutionary patterns of the Mitochondrial genome in Metazoa: Exploring the role of mutation and selection in mitochondrial protein-coding genes. Genome Biol. Evol. 2011; 3:1067–1079. pmid:21551352
- View Article
- PubMed/NCBI
- Google Scholar
61. Faber JE, Stepien CA. Tandemly repeated sequences in mitochondrial DNA control region and phylogeography of the Pike-Perches Stizostedion. Mol. Phylogenetics Evol. 1998; 10(3):310–322
- View Article
- Google Scholar
62. Dunz AR, Schliewen UK. Molecular phylogeny and revised classification of the haplotilapiine cichlid fishes formerly referred to as ‘‘Tilapia”. Molecular Phylogenetics and Evolution. 2013; 68:64–80. pmid:23542002
- View Article
- PubMed/NCBI
- Google Scholar
63. Klett V, Meyer A. What, if anything, is a Tilapia?—Mitochondrial ND2 phylogeny of tilapiines and the evolution of parental care systems in the African cichlid fishes. Mol.Biol.Evol. 2002; 19,865–883. pmid:12032243
- View Article
- PubMed/NCBI
- Google Scholar
64. Pouyaud L, Agnèse J-F. Phylogenetic relationships between 21 species of three tilapiine genera Tilapia, Sarotherodon and Oreochromis using allozyme data. Journal of Fish Biology. 1995; 47:26–38.
- View Article
- Google Scholar
65. Nagl S, Tichy H, Mayer WE, Samonte IE, McAnderw BJ, Klein J. Classification and phylogenetic relationships of African tilapiine fishes inferred from mitochondrial DNA sequences. Mol. Phylogenetics Evol. 2001; 20(3):361–374.
- View Article
- Google Scholar

[ref1] 1. Brawand D, Wagner CE, Li YI, Malinsky M, Keller I, Fan S, et al. The genomic substrate for adaptive radiation in African cichlid fish. Nature. 2014; 513:375–381. pmid:25186727
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Trewavas E. Tilapiine fishes of the Genera Sarotherodon, Oreochromis, and Danakilia. London: British Museum (Natural History); (1983).

[ref3] 3. Skelton P. Freshwater Fishes of Southern Africa. Second edition. South Africa: Struik Publishers (Pty) Ltd; 2001.

[ref4] 4. Froese R, Pauly D; 2016 [cited 2018 Jan 6]. Database: FishBase [Internet]. Available from: http://www.fishbase.org

[ref5] 5. Lind CE, Brummett RE, Ponzoni RW. Exploitation and conservation of fish genetic resources in Africa: issues and priorities for aquaculture development and research. Reviews in Aquaculture. 2012; 4:125–141.
View Article
Google Scholar

[9] View Article

[10] Google Scholar

[ref6] 6. Tweddle D, Marshall BE; 2007. [cited 2017 Oct 23]. Database: Oreochromis andersonii. The IUCN Red List of Threatened Species [Internet]. Available from: https://doi.org/10.2305/IUCN.UK.2007.RLTS.T60623A12385801.en

[ref7] 7. Tweddle D, Peel RA, Weyl OLF. Challenges in fisheries management in the Zambezi, one of the great rivers of Africa. Fisheries Management and Ecology. 2015; 22:99–111.
View Article
Google Scholar

[13] View Article

[14] Google Scholar

[ref8] 8. Canonico GC, Arthington A, McCrary JF, Thiem ML. The effects of introduced tilapias on native biodiversity. Aquatic Conserv: Mar Freshw Ecosyst. 2005; 15:463–483.
View Article
Google Scholar

[16] View Article

[17] Google Scholar

[ref9] 9. Deines AM, Bbole I, Katongo C, Feder JL and Lodge DM. Hybridisation between native Oreochromis species and introduced Nile tilapia O. niloticus in the Kafue River, Zambia. Afr J Aquat Sci. 2014; 39:23–34.
View Article
Google Scholar

[19] View Article

[20] Google Scholar

[ref10] 10. Bbole I, Katongo C, Deines AM, Shumba O, Lodge DM. Hybridization between non-indigenous Oreochromis niloticus and native Oreochromis species in the lower Kafue River and its potential impacts on fishery. J. Ecol. Nat. Environ. 2015; 6(6):215–225.
View Article
Google Scholar

[22] View Article

[23] Google Scholar

[ref11] 11. Crayon-Thomas E. Background history on the research and use of Oreochromis niloticus in Zambia and their use on a private fish farm (Kalimba Farm) between 1985 and 1993. Technical Consultation on Species for Small Reservoir Fisheries and Aquaculture in Southern Africa. Livingstone, Zambia, 7–11 November 1994

[ref12] 12. Kefi AS, Kang’ombe J, Kassam D, Katongo C. Growth, reproduction and sex ratios in Oreochromis andersonii (Castelnau, 1861) fed with varying Levels of 17α-methyl testosterone. J Aquac Res Dev. 2012; 3:130–137.
View Article
Google Scholar

[26] View Article

[27] Google Scholar

[ref13] 13. Musuka CG, Musonda FF. Current and future prospects of commercial fish farming in Zambia. Int J Bioflux Soc. 2012 5:79–87.
View Article
Google Scholar

[29] View Article

[30] Google Scholar

[ref14] 14. Nsonga A. Indigenous fish species a panacea for cage aquaculture in Zambia: A case for Oreochromis macrochir (Boulenger, 1912) at Kambashi out-grower scheme. Int. j. fish. Aquat. 2014; 2(1):102–105.
View Article
Google Scholar

[32] View Article

[33] Google Scholar

[ref15] 15. Kefi AS, Kang’ombe J, Kassam D, Katongo C. Optimal Dietary Plant Based Lipid on Growth of Oreochromis andersonii (Castelnau, 1861). Turk J Fish Aquat Sci. 2013; 13:503–508.
View Article
Google Scholar

[35] View Article

[36] Google Scholar

[ref16] 16. Salzburger W, Meyer A, Baric S, Verheyen E, Sturmbauer C. Phylogeny of the Lake Tanganyika Cichlid Species Flock and Its Relationship to the Central and East African Haplochromine Cichlid Fish Faunas. Syst Biol. 2002; 51(1):113–135. pmid:11943095
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref17] 17. Salzburger W, Meyer A. The species flocks of East African cichlid fishes: recent advances in molecular phylogenetics and population genetics. Naturwissenschaften. 2004; 91:277–290. pmid:15241604
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref18] 18. Meyer BS, Matschiner M, Salzburger W. A tribal level phylogeny of Lake Tanganyika cichlid fishes based on a genomic multi-marker approach. Mol Phylogenet Evol. 2015; 83:56–71. pmid:25433288
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref19] 19. Schwarzer J, Misof B, Tautz D, Schliewen U.K. The root of the East African cichlid radiations. BMC Evolutionary Biology. 2009; 9:186. pmid:19656365
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref20] 20. Kocher TD, Lee W, Sobolewska H, Penman D, Andrew B. A genetic linkage map of a cichlid fish the tilapia (Oreochromis niloticus). Genetics. 1998; 148:1225–1232. pmid:9539437
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref21] 21. Sodsuk PK, McAndrew BJ, Turner GF (1995) Evolutionary relationships of the Lake Malawi Oreochromis species: evidence from allozymes. J Fish Biol. 1995; 47:321–333.
View Article
Google Scholar

[58] View Article

[59] Google Scholar

[ref22] 22. Feresu-Shonhiwa F, Howard JH. Electrophoretic identification and phylogenetic relationships of indigenous tilapiine species of Zimbabwe. J Fish Biol. 1998; 53:1178–1206.
View Article
Google Scholar

[61] View Article

[62] Google Scholar

[ref23] 23. Katongo C, Koblmüller S, Duftner N, Makasa L, Sturmbauer C. Phylogeography and speciation in the Pseudocrenilabrus philander species complex in Zambian Rivers. Hydrobiologia. 2005; 542:221–233.
View Article
Google Scholar

[64] View Article

[65] Google Scholar

[ref24] 24. D’Amato ME, Esterhuyse MM, Van der Waal BCW, Brink D, Volckaert FAM. Hybridization and Phylogeography of the Mozambique tilapia Oreochromis mossambicus in Southern Africa evidenced by mitochondrial and microsatellite DNA genotyping. Conserv. Genet. 2007; 8: 475–488.
View Article
Google Scholar

[67] View Article

[68] Google Scholar

[ref25] 25. Katongo C, Koblmüller S, Duftner N, Mumba L, Sturmbauer C. Evolutionary history and biogeographic affinities of the Serranochromine cichlids in Zambian rivers. Mol. Phylogenetics Evol. 2007; 45:326–338. pmid:17400000
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref26] 26. Egger B, Klaefiger Y, Indermaur A, et al. Phylogeographic and phenotypic assessment of a basal haplochromine cichlid fish from Lake Chila, Zambia. Hydrobiologia. 2015; 748: 171.
View Article
Google Scholar

[74] View Article

[75] Google Scholar

[ref27] 27. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999; 41:95–98.
View Article
Google Scholar

[77] View Article

[78] Google Scholar

[ref28] 28. He A, Luo Y, Yang H, Liu L, Li S, Wang C. Complete mitochondrial DNA sequences of the Nile tilapia (Oreochromis niloticus) and Blue tilapia (Oreochromis aureus): genome characterization and phylogeny applications. Mol Biol Rep. 2011; 38:2015–2021. pmid:20857213
View Article
PubMed/NCBI
Google Scholar

[80] View Article

[81] PubMed/NCBI

[82] Google Scholar

[ref29] 29. Kinaro ZO, Xue L, Volatiana JA. Complete mitochondrial DNA sequences of the Victoria tilapia (Oreochromis variabilis) and Redbelly Tilapia (Tilapia zilli): genome characterization and phylogeny analysis. Mitochondrial DNA Part A. 2015; 27(4): 2455–2457.
View Article
Google Scholar

[84] View Article

[85] Google Scholar

[ref30] 30. Lowe TM, Eddy SR. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucl Acids Res. 1997; 25:955–964. pmid:9023104
View Article
PubMed/NCBI
Google Scholar

[87] View Article

[88] PubMed/NCBI

[89] Google Scholar

[ref31] 31. Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016; 33(7):1870–1874. https://doi.org/10.1093/molbev/msw054 pmid:27004904
View Article
PubMed/NCBI
Google Scholar

[91] View Article

[92] PubMed/NCBI

[93] Google Scholar

[ref32] 32. Wyman SK, Jansen RK, Boore JL. Automatic annotation of organellar genomes with DOGMA. Bioinformatics. 2004; 20(17):3252–5. pmid:15180927
View Article
PubMed/NCBI
Google Scholar

[95] View Article

[96] PubMed/NCBI

[97] Google Scholar

[ref33] 33. Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, et al. MITOS: improved de novo metazoan mitochondrial genome annotation. Mol Phylogenet Evol. 2013; 69(2):313–9. pmid:22982435
View Article
PubMed/NCBI
Google Scholar

[99] View Article

[100] PubMed/NCBI

[101] Google Scholar

[ref34] 34. Iwasaki W, Fukunaga T, Isagozawa R, Yamada K, Maeda Y, Satoh TP, et al. MitoFish and MitoAnnotator: a mitochondrial genome database of fish with an accurate and automatic annotation pipeline. Mol Biol Evol. 2013; 30:2531–2540. pmid:23955518
View Article
PubMed/NCBI
Google Scholar

[103] View Article

[104] PubMed/NCBI

[105] Google Scholar

[ref35] 35. Perna NT, Kocher TD. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J Mol Evol. 1995; 41:353–358. pmid:7563121
View Article
PubMed/NCBI
Google Scholar

[107] View Article

[108] PubMed/NCBI

[109] Google Scholar

[ref36] 36. Miya M, Nishida M. The mitogenomic contributions to molecular phylogenetics and evolution of fishes: a 15- year retrospect. Ichthyol Res. 2015; 62:29–71.
View Article
Google Scholar

[111] View Article

[112] Google Scholar

[ref37] 37. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004; 32:1792–1797. pmid:15034147
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref38] 38. He A-Y, Tang S-J, Jiang Y-T, Li S-F, Wang C-H. Complete mitochondrial genome of blackchin tilapia Sarotherodon melanotheron (Perciformes, Cichlidae). Mitochondrial DNA. 2011; (5–6):171–3. pmid:22165831
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref39] 39. Hulsey CD, Keck BP, Alamillo H, O’Meara BC. Mitochondrial genome primers for Lake Malawi cichlids. Molec Ecol Res. 2013b; 13:347–353.
View Article
Google Scholar

[122] View Article

[123] Google Scholar

[ref40] 40. Azuma Y, Kumazawa Y, Miya M, Mabuchi K, Nishida M. Mitogenomic evaluation of the historical biogeography of cichlids toward reliable dating of teleostean divergences. BMC Evol Biol. 2008; 8:215. pmid:18651942
View Article
PubMed/NCBI
Google Scholar

[125] View Article

[126] PubMed/NCBI

[127] Google Scholar

[ref41] 41. Hu XX, Lu J, He SY, Li XF, Liu HJ, Han LJ. The complete mitochondrial genome of Astatotilapia burtoni. Mitochondrial DNA. 2016; 27(4):2379–80. pmid:25962483
View Article
PubMed/NCBI
Google Scholar

[129] View Article

[130] PubMed/NCBI

[131] Google Scholar

[ref42] 42. Chen L, Song X, Chen X, Dang X, Wang W. The complete mitochondrial genome of the Pundamilia nyererei (Perciformes, Cichlidae). Mitochondrial DNA. 2016; 27(5):3567–8. pmid:26260178
View Article
PubMed/NCBI
Google Scholar

[133] View Article

[134] PubMed/NCBI

[135] Google Scholar

[ref43] 43. Qi DS, Zhang SC, Jiang J, Zhang LQ, Fu YY, Du ZM, et al. The complete mitochondrial genome of the Fossorochromis rostratus. Mitochondrial DNA. 2016; 27(6):4284–4285. pmid:26369669
View Article
PubMed/NCBI
Google Scholar

[137] View Article

[138] PubMed/NCBI

[139] Google Scholar

[ref44] 44. Zhao J, Gao J. Complete mitochondrial genome of Aulonocara stuartgranti (Flavescent peacock cichlid). Mitochondrial DNA A DNA Mapp Seq Anal. 2017; 28(2):279–280. pmid:26713354
View Article
PubMed/NCBI
Google Scholar

[141] View Article

[142] PubMed/NCBI

[143] Google Scholar

[ref45] 45. Mabuchi K, Miya M, Azuma Y, Nishida M. Independent evolution of the specialized pharyngeal jaw apparatus in cichlid and labrid fishes. BMC Evol Biol. 2007; 7:10. pmid:17263894
View Article
PubMed/NCBI
Google Scholar

[145] View Article

[146] PubMed/NCBI

[147] Google Scholar

[ref46] 46. Fischer C, Koblmuller S, Gully C, Schlotterer C, Sturmbauer C, Thallinger GG. Complete mitochondrial DNA sequences of the threadfin cichlid (Petrochromis trewavasae) and the blunthead cichlid (Tropheus moorii) and patterns of mitochondrial genome evolution in cichlid fishes. PLoS One. 2013; 8(6):e67048. pmid:23826193
View Article
PubMed/NCBI
Google Scholar

[149] View Article

[150] PubMed/NCBI

[151] Google Scholar

[ref47] 47. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003; 19:1572–1574. pmid:12912839
View Article
PubMed/NCBI
Google Scholar

[153] View Article

[154] PubMed/NCBI

[155] Google Scholar

[ref48] 48. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 2018; 35:1547–1549 pmid:29722887
View Article
PubMed/NCBI
Google Scholar

[157] View Article

[158] PubMed/NCBI

[159] Google Scholar

[ref49] 49. Sergei L, Kosakovsky P, Simon DWF, Spencer VM. HyPhy: hypothesis testing using phylogenies. Bioinformatics. 2005; 21:676–679. pmid:15509596
View Article
PubMed/NCBI
Google Scholar

[161] View Article

[162] PubMed/NCBI

[163] Google Scholar

[ref50] 50. Liu Y, Cui Z. The complete mitochondrial genome sequence of the cutlassfish Trichiurus japonicas (Perciformes:Trichiuridae): Genome characterization and phylogenetic considerations. Mar Genomics. 2009; 2:133–142. pmid:21798182
View Article
PubMed/NCBI
Google Scholar

[165] View Article

[166] PubMed/NCBI

[167] Google Scholar

[ref51] 51. Zhang X, Yue B, Jiang W, Song Z. The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications. Mol Biol Rep. 2009; 36:981–991. pmid:18496768
View Article
PubMed/NCBI
Google Scholar

[169] View Article

[170] PubMed/NCBI

[171] Google Scholar

[ref52] 52. Villela LC, Alves AL, Varela ES, Yamagishi ME, Giachetto PF, da Silva NM, et al. Complete mitochondrial genome from South American catfish Pseudoplatystoma reticulatum (Eigenmann & Eigenmann) and its impact in Siluriformes phylogenetic tree. Genetica. 2017. 145:51–66. pmid:28160169
View Article
PubMed/NCBI
Google Scholar

[173] View Article

[174] PubMed/NCBI

[175] Google Scholar

[ref53] 53. Wang C, Wang J, Yang J, Song X, Chen Q, Xu J, Yang Q, Li S. Complete mitogenome sequence of black carp (Mylopharyngodon piceus) and its use for molecular phylogeny of leuciscine fishes. Mol Biol Rep. 2012; 39:6337–6342. pmid:22350152
View Article
PubMed/NCBI
Google Scholar

[177] View Article

[178] PubMed/NCBI

[179] Google Scholar

[ref54] 54. Yue GH, Liew WC, Orban L. The complete mitochondrial genome of a basal teleost, the Asian arowana (Scleropages formosus, Osteoglossidae). BMC Genomics. 2006; 7:242. pmid:16989663
View Article
PubMed/NCBI
Google Scholar

[181] View Article

[182] PubMed/NCBI

[183] Google Scholar

[ref55] 55. Lv Y, Li Y, Ruan Z, et al. The Complete Mitochondrial Genome of Glyptothorax macromaculatus provides a Well-Resolved Molecular Phylogeny of the Chinese Sisorid Catfishes. Genes. 2018; 9:282. pmid:29867051
View Article
PubMed/NCBI
Google Scholar

[185] View Article

[186] PubMed/NCBI

[187] Google Scholar

[ref56] 56. Li Y, Ren Z, Shedlock AM, et al. High altitude adaptation of the schizothoracine fishes (Cyprinidae) revealed by the mitochondrial genome analyses. Gene. 2013; 517: 169–178. pmid:23328645
View Article
PubMed/NCBI
Google Scholar

[189] View Article

[190] PubMed/NCBI

[191] Google Scholar

[ref57] 57. Ning T, Xiao H, Li J, Hua S, Zhang YP. Adaptive evolution of the mitochondrial ND6 gene in the domestic horse. Genetics and Molecular Research. 2010; 9 (1): 144–150 pmid:20198570
View Article
PubMed/NCBI
Google Scholar

[193] View Article

[194] PubMed/NCBI

[195] Google Scholar

[ref58] 58. Xu S, Luosang J, Hua S, He J, et al. High altitude adaptation and phylogenetic analysis of Tibetan horse based on the mitochondrial genome. J. Genet. Genomics. 2007; 34: 720–729. pmid:17707216
View Article
PubMed/NCBI
Google Scholar

[197] View Article

[198] PubMed/NCBI

[199] Google Scholar

[ref59] 59. Bazin E, Glémin S, Galtier N. Population size does not influence mitochondrial genetic diversity in animals. New Phytol. 2006; 168(1):39–50.
View Article
Google Scholar

[201] View Article

[202] Google Scholar

[ref60] 60. Castellana S, Vicario S, Saccone C. Evolutionary patterns of the Mitochondrial genome in Metazoa: Exploring the role of mutation and selection in mitochondrial protein-coding genes. Genome Biol. Evol. 2011; 3:1067–1079. pmid:21551352
View Article
PubMed/NCBI
Google Scholar

[204] View Article

[205] PubMed/NCBI

[206] Google Scholar

[ref61] 61. Faber JE, Stepien CA. Tandemly repeated sequences in mitochondrial DNA control region and phylogeography of the Pike-Perches Stizostedion. Mol. Phylogenetics Evol. 1998; 10(3):310–322
View Article
Google Scholar

[208] View Article

[209] Google Scholar

[ref62] 62. Dunz AR, Schliewen UK. Molecular phylogeny and revised classification of the haplotilapiine cichlid fishes formerly referred to as ‘‘Tilapia”. Molecular Phylogenetics and Evolution. 2013; 68:64–80. pmid:23542002
View Article
PubMed/NCBI
Google Scholar

[211] View Article

[212] PubMed/NCBI

[213] Google Scholar

[ref63] 63. Klett V, Meyer A. What, if anything, is a Tilapia?—Mitochondrial ND2 phylogeny of tilapiines and the evolution of parental care systems in the African cichlid fishes. Mol.Biol.Evol. 2002; 19,865–883. pmid:12032243
View Article
PubMed/NCBI
Google Scholar

[215] View Article

[216] PubMed/NCBI

[217] Google Scholar

[ref64] 64. Pouyaud L, Agnèse J-F. Phylogenetic relationships between 21 species of three tilapiine genera Tilapia, Sarotherodon and Oreochromis using allozyme data. Journal of Fish Biology. 1995; 47:26–38.
View Article
Google Scholar

[219] View Article

[220] Google Scholar

[ref65] 65. Nagl S, Tichy H, Mayer WE, Samonte IE, McAnderw BJ, Klein J. Classification and phylogenetic relationships of African tilapiine fishes inferred from mitochondrial DNA sequences. Mol. Phylogenetics Evol. 2001; 20(3):361–374.
View Article
Google Scholar

[222] View Article

[223] Google Scholar

Figures

Abstract

Introduction

Materials and methods

Sample collection and DNA extraction

PCR amplification and sequencing

Sequence editing, alignment and annotation

Phylogenetic analysis

Relative rate of protein coding gene evolution

Results and discussion

Mitogenome annotation

Mitogenome organization

Protein coding genes

Ribosomal and transfer RNAs

Non-coding region

Amino acid composition

Phylogenetic analysis

Conclusion

Supporting information

S1 Fig. Mitogenome organisation of O. andersonii generated by MitoAnnotator.

S2 Fig.

S3 Fig. The phylogenetic tree showing the relative positions of O. andersonii and O. macrochir among 29 African cichlids based on Maximum Likelihood bootstrap consensus tree inferred from 1000 replicates of ND2 gene.

S1 Table. Designed primers used for amplification and sequencing of complete mitogenome of O. andersonii and O. macrochir.

S2 Table. Complete automated annotation of O. andersonii and O. macrochir mitochondrial genome.

S3 Table. Codon usage of complete mitogenome sequences of Oreochromis andersonii (16642 bp) and O. macrochir (16644 bp).

Acknowledgments

References