Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Genomic and phenotypic characteristics of Swedish C. jejuni water isolates

  • Anna Nilsson,

    Roles Conceptualization, Data curation, Formal analysis, Writing – original draft, Writing – review & editing

    Affiliation Department of Medical Sciences, Clinical Microbiology, Uppsala University, Uppsala, Sweden

    ⨯
  • Cecilia Johansson,

    Roles Conceptualization, Data curation, Formal analysis, Writing – original draft, Writing – review & editing

    Affiliation Department of Medical Sciences, Clinical Microbiology, Uppsala University, Uppsala, Sweden

    ⨯
  • Astrid Skarp,

    Roles Conceptualization, Writing – review & editing

    Current address: Astrid Skarp, School of Engineering and Applied Science, Biology and Medical Laboratory Research, Rotterdam University of Applied Sciences, Rotterdam, the Netherlands

    Affiliation Department of Medical Sciences, Clinical Microbiology, Uppsala University, Uppsala, Sweden

    ⨯
  • René Kaden,

    Roles Data curation, Formal analysis, Writing – review & editing

    Affiliation Department of Medical Sciences, Clinical Microbiology, Uppsala University, Uppsala, Sweden

    ⨯
  • Lars Engstrand,

    Roles Data curation, Methodology, Resources, Writing – review & editing

    Affiliation Department of Microbiology, Tumor and Cell Biology, Karolinska Institute, and Science for Life Laboratory, Stockholm, Sweden

    ⨯
  • Hilpi Rautelin

    Roles Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing

    hilpi.rautelin@medsci.uu.se

    Affiliation Department of Medical Sciences, Clinical Microbiology, Uppsala University, Uppsala, Sweden

    ⨯

Abstract

Campylobacter jejuni is the most common cause of bacterial gastroenteritis. Major reservoirs are warm-blooded animals, poultry in particular, but Campylobacter can also be transmitted via water. In this paper, we have taken a closer look at the biology and potential virulence of C. jejuni water isolates. Seven C. jejuni isolates from incoming surface water at water plants in Sweden were characterized with whole genome sequencing and phenotypical testing. Multi locus sequence typing analysis revealed that these isolates belonged to groups known to include both common (ST48CC) and uncommon (ST1275CC, ST683, ST793 and ST8853) human pathogens. Further genomic characterization revealed that these isolates had potential for arsenic resistance (due to presence of arsB gene in all isolates), an anaerobic dimethyl sulfoxide oxidoreductase (in three isolates) and lacked the MarR-type transcriptional regulator gene rrpB (in all but one isolate) earlier shown to be involved in better survival under oxidative and aerobic stress. As putative virulence factors were concerned, there were differences between the water isolates in the presence of genes coding for cytolethal distending toxin (cdtABC), Type VI secretion system and sialylated LOS, as well as in biofilm formation. However, all isolates were motile and could adhere to and invade the human HT-29 colon cancer cell line in vitro and induce IL-8 secretion suggesting potential to infect humans. This is, to the best of our knowledge, the first study where C. jejuni water isolates have been characterized using whole genome sequencing and phenotypical assays. We found differences and shared traits among the isolates but also potential to infect humans.

Citation: Nilsson A, Johansson C, Skarp A, Kaden R, Engstrand L, Rautelin H (2017) Genomic and phenotypic characteristics of Swedish C. jejuni water isolates. PLoS ONE 12(12): e0189222. https://doi.org/10.1371/journal.pone.0189222

Editor: Patrick Jon Biggs, Massey University, NEW ZEALAND

Received: June 9, 2017; Accepted: November 21, 2017; Published: December 7, 2017

Copyright: © 2017 Nilsson et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: This work was supported by the Swedish Research Council FORMAS www.formas.se (grant 221-2012-1442) (HR). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Campylobacter is the most common cause of bacterial gastroenteritis in most parts of the world and C. jejuni is the predominant pathogen [1]. Warm-blooded animals, such as poultry, pigs and ruminants are major reservoirs for Campylobacter and the bacteria are thought to be mainly transmitted via handling and eating raw or undercooked meat [2,3]. Campylobacter can also be transmitted via environmental pathways, such as water, and waterborne outbreaks of Campylobacter are not uncommon [4–7]. In the Nordic countries, groundwater for drinking water is usually not treated and reports from Finland describe Campylobacter outbreaks where heavy rain has led to contamination of groundwater wells [6,7]. It has also been shown that cattle drinking untreated water from lakes or private water supplies are more likely to test positive for Campylobacter [8,9]. Studies have shown C. jejuni water survival time at a low temperature to vary between two weeks and four months [10–13] and strains isolated from different sources have been noted to show different survival potentials [13–15]. These inter-strain differences have been suggested to be caused by variations in genetic content [12], however, whole genome sequencing has rarely been used to study waterborne C. jejuni.

The population structure of C. jejuni is highly diverse and described using Multi Locus Sequence Typing (MLST). To date there are almost 9000 STs, divided into several clonal complexes (CCs; http://pubmlst.org/campylobacter/, last accessed 22 May 2017). The CCs of C. jejuni can be considered to consist of generalists when able to colonize various hosts or specialists if host- or niche-specific [16].

C. jejuni are fastidious bacteria needing a microaerobic environment for survival and growth, which optimally occurs at 42°C. However, C. jejuni have been isolated from environmental sources where neither the atmosphere nor the temperature have been optimal [11–13]. For survival in the environment, bacteria can use strategies such as biofilm formation and motility [17,18]. By forming biofilm, bacteria can provide themselves with a protective environment under harsh conditions and also allow for dispersal of the bacteria. Motility has been shown to be important for biofilm formation and the ability to form biofilm has been noted to vary between different lineages of C. jejuni [19–21].

To study the potential of Campylobacter to cause human infections, in vitro infection models with human epithelial cell lines are frequently used to determine adherence, invasion and downstream cellular responses. Several studies have demonstrated differences between C. jejuni strains in the ability to adhere to and invade cell lines in vitro and it has been suggested that C. jejuni strains causing more severe symptoms also adhere to and invade cells in vitro at a higher grade than strains causing milder symptoms [22]. However, other studies have shown that both C. jejuni strains causing mild and those causing severe human infections adhere to and invade cell lines in vitro to a similar extent [23]. C. jejuni have also been shown to be capable of inducing downstream cell responses such as interleukin 8 (IL-8) secretion [24,25], an early signal for acute inflammatory response to bacterial infection [24]. The IL-8 response caused by C. jejuni has been suggested to be correlated to the capability of the strains to adhere and invade [24].

In this study, we characterized C. jejuni water isolates using a genotypic and phenotypic approach in order to determine features important for water survival and to reveal the potential of the isolates to infect human cells. For these purposes, whole genome sequencing, phenotypic analyses for motility and biofilm formation and an in vitro infection model were used.

Material and methods

Bacterial isolates

Seven Campylobacter isolates collected by the National Food Agency in 2000 from raw (incoming) surface water at water plants in Sweden were characterized in this study (Table 1). The isolates were identified as C. jejuni using MALDI-TOF Biotyping (Microflex, Bruker, Billerica, Massachusetts, US). In addition, the earlier characterized clinical strains C. coli 76339 [26] and C. jejuni 76577 [19] and the C. jejuni reference strains NCTC 11168 and 81–176 were used as experimental controls.

thumbnail
Download:
Table 1. Water sample collection information and genetic description for the C. jejuni water isolates.

https://doi.org/10.1371/journal.pone.0189222.t001

Genomics

The isolates were cultured for 24-48h on blood agar (Columbia agar plates supplemented with 5% horse blood; Oxoid, Basingstoke, UK) in a microaerobic atmosphere (Campygen, Oxoid) at 42°C. The DNA was extracted from bacterial cultures using MagNa Pure Compact Nucleic Acid isolation kit I (Roche, Penzberg, Germany) according to manufacturer´s protocol version 12. The isolates were whole genome sequenced with an Illumina HiSeq 2500 platform with a 2 x 300 paired end run. For assembly of the reads into contigs, Geneious (version 8.1.5.) [27] with the Mira plugin (version 1.0.1.) was used and merged contigs were assembled with Geneious. The assembled sequences were annotated by RAST [28] and the translated coding sequences (tCDS) were extracted. To determine orthologues clusters, a reciprocal blastp query was performed using an E-value of 10−5 and the OrthAgogue [29] and MCL-edge tools [30].

Plasmids were assembled from the raw sequence reads with Geneious de novo assembler version 8.1.9 [27].

PCR.

The lipooligosaccharide (LOS) locus class was determined with PCR as previously described [25] using primers described by Parker et al [31]. For the isolates that remained unassigned to a LOS locus class after PCR typing a manual search for previously sequenced LOS locus classes [32] was perfomed.

Real-time qPCR for cdtA, B, C and 16S rRNA was performed in the BioRad CFX96 Touch cycler using the DyNAmo HS SYBR Green qPCR kit (Thermo Scientific). The 16S rRNA primers have been previously described [33]. Primers for cdt genes were GGCGATGCTAGAGTTTGGC and GAACCGCTGTATTGCTCATAGG (cdtA), CGCGTTGATGTAGGAGCTAA and GCTCCTACATCTGTTCCTCCA (cdtB), and CAACAACTTCAGCTGTGCAAA and GGGGTAGCAGCTGTTAAAGGT (cdtC).

Phenotyping.

All phenotypic experiments described below were performed in duplicate and repeated at least three times for each strain.

Biofilm.

The isolates were tested for biofilm formation as previously described by Revez et al. [19] with minor modifications. A bacterial suspension with a concentration of 4 x 106 CFU/ml was prepared by harvesting bacteria from blood agar and resuspending in PBS. Of the bacterial suspension, 10 μl was added to Brucella broth (Becton, Dickinson and Company, Franklin Lakes, New Jersey, US) in glass tubes and incubated at 37°C in a microaerobic environment for 48 h. After carefully removing the broth, the tubes were stained with 1% crystal violet solution. The isolates were identified as positive if a stained band was seen at the air-liquid interface. The C. jejuni strain 76577, previously identified as positive for biofilm formation [19], was used as a positive control and broth without addition of bacteria was used as a negative control.

Motility.

The motility of the isolates was tested according to Szymanski et al. [34], with minor modifications. The isolates were cultured in Brucella broth at 42°C in a microaerobic atmosphere for 17–18 h. The bacteria were centrifuged at 8000 x g for 5 min, the supernatant removed and the pellets resuspended in PBS to a concentration of approximately 108 CFU/ml. Of the bacterial suspension, 5 μl was stabbed into a Brucella soft agar plate (0.4%) and swarming zones were measured after incubation at 42°C in a microaerobic atmosphere for 48 h. The clinical C. coli clade 3 strain 76339 was included for comparison.

Adhesion/invasion assay.

The HT-29 human colon cancer cell line (ECACC 91072201) was maintained in RPMI 1640 media (Gibco by life technologies, Carlsbad, California, US) supplemented with 2 mM glutamine (Swedish National Veterinary Institute, Uppsala, Sweden), 10% Fetal bovine serum (FBS, Gibco by Life Technologies), 100 U/ml penicillin and 100 μg/ml streptomycin (Swedish National Veterinary Institute). Overnight bacterial cultures were centrifuged, diluted in cell culture media and added to low passage HT-29 cells grown in RPMI 1640 supplemented with 1% FBS at a MOI of 100. At indicated time points, media was collected for IL-8 ELISA. For adhesion/invasion assays, cells were washed four times in PBS to remove non-adhered bacteria and lysed in 20 mM Tris, pH 7.5, 150 mM NaCl and 0.15% Triton X-100. The lysate was diluted 10 and 100 times for qPCR analysis of the 16S rRNA gene together with 10 000 times-diluted starting cultures to determine the adhesion/invasion percentage.

IL-8 ELISA.

The IL-8 levels in the media were measured using the IL-8 ELISA Kit (Thermo Fisher Scientific, Waltham, Massachusetts, US) according to the manufacturer’s instructions. Media was diluted four to ten times prior to the assay. A standard of known concentration (included in the kit) was used to assess variations between infections. Results are expressed as fold increase over uninfected (mock) cells.

Results

Genomics

Seven C. jejuni isolates, collected from incoming water at water surface plants in Sweden, were whole genome sequenced (Table 1). Analysis of MLST identified ST for six of the seven isolates; ST48 (three isolates), ST637 (one isolate), ST683 (one isolate) and ST793 (one isolate), respectively. One isolate was submitted to PubMLST and assigned to the new ST8853. The ST48 isolates belonged to the ST48CC, the ST637 to ST1275CC, and the remaining three isolates were unassigned to any CC at the time of the analysis (Table 1).

To identify traits involved in virulence and survival of C. jejuni water isolates, the genomes were clustered into orthologue groups and annotated in RAST. Annotations of groups not shared by all C. jejuni water isolates, but shared by isolates from more than one ST, were manually analyzed (S1 Table). The genomes were also manually searched for genes known to be involved in specific traits of interest, such as virulence and motility.

A previously described [35] arsenic resistance gene cluster consisting of four genes (arsP, arsR, arsC and acr3) was found in the isolate VA33 (ST683) and in the three ST48 isolates. However, the gene coding for the membrane transporter arsP [36] was fragmented in all the four isolates and the gene coding for the efflux pump protein Acr3 was disrupted by a premature stop codon in the ST48 isolates (Table 2). The arsP gene was also identified in VA12 (ST1275CC, Table 2). The arsB gene, which is also coding for an efflux pump for arsenic [37], but not included in the gene cluster mentioned above, was detected among all of the water isolates studied (Table 2).

thumbnail
Download:
Table 2. LOS locus classes and putative virulence factors detected among the C. jejuni water isolates.

https://doi.org/10.1371/journal.pone.0189222.t002

An intact gene cluster, previously described in the C. jejuni strain 81–176 [38] as coding for an anaerobic DMSO-reductase (dmsABC), was detected in isolates VA12 (ST1275CC), VA33 (ST683) and VA48 (ST793) (Table 2). The dmsA was also identified in VA49 (ST8853), but both dmsB and dmsC were disrupted. The MarR-type transcriptional regulator gene rrpA (regulator of the response to peroxide, Cj1546 in NCTC 11168) was found in all of the C. jejuni water isolates, however, rrpB (Cj1556 in NCTC 11168) was only identified in one isolate (ST1275CC; Table 2).

In three isolates, VA12 (ST1275), VA48 (ST793) and VA49 (ST8853), an intact Type VI secretion system (T6SS) gene cluster was identified (Table 2).

Intact cdtABC genes coding for cytolethal distending toxin (CDT) were found in the C. jejuni ST48 water isolates and in the isolate VA33 (ST683, Table 2), which was also verified with PCR (data not shown). The putative virulence genes ciaB, pldA, cadF and ceuE were identified in the genomes of all isolates, with only minor sequence variations in the predicted amino acid sequences (data not shown).

Most of the major flagellar motility genes, such as fla, flg, fli, motA and motB, were present in all C. jejuni water isolates. For VA12 (ST1275CC), VA33 (ST683), VA48 (ST793) and VA49 (ST8853), deletions and insertions were detected in the nucleotide sequences of the flaA, flaB, flaG and flgL genes when compared to the corresponding gene sequences in the C. jejuni reference strain NCTC 11168. However, these particular deletions and insertions did not result in any frameshifts and thus, all ORFs seemed to be intact. The flgD, fliD and fliK genes were detected in all C. jejuni water isolates, but variations in the sequences resulting in disrupted ORFs were detected in some of the isolates (Table 3). Furthermore, the pseE gene involved in flagellar modification was identified in all of the water isolates, but an intact ORF was only identified in five of the isolates (Table 3).

thumbnail
Download:
Table 3. Presence (+) or absence (-) of gene/ORF involved in flagellar motility in the C. jejuni water isolates.

https://doi.org/10.1371/journal.pone.0189222.t003

Two genes implicated in biofilm formation, csrA and peb4, were present in all water isolates and showed almost no differences in the gene and translated amino acid sequences. In four of the isolates, VA1 (ST48), VA25 (ST48), VA52 (ST48) and VA33), the luxS gene involved in quorum sensing and shown to be important for biofilm formation [39] was detected.

A plasmid of 20801 bp was identified in three of the C. jejuni water isolates (ST48CC) and annotated against the plasmid sequence of C. jejuni F38011 (S2 Table, NCBI Acc. No. CP006851), which gave the best hit (99.4%) when the sequence was blasted against all available entries in the NCBI database. Among the annotations an oxidoreductase (7-alpha-hydroxysteroid dehydrogenase) and a betalactamase were identified as well as genes possibly involved in virulence, such as prevent-host-death protein and ABC transporter permease.

LOS locus classes were assigned to five of the seven C. jejuni water isolates using PCR (data not shown). The three ST48 isolates were assigned to LOS locus class B2, VA12 (ST1275CC) to LOS locus class C and VA33 (ST683) to LOS locus class F, J or S whereas the two isolates VA48 (ST793) and VA49 (ST8853) were untypeable (Table 2). The isolates VA48 and VA49 remained unassigned even after a manual search for previously sequenced LOS locus classes.

Phenotyping

The ability of the water C. jejuni isolates to form biofilm was tested in three independent experiments and the isolates belonging to ST48 (ST48CC), ST637 (ST1275CC) and ST683 (CC ua) were able to form biofilm (Fig 1).

thumbnail
Download:
Fig 1. Motility and biofilm formation of the C. jejuni water isolates.

Motility shown as swarming diameters in soft agar plates. Mean values of 3 experiments with error bars indicating SDs are shown. Biofilm positive isolates shown in dark grey and negative isolates in light grey. The C. jejuni strain 76577 was included as a positive control for biofilm formation. The C. jejuni strains NCTC 11168 and 81–176 and the C. coli strain 76339 were included for comparison. ST types and CCs are shown where available (ua = unassigned).

https://doi.org/10.1371/journal.pone.0189222.g001

The motility assay showed that all isolates were motile, however, VA12 (ST1275CC) displayed the lowest motility (Fig 1). When the motility results were compared with the genome sizes, it was shown that isolates with larger genomes were less motile and a higher motility was detected among the isolates with smaller genomes (R2 = 0.61; Fig 2).

thumbnail
Download:
Fig 2. Motility and genome size of C. jejuni water isolates.

Comparison of motility and genome size of the seven C. jejuni water isolates. Plasmids are included in the genome size. C. jejuni reference strains 81–176 and NCTC 11168 were included for comparison.

https://doi.org/10.1371/journal.pone.0189222.g002

To assess the potential virulence of the water C. jejuni isolates and see whether they would be able to infect human cells, an in vitro infection model with HT-29 colon cancer cells was used. All isolates were able to infect HT-29 cells (Fig 3A), and adhered bacteria could be detected already at 30 minutes post-infection (data not shown). At 1 h, mean levels ranged between 0.02 and 0.12% for the C. jejuni water isolates (Fig 3A). The level of adherence/invasion for the isolates belonging to ST48 varied among the isolates assigned to this ST. At 8 h, the levels had reached 1% for some strains (data not shown), possibly due to bacterial growth. The levels of adhered/invaded bacteria of the water isolates were consistently lower than those of the C. jejuni NCTC 11168 reference strain at all time points.

thumbnail
Download:
Fig 3. Adherence/Invasion and IL-8 induction of C. jejuni water isolates.

(a) The adherence/invasion of C. jejuni water isolates to HT-29 cells 1 h post infection shown as percentage of the starting culture. (b) The induction of IL-8 levels at 2 h post infection shown as fold increase over uninfected cells. Mean values of three independent infections with error bars indicating SDs are shown. ST type and CCs shown where available (ua = unassigned).

https://doi.org/10.1371/journal.pone.0189222.g003

To further assess the potential ability of the water isolates to cause inflammation, IL-8 levels in the cell media were measured. IL-8 started to be detected at 2 hours post-infection and increased during the course of the infection (data not shown). In general, all water isolates induced lower levels of IL-8 than NCTC 11168 and no significant differences could be seen between the water isolates (Fig 3B). In conclusion, no clear correlation could be seen between the levels of adhered/invaded bacteria and induced IL-8 levels.

Discussion

In this study, whole genome sequencing, phenotypical tests and in vitro infection results were used to characterize C. jejuni isolates collected from raw surface water at water plants in Sweden. The aim was to detect unique traits among these isolates to gain a better understanding of environmental survival of C. jejuni and the potential of the water isolates to cause human infection. Our results showed that the seven C. jejuni water isolates were genetically diverse and belonged to ST48CC (three isolates), ST1275CC (one isolate) or were unassigned to any CC (three isolates). ST48CC is one of the most common CCs among human C. jejuni isolates but also contains isolates from various other sources, including the environment [40,41]. In contrast, ST1275CC isolates have been reported to be commonly found in environmental waters and wild birds [40,42,43]. Furthermore, a search in the Campylobacter PubMLST database showed that ST1275CC isolates had been detected from wild birds and environmental waters, but only rarely from human samples. Moreover, ST683 and ST793, unassigned to any CC, had previously been found in samples from environmental waters and wild birds only, according to PubMLST database. Thus, according to the MLST, our water isolates included both common and uncommon human pathogens.

Whole genome sequencing revealed the gene arsB, coding for an efflux transporter for inorganic arsenic, in all our C. jejuni water isolates. In four of our C. jejuni water isolates (ST683 and ST48) an arsenic resistance gene cluster associated with high level resistance to inorganic arsenic [35] and with a fragmented arsP gene was identified. In addition, the arsP gene coding for an efflux transporter specific for organic arsenic [36] was found in VA12 (ST1275CC). Toxic arsenic exists in the natural environment and in order to survive in its presence bacteria have developed resistance mechanisms [35]. Organoarsenic compounds have also previously been used as growth promoters in poultry production and as antimicrobials to control coccidiosis caused by parasites [44]. However, in this study, we did not test the resistance of our isolates to arsenic compounds and therefore the role of the genes described remains to be studied.

For Campylobacter to survive in water, it would be beneficial to handle oxidative and aerobic stress. The MarR-type transcriptional regulator gene rrpB has previously been shown to be involved in C. jejuni oxidative and aerobic stress response [45]. Wildtype strains lacking rrpB have been shown to survive better under oxidative and aerobic stress than strains with rrpB [46]. The rrpB has also been shown to be more uncommon in C. jejuni strains associated with water and wildlife than other strains associated with bovines [46]. In our study, rrpB was only present in isolate VA12 (ST1275, Table 2), which suggests that this particular isolate might be more sensitive to oxidative and aerobic stress but otherwise water isolates would be more adapted to handle oxidative and aerobic stress. However, further testing is needed to confirm this finding.

DMSO exists naturally in freshwater and marine environments, in rainwater and in the atmosphere [47]. C. jejuni have been shown to be capable of utilizing DMSO as an electron acceptor under low-oxygen conditions [48]. Here, an anaerobic DMSO-reductase coded by dmsABC was found in three of our C. jejuni water isolates (ST1275CC, ST683 and ST793). This DMSO-reductase has been shown to be common in C. jejuni isolates from humans and chicken [49] but uncommon in bovine isolates [49].

The majority of our isolates were able to form biofilm under the conditions tested (Fig 1). By forming biofilm, bacteria can create a protective environment for survival under harsh conditions [18]. As motility has been shown to be important for the formation of biofilm [19–21], the results from the biofilm assay were compared to the motility results. However, we could not see any correlations between the results. Although variations were seen in the motility genes between the C. jejuni water isolates, none of them could fully explain the differences in motility and biofilm formation. PseE mutations have earlier been shown to result in a non-motile phenotype [50], but here we could not see any motility loss for the isolates that seemed to lack an intact pseE gene. However, an intact pseE was only identified in the biofilm positive isolates suggesting that pseE-dependent flagellar modification is important for biofilm formation. In addition to motility, quorum sensing has been shown to affect the biofilm formation and studies have shown a decreased biofilm formation and motility in mutants lacking luxS [39,51]. Here, luxS was detected in four out of five water isolates that formed biofilm, but was lacking in the biofilm negative isolates. The swarming zones of the isolates were also compared with the genome sizes and the results showed that the isolate with the smallest genome had the highest motility and the isolate with the largest genome had the smallest swarming zone (Fig 2). These results may suggest that the C. jejuni that are less motile either contain more genetic material to compensate for the disadvantage or that the larger (heavier) genome directly and negatively impact the ability of the bacteria to move. Together, these findings suggest that the motility and biofilm phenotypes are multigenic and attributed to variations in a number of different genes.

The potential virulence of the C. jejuni water isolates was assessed in an in vitro infection model. The ability of the isolates to adhere to/invade and induce an immune response in a human colon cancer cell line was analyzed. All of the water isolates were able to both adhere/invade the cultured cells and to induce an IL-8 response, which suggests a potential to infect and cause inflammation in humans. However, as compared to the C. jejuni NCTC 11168 reference strain, the levels of adherence/invasion and IL-8 response were considerably lower. CDT is a toxin that has been shown to induce an IL-8 response [52] and in four of the C. jejuni water isolates, belonging to ST48 and ST683, the intact gene locus cdtABC was identified. The level of adherence/invasion for the isolates with intact cdtABC (ST48) varied, however, all the ST48 isolates induced the same level of IL-8 response (Fig 3). In one study the in vitro IL-8 response was not affected by CDT when the C. jejuni were able to adhere/invade [52], which might explain why isolates lacking CDT were able to induce similar levels of IL-8 as ST48 isolates. Together, these results suggest that the IL-8 response can be induced by different bacterial virulence mechanisms. As all isolates had intact genes for the putative virulence genes ciaB, pldA, cadF and ceuE, a more thorough analysis of expression levels of these genes might give an indication of the specific virulence strategy for each isolate.

A gene cluster coding for T6SS, a structure through which bacteria can deliver effector proteins into adjacent prokaryotic and eukaryotic cells [53], was identified in three of the C. jejuni water isolates (Table 2). The T6SS may be advantageous for the bacteria in several ways, e.g. to outcompete or to interact with other bacteria in the gut or in the environment [53]. However, as the T6SS gene cluster was not present in all of the water isolates, this structure does not seem to be critical for the survival in water.

The ST48 water isolates were assigned to LOS locus class B2 in accordance with a previous report [54]. C. jejuni with potential to sialylate LOS (LOS locus A, B and C) have been proposed to cause more severe symptoms [55] and also to adhere and invade cultured intestinal epithelial cell lines at a higher level than isolates without this characteristic [56,57]. In this study, no differences in the in vitro infections were seen between the isolates with or without the potential to sialylate their LOS. This is in line with our previous study [25] where C. jejuni with potential to sialylate LOS did not induce a higher IL-8 response than those without the ability to sialylate their LOS.

In conclusion, this is, to the best of our knowledge, the first study where C. jejuni isolated from water have been characterized using both whole genome sequencing and phenotypical assays. Although our collection of water isolates was limited, we found both characteristics common for all water isolates but also interesting genotypical and phenotypical differences between the isolates that might influence their potential to survive in the environment and transmit to human hosts.

Supporting information

S1 Table. RAST annotations of orthologues not shared by all C. jejuni water isolates.

https://doi.org/10.1371/journal.pone.0189222.s001

(DOCX)

S2 Table. Annotations of plasmid genes found in C. jejuni ST48 water isolates from C. jejuni strain F38011.

https://doi.org/10.1371/journal.pone.0189222.s002

(DOCX)

Acknowledgments

We thank Hans Lindmark and National Food Agency, Sweden, for providing the water isolates. Parts of the results have been presented at the 19th International workshop on Campylobacter, Helicobacter and Related Organisms in Nantes, France, 10th– 14th September 2017.

References

  1. 1. Curtis D, Hill A, Wilcock A, Charlebois S. Foodborne and waterborne pathogenic bacteria in selected Organisation for Economic Cooperation and Development (OECD) countries. J Food Sci. 2014 Oct;79(10):R1871–1876. pmid:25257314
  2. 2. Thomas C, Gibson H, Hill DJ, Mabey M. Campylobacter epidemiology: an aquatic perspective. J Appl Microbiol. 1998 Dec;85 Suppl 1:168S–177S.
  3. 3. Skirrow MB. Epidemiology of Campylobacter enteritis. Int J Food Microbiol. 1991 Jan 1;12(1):9–16. pmid:2018709
  4. 4. Schönberg-Norio D, Takkinen J, Hänninen M-L, Katila M-L, Kaukoranta S-S, Mattila L, et al. Swimming and Campylobacter infections. Emerg Infect Dis. 2004 Aug;10(8):1474–7. pmid:15496253
  5. 5. Kapperud G. Factors associated with increased and decreased risk of Campylobacter infection: a prospective case-control study in Norway. Am J Epidemiol. 2003 Aug 1;158(3):234–42. pmid:12882945
  6. 6. Hänninen M-L, Haajanen H, Pummi T, Wermundsen K, Katila M-L, Sarkkinen H, et al. Detection and typing of Campylobacter jejuni and Campylobacter coli and analysis of indicator organisms in three waterborne outbreaks in Finland. Appl Environ Microbiol. 2003 Mar 1;69(3):1391–6. pmid:12620821
  7. 7. Guzman-Herrador B, Carlander A, Ethelberg S, Freiesleben de Blasio B, Kuusi M, Lund V, et al. Waterborne outbreaks in the Nordic countries, 1998 to 2012. Euro Surveill Bull Eur Sur Mal Transm Eur Commun Dis Bull. 2015;20(24).
  8. 8. Hänninen ML, Niskanen M, Korhonen L. Water as a reservoir for Campylobacter jejuni infection in cows studied by serotyping and pulsed-field gel electrophoresis (PFGE). Zentralblatt Vet Reihe B J Vet Med Ser B. 1998 Feb;45(1):37–42.
  9. 9. Ellis-Iversen J, Cook AJC, Smith RP, Pritchard GC, Nielen M. Temporal Patterns and Risk Factors for Escherichia coli O157 and Campylobacter spp. in Young Cattle. J Food Prot. 2009 Mar 1;72(3):490–6. pmid:19343935
  10. 10. Rollins DM, Colwell RR. Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl Environ Microbiol. 1986 Sep;52(3):531–8. pmid:3767358
  11. 11. Chan KF, Le Tran H, Kanenaka RY, Kathariou S. Survival of clinical and poultry-derived isolates of Campylobacter jejuni at a low temperature (4°C). Appl Environ Microbiol. 2001 Sep;67(9):4186–91. pmid:11526022
  12. 12. Trigui H, Thibodeau A, Fravalo P, Letellier A, P. Faucher S. Survival in water of Campylobacter jejuni strains isolated from the slaughterhouse. SpringerPlus [Internet]. 2015 Dec [cited 2016 Apr 11];4(1). Available from: http://www.springerplus.com/content/4/1/799
  13. 13. Cools I, Uyttendaele M, Caro C, D’Haese E, Nelis HJ, Debevere J. Survival of Campylobacter jejuni strains of different origin in drinking water. J Appl Microbiol. 2003;94(5):886–92. pmid:12694454
  14. 14. Buswell CM, Herlihy YM, Lawrence LM, McGuiggan JTM, Marsh PD, Keevil CW, et al. Extended survival and persistence of Campylobacter spp. in water and aquatic biofilms and their detection by immunofluorescent-antibody and -rRNA staining. Appl Environ Microbiol. 1998 Feb;64(2):733–41. pmid:9464415
  15. 15. Jones DM, Sutcliffe EM, Curry A. Recovery of viable but non-culturable Campylobacter jejuni. J Gen Microbiol. 1991 Oct 1;137(10):2477–82. pmid:1770362
  16. 16. Gripp E, Hlahla D, Didelot X, Kops F, Maurischat S, Tedin K, et al. Closely related Campylobacter jejuni strains from different sources reveal a generalist rather than a specialist lifestyle. BMC Genomics. 2011;12(1):584.
  17. 17. Ottemann KM, Miller JF. Roles for motility in bacterial–host interactions. Mol Microbiol. 1997 Jun 1;24(6):1109–17. pmid:9218761
  18. 18. Costerton J W, Cheng K J, Geesey G G, Ladd T I, Nickel J C, Dasgupta M, et al. Bacterial biofilms in nature and disease. Annu Rev Microbiol. 1987;41(1):435–64.
  19. 19. Revez J, Rossi M, Ellström P, de Haan C, Rautelin H, Hänninen M-L. Finnish Campylobacter jejuni strains of multilocus sequence type ST-22 complex have two lineages with different characteristics. PLoS ONE. 2011 Oct 24;6(10):e26880. pmid:22039552
  20. 20. Pascoe B, Méric G, Murray S, Yahara K, Mageiros L, Bowen R, et al. Enhanced biofilm formation and multi-host transmission evolve from divergent genetic backgrounds in C ampylobacter jejuni: Campylobacter biofilm GWAS. Environ Microbiol. 2015 Nov;17(11):4779–89. pmid:26373338
  21. 21. Asakura H, Brüggemann H, Sheppard SK, Ekawa T, Meyer TF, Yamamoto S, et al. Molecular evidence for the thriving of Campylobacter jejuni ST-4526 in Japan. PLOS ONE. 2012 Nov;7(11):e48394. pmid:23144873
  22. 22. Fauchere JL, Rosenau A, Veron M, Moyen EN, Richard S, Pfister A. Association with HeLa cells of Campylobacter jejuni and Campylobacter coli isolated from human feces. Infect Immun. 1986 Nov;54(2):283–7. pmid:3770943
  23. 23. Everest PH, Goossens H, Butzler J-P, Lloyd D, Knutton S, Ketley JM, et al. Differentiated Caco-2 cells as a model for enteric invasion by Campylobacter jejuni and C. coli. J Med Microbiol. 1992 Nov 1;37(5):319–25. pmid:1433253
  24. 24. Hickey TE, Baqar S, Bourgeois AL, Ewing CP, Guerry P. Campylobacter jejuni-Stimulated Secretion of Interleukin-8 by INT407 Cells. Infect Immun. 1999 Jan;67(1):88–93. pmid:9864200
  25. 25. Ellström P, Feodoroff B, Hänninen M-L, Rautelin H. Characterization of clinical Campylobacter jejuni isolates with special emphasis on lipooligosaccharide locus class, putative virulence factors and host response. Int J Med Microbiol. 2013 Apr;303(3):134–9. pmid:23528202
  26. 26. Skarp-de Haan CPA, Culebro A, Schott T, Revez J, Schweda EKH, Hänninen M-L, et al. Comparative genomics of unintrogressed Campylobacter coli clades 2 and 3. BMC Genomics. 2014;15:129. pmid:24524824
  27. 27. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinforma Oxf Engl. 2012 Jun 15;28(12):1647–9.
  28. 28. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 2008;9:75. pmid:18261238
  29. 29. Ekseth OK, Kuiper M, Mironov V. orthAgogue: an agile tool for the rapid prediction of orthology relations. Bioinformatics. 2014 Mar 1;30(5):734–6. pmid:24115168
  30. 30. Enright AJ, Van Dongen S, Ouzounis CA. An efficient algorithm for large-scale detection of protein families. Nucleic Acids Res. 2002 Apr 1;30(7):1575–84. pmid:11917018
  31. 31. Parker CT, Horn ST, Gilbert M, Miller WG, Woodward DL, Mandrell RE. Comparison of Campylobacter jejuni Lipooligosaccharide Biosynthesis Loci from a Variety of Sources. J Clin Microbiol. 2005 Jun 1;43(6):2771–81. pmid:15956396
  32. 32. Richards VP, Lefébure T, Pavinski Bitar PD, Stanhope MJ. Comparative characterization of the virulence gene clusters (lipooligosaccharide [LOS] and capsular polysaccharide [CPS]) for Campylobacter coli, Campylobacter jejuni subsp. jejuni and related Campylobacter species. Infect Genet Evol. 2013 Mar;14:200–13. pmid:23279811
  33. 33. Skarp CPA, Akinrinade O, Kaden R, Johansson C, Rautelin H. Accessory genetic content in Campylobacter jejuni ST21CC isolates from feces and blood. Int J Med Microbiol IJMM. 2017 Jun;307(4–5):233–40. pmid:28408091
  34. 34. Szymanski CM, King M, Haardt M, Armstrong GD. Campylobacter jejuni motility and invasion of Caco-2 cells. Infect Immun. 1995 Nov;63(11):4295–300. pmid:7591061
  35. 35. Wang L, Jeon B, Sahin O, Zhang Q. Identification of an arsenic resistance and arsenic-sensing system in Campylobacter jejuni. Appl Environ Microbiol. 2009 Aug;75(15):5064–73. pmid:19502436
  36. 36. Shen Z, Luangtongkum T, Qiang Z, Jeon B, Wang L, Zhang Q. Identification of a Novel Membrane Transporter Mediating Resistance to Organic Arsenic in Campylobacter jejuni. Antimicrob Agents Chemother. 2014 Apr 1;58(4):2021–9. pmid:24419344
  37. 37. Shen Z, Han J, Wang Y, Sahin O, Zhang Q. The Contribution of ArsB to Arsenic Resistance in Campylobacter jejuni. Chang Y-F, editor. PLoS ONE. 2013 Mar 15;8(3):e58894. pmid:23554953
  38. 38. Hofreuter D, Tsai J, Watson RO, Novik V, Altman B, Benitez M, et al. Unique Features of a Highly Pathogenic Campylobacter jejuni Strain. Infect Immun. 2006 Aug;74(8):4694–707. pmid:16861657
  39. 39. Reeser RJ, Medler RT, Billington SJ, Jost BH, Joens LA. Characterization of Campylobacter jejuni Biofilms under Defined Growth Conditions. Appl Environ Microbiol. 2007 Mar 15;73(6):1908–13. pmid:17259368
  40. 40. Sheppard SK, Dallas JF, MacRae M, McCarthy ND, Sproston EL, Gormley FJ, et al. Campylobacter genotypes from food animals, environmental sources and clinical disease in Scotland 2005/6. Int J Food Microbiol. 2009 Aug 31;134(0):96–103.
  41. 41. de Haan CPA, Kivistö R, Hakkinen M, Rautelin H, Hänninen ML. Decreasing Trend of Overlapping Multilocus Sequence Types between Human and Chicken Campylobacter jejuni Isolates over a Decade in Finland. Appl Environ Microbiol. 2010 Aug;76(15):5228–36. pmid:20543048
  42. 42. Carter PE, McTavish SM, Brooks HJL, Campbell D, Collins-Emerson JM, Midwinter AC, et al. Novel Clonal Complexes with an Unknown Animal Reservoir Dominate Campylobacter jejuni Isolates from River Water in New Zealand. Appl Environ Microbiol. 2009 Oct 1;75(19):6038–46. pmid:19648367
  43. 43. Lévesque S, Frost E, Arbeit RD, Michaud S. Multilocus Sequence Typing of Campylobacter jejuni Isolates from Humans, Chickens, Raw Milk, and Environmental Water in Quebec, Canada. J Clin Microbiol. 2008 Oct 1;46(10):3404–11. pmid:18701662
  44. 44. Chapman HD, Johnson ZB. Use of antibiotics and roxarsone in broiler chickens in the USA: analysis for the years 1995 to 2000. Poult Sci. 2002 Mar;81(3):356–64. pmid:11902412
  45. 45. Gundogdu O, da Silva DT, Mohammad B, Elmi A, Mills DC, Wren BW, et al. The Campylobacter jejuni MarR-like transcriptional regulators RrpA and RrpB both influence bacterial responses to oxidative and aerobic stresses. Front Microbiol [Internet]. 2015 Jul 21 [cited 2017 May 19];6. Available from: http://journal.frontiersin.org/Article/10.3389/fmicb.2015.00724/abstract
  46. 46. Gundogdu O, da Silva DT, Mohammad B, Elmi A, Wren BW, van Vliet AHM, et al. The Campylobacter jejuni Oxidative Stress Regulator RrpB Is Associated with a Genomic Hypervariable Region and Altered Oxidative Stress Resistance. Front Microbiol [Internet]. 2016 Dec 26 [cited 2017 Mar 9];7. Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5183652/
  47. 47. Hatton AD, Malin G, McEwan AG, Liss PS. Determination of Dimethyl Sulfoxide in Aqueous Solution by an Enzyme-Linked Method. Anal Chem. 1994 Nov;66(22):4093–6.
  48. 48. Sellars MJ, Hall SJ, Kelly DJ. Growth of Campylobacter jejuni Supported by Respiration of Fumarate, Nitrate, Nitrite, Trimethylamine-N-Oxide, or Dimethyl Sulfoxide Requires Oxygen. J Bacteriol. 2002 Aug 1;184(15):4187–96. pmid:12107136
  49. 49. Gonzalez M, Hakkinen M, Rautelin H, Hänninen M-L. Bovine Campylobacter jejuni Strains Differ from Human and Chicken Strains in an Analysis of Certain Molecular Genetic Markers. Appl Environ Microbiol. 2009 Feb;75(4):1208–10. pmid:19098218
  50. 50. Guerry P, Ewing CP, Schirm M, Lorenzo M, Kelly J, Pattarini D, et al. Changes in flagellin glycosylation affect Campylobacter autoagglutination and virulence. Mol Microbiol. 2006 Apr;60(2):299–311. pmid:16573682
  51. 51. Elvers KT, Park SF. Quorum sensing in Campylobacter jejuni: detection of a luxS encoded signalling molecule. Microbiology. 2002;148(5):1475–81.
  52. 52. Hickey TE, McVeigh AL, Scott DA, Michielutti RE, Bixby A, Carroll SA, et al. Campylobacter jejuni cytolethal distending toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect Immun. 2000 Dec;68(12):6535–41. pmid:11083762
  53. 53. Russell AB, Peterson SB, Mougous JD. Type VI secretion system effectors: poisons with a purpose. Nat Rev Microbiol. 2014 Jan 2;12(2):137–48. pmid:24384601
  54. 54. Revez J, Hänninen M-L. Lipooligosaccharide locus classes are associated with certain Campylobacter jejuni multilocus sequence types. Eur J Clin Microbiol Infect Dis. 2012 Sep 1;31(9):2203–9. pmid:22298242
  55. 55. Mortensen NP, Kuijf ML, Ang CW, Schiellerup P, Krogfelt KA, Jacobs BC, et al. Sialylation of Campylobacter jejuni lipo-oligosaccharides is associated with severe gastro-enteritis and reactive arthritis. Microbes Infect. 2009 Oct;11(12):988–94. pmid:19631279
  56. 56. Louwen R, Heikema A, van Belkum A, Ott A, Gilbert M, Ang W, et al. The sialylated lipooligosaccharide outer core in Campylobacter jejuni is an important determinant for epithelial cell invasion. Infect Immun. 2008 Oct;76(10):4431–8. pmid:18644887
  57. 57. Habib I, Louwen R, Uyttendaele M, Houf K, Vandenberg O, Nieuwenhuis EE, et al. Correlation between Genotypic Diversity, Lipooligosaccharide Gene Locus Class Variation, and Caco-2 Cell Invasion Potential of Campylobacter jejuni Isolates from Chicken Meat and Humans: Contribution to Virulotyping. Appl Environ Microbiol. 2009 Jul 1;75(13):4277–88. pmid:19411422