http://orcid.org/0000-0002-2337-6807
Figures
Abstract
Improved awareness of the hepatitis C virus (HCV) transmission has contributed to the overall decline in the HCV infection rate in some developing countries including Thailand. Chronic HCV infection in some rural Thai communities, however, presents a challenge in the efforts to treat and manage HCV-related diseases. Published and unpublished studies have suggested an unusually high incidence of HCV infection in a Thai province of Phetchabun compared to elsewhere in Thailand. To determine the magnitude of HCV infection and identify potential factors contributing to the higher rate of HCV infection in this province, we performed a population-based study in Phetchabun (n = 1667) and the neighboring Khon Kaen province (n = 1410) where HCV prevalence is much lower. Individuals between 30 and 64 years old completed detailed questionnaires designed to identify HCV risk factors and provided blood samples for anti-HCV antibody screening. The anti-HCV seropositive rates were 15.5% (259/1667) in Phetchabun and 3.6% (51/1410) in Khon Kaen. Positive samples were subsequently genotyped for HCV core gene sequence and assessed for the hepatitis B virus surface antigen (HBsAg) and human immunodeficiency virus antigen/antibody (HIV Ag/Ab). More individuals in Phetchabun possessed the combined presence of HBsAg (5.0%) and HIV Ag/Ab (0.4%) than those in Khon Kaen (3.9% HBsAg and 0.0% HIV Ag/Ab). While male gender, intravenous drug use (IVDU) and tattoos were significant HCV risk factors in both provinces (p <0.05), education less than high school and agriculture-related occupation were additionally associated with HCV in Phetchabun. HCV genotypes 6, 3, and 1 were identified in similar frequency in both provinces. We estimated that prevalence of HCV seropositivity and viremic carriers were higher in Phetchabun (143 and 111 per 1000) than in Khon Kaen (34 and 22 per 1000). Finally, we derived a simple risk factor-based scoring system as a useful preclinical tool to screen individuals at risk of chronic HCV infection prior to intervention. Knowledge gained from this study will assist in HCV screening and promote access to anti-viral treatment in high-risk groups.
Citation: Wasitthankasem R, Vichaiwattana P, Siripon N, Posuwan N, Auphimai C, Klinfueng S, et al. (2017) Assessment of hepatitis C virus infection in two adjacent Thai provinces with drastically different seroprevalence. PLoS ONE 12(5): e0177022. https://doi.org/10.1371/journal.pone.0177022
Editor: Jason Blackard, University of Cincinnati College of Medicine, UNITED STATES
Received: December 22, 2016; Accepted: March 28, 2017; Published: May 5, 2017
Copyright: © 2017 Wasitthankasem et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All sequence files are available from the GenBank database (accession numbers KY625212 to KY625445).
Funding: This work was supported by the National Research Council of Thailand (NRCT), the National Research University Project, Office of Higher Education Commission (NRU-59-002-HR), the Research Chair Grant from the National Science and Technology Development Agency, Chulalongkorn University Centenary Academic Development Project (CU56-HR01), Ratchadaphiseksomphot Endowment Fund of Chulalongkorn University (RES560530093) the Outstanding Professor of Thailand Research Fund (DPG5480002), Ratchadaphiseksomphot Endowment Fund for Postdoctoral Fellowship to Rujipat Wasitthankasem, the Center of Excellence in Clinical Virology, Chulalongkorn University (GCE58- 014-30-004) and King Chulalongkorn Memorial Hospital. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Hepatitis C virus (HCV) is a major cause of chronic liver disease, cirrhosis and hepatocellular carcinoma (HCC) [1,2] and affects approximately 185 million people worldwide [3]. HCV was often acquired from blood transfusion, iatrogenic procedure, intravenous drug use (IVDU), accidental needle sticks, unsterile needle use in medical procedures, and tattooing in the years before HCV pathogenesis was elucidated [4–6]. The presence of anti-HCV antibodies can indicate current or past HCV infection, and when left untreated, chronic infection can be as high as 75% to 85% [4,7].
The prevalence rates of HCV in developing countries are generally higher than in industrialized nations, but improving socio-economic status and education in developing nations have contributed in the decline in new HCV infection. For example, the overall HCV seroprevalence in Thailand has decreased from 2.2% to 0.9% within the past 10 years [8,9] and will likely be ≤0.2% over the next 20 years [10]. Despite the declining trend in the general population, HCV infection rate continues to increase among individuals >30 years with the highest prevalence among individuals 41–50 years [9]. Regional pockets of relatively high HCV endemicity also remained in northern and northeastern Thailand [9,11–13].
In 2006, The Bureau of Epidemiology of the Thai Ministry of Health reported a marked increase of HCV infection compared to 2004 [14]. Very limited seroprevalence survey in a rural province of Phetchabun found that up to 16% of the residents possessed HCV antibodies, well above the national average of 2.2% [14]. Although most individuals were asymptomatic (55.5%), chronic hepatitis (17.8%), cirrhosis (8.9%) and HCC (2.2%) were also reported [8,15]. However, accurate number of infection and contributing factors attributed to the high rate of HCV was unknown.
The apparently high rate of HCV infection in Phetchabun has not been independently confirmed. Since clinical development of HCV infection is slow and asymptomatic phase is long, we hypothesized that HCV prevalence in Phetchabun is significantly higher than initially assessed. Therefore, we sought to more accurately determine HCV seroprevalence rate and identify potential risk factors contributing to active infection in this province as compared to the neighboring province of Khon Kaen where HCV infection was low. We also proposed the use of a simple scoring system defined by several associated risk factors, which can be used to estimate crude HCV infection rate for a given community.
Material and methods
The cohorts in this cross-sectional study reside in Phetchabun and Khon Kaen provinces of Thailand (Fig 1). Khon Kaen was a comparison site because it adjoins Phetchabun and previous serological data from the 2014 national survey of hepatitis burden were available [9]. Written informed consent was obtained from all participants and the study protocol was approved by the institutional review board of the Faculty of Medicine, Chulalongkorn University (IRB No. 258/58).
Phetchabun and Khon Kaen are adjacent provinces with different HCV prevalence. The districts of Lom Kao and Lom Sak in Phetchabun and Chum Phae in Khon Kaen are divided into administrative sub-districts. Sub-districts are shown in different colors in which light blue denotes relatively low (<1.0%) and red denotes relatively high (>30%) HCV seroprevalence. Regions with no data are denoted white.
Study population
Randomly chosen individuals aged 30 to 64 years from Lom Kao and Lom Sak districts of Phetchabun (n = 1667) and Chum Phae district of Khon Kaen (n = 1410) were recruited between October and December 2015 (Fig 2). This age range was examined because they were more likely to be seropositive compared to younger individuals [9]. Individuals were generally in good health and were seen at Lom Kao Crown Prince Hospital (Phetchabun) and Chumpae Hospital (Khon Kaen) where they had their blood drawn. They were age-weighed according to the proportion of the population in each sub-district of Lom Kao, Lom Sak, and Chum Phae. Socio-demographic data and exposure to potential risk factors associated with HCV infection were obtained from completed questionnaires (e.g. history of blood transfusion, non-intravenous illicit drug use, IVDU, history of medical surgery, sharp needle/injection administered by licensed medical person or unlicensed non-medical person, tattooing, sharing of razors, acupuncture treatment, accidental needle stick, sexual orientation, having HCV-infected spouse, history of liver disease, and hepatitis disease in family member) (S1 and S2 Files).
Data obtained from individuals between 30 to 64 years residing in Lom Sak and Lom Kao in Phetchabun and Chum Phae in Khon Kaen were analyzed. Samples tested positive for anti-HCV antibodies were further evaluated for HBV and HIV co-infection. HCV RNA was isolated and the virus genotyped by RT-PCR, sequencing, and phylogenetic analysis.
Serological and molecular assays
Anti-HCV antibody was evaluated using an automated chemiluminescent microparticle immunoassay (ARCHITECT anti-HCV assay, Abbott Diagnostics, Wiesbaden, Germany). Positive samples were tested for co-infection with HBV and/or HIV by automated HBsAg and HIV Ag/Ab assays, also using the ARCHITECT platform. For HCV genotyping, viral nucleic acid was extracted from the sera and nested RT-PCR performed to amplify the HCV partial core region as previously described [16]. Primers used for the first-round of PCR were 954F (ACTGCCTGATAGGGTGCTTGCGAG, nucleotide position 288–311 based on the reference strain with GenBank accession number M62321) and 410R (ATGTACCCCATGAGGTCGGC, position 732–751). Primers for the second-round of PCR were 953F (AGGTCTCGTAGACCGTGCATCATG, position 321–344) and 951R (CACTGTRAGGGTATCGATGAC, position 705–725) [17]. The expected 405 base-pair amplicons were resolved by 2% agarose gel electrophoresis and subjected to nucleotide sequencing. HCV sequences were preliminarily assigned genotypes using BLASTN (http://www.ncbi.nlm.nih.gov) and viral genotyping tool (http://www.ncbi.nlm.nih.gov/projects/genotyping/formpage.cgi).
Phylogenetic analysis of HCV genotypes
Confirmation of HCV genotypes was performed using phylogenetic analysis. Nucleotide sequences were edited and assembled using BioEdit version.5.0.9 and SeqMan versoin.8.1.3 and aligned with reference strains using ClustalX version 2.1. Phylogenetic tree was constructed using Kimura two-parameter best-fit model and 1,000 bootstrap value implemented in MEGA software version 6. Nucleotide sequences obtained from this study were deposited in GenBank (accession numbers KY625212 to KY625445). Reference sequences used in this study were 1a (M62321, M67463, EU155350), 1b (D90208, M58335, AF207757, EU155303), 2a (AB047639, D00944), 2b (D10988, AB030907), 2c (D50409), 3a (D17763, D28917, AB691595, KJ470615-), 3b (D49374), 4a (Y11604), 5a (Y13184), 6a (Y12083, AY859526), 6b (D84262), 6c (EF424629), 6d (D84263), 6e (DQ314805), 6f (DQ835760, EU246936, HM042030), 6g (D63822), 6h (D84265), 6i (DQ835770), 6j (DQ835769), 6k (D84264), 6l (EF424628), 6m (DQ835767), 6n (DQ278894, DQ835768), 6o (EF424627), 6p (EF424626), 6q (EF424625), 6r (EU408328), 6s (EU408329), 6t (EF632071, EU246939), 6u (EU246940), 6v (EU158186, EU798760), 6w (DQ278892, EU643834), 6xa (EU408330, EU408332), 6xb (JX183552, KJ567645), 6xc (KJ567650, KJ567649), 6xd (KM252791, KM252789), 6xe (JX183557, KM252792) and 7a (EF108306).
Estimating the HCV carrier rate
Population census data of Lom Kao, Lom Sak, and Chum Phae in 2015 were obtained from the Official Statistics Registration System (http://stat.dopa.go.th/stat/statnew/upstat_age.php). HCV seropositive rates were age group-stratified (from 30 to 64 years). Seropositive carrier rates were extrapolated and calculated separately for men and women.
Statistical analysis
All categorical data were transformed to nominal scale. Comparison of the differences in potential risk factors for HCV infection between groups was done using Chi-square and ANOVA univariate analysis (IBM SPSS Statistics version 22, IBM Corporation, Armonk, NY). A p-value <0.05 was considered statistically significant. Factors with a p-value <0.2 in the univariate analysis were further evaluated for independent effect using multivariate analysis with logistic regression model. Odds ratios and 95% confidence interval (CI) of demographic and relative risk factors were derived from univariate and multivariate analyses. The odds ratios of significant risk factors were used to develop the screening score for HCV infection prediction. Receiving operating curve (ROC) analysis was used to calculate the area under the curve (AUC) in order to interpret validity of screening test for HCV infection. Cut-off score with sensitivity (≥ 80%) were chosen to maximize the inclusion of asymptomatic HCV-positive individuals.
Results
Prevalence and factors associated with HCV seropositivity
The mean age of the entire study population (n = 3077) was 48.4 ± 7.9 years and women comprised 56.8% (1747/3077) (Table 1). The majority of individuals (60.2%, 1831/3041) possessed at least some primary school education (grades 1 through 6). The most common occupation was agriculture (2144/2996, 71.6%). Individuals who tested positive for HCV antibody were generally older, less educated, and overwhelmingly male.
Lom Kao and Lom Sak are adjacent districts approximately 40 kilometers apart, while Chum Phae is 120 kilometers east of Lom Sak. The differences in the HCV seropositivity rates in these districts, however, were striking (Fig 1). In both provincial cohorts, individuals were similar in age, gender ratio, education level, and occupation. Although the overall HCV seroprevalence was 10.1%, the rate was significantly higher in Phetchabun (Lom Sak = 11.8%, Lom Kao = 16.6%, total = 15.5%) than in Khon Kaen (Chum Phae = 3.6%) (Table 1). The proportion of seropositive men compared to seropositive women were approximately 7:1 in both provinces (28.4% vs. 4.4% in Phetchabun, p<0.001; 7.5% vs. 1.0% in Khon Kaen, p<0.001). Several factors associated with HCV seropositivity were significantly linked to the Phetchabun but not Khon Kaen cohort. These were the slightly higher mean age (p = 0.003), education (p<0.001) and agricultural employment (p<0.001).
In the Phetchabun cohort, univariate analysis showed several factors were associated with increasing odds ratios of HCV seropositivity (Table 2 and S1 Table). These included age, male gender, education less than university level, agricultural and temporary employment, history of oral drug abuse and IVDU. HCV-seropositive individuals were also more likely to have a history of medical treatment involving injection either by medical or non-medical staff, shared razor blade, and had tattoos. Lower HCV seropositivity rates were observed in individuals with a history of surgery (OR 0.6, 95% CI: 0.5, 0.8) and hepatitis in the family (OR 0.6, 95% CI: 0.4, 1.0). In Khon Kaen, however, higher HCV seropositivity rates were statistically significant in men, oral drug abuser, IVDU and those with tattoo.
Multivariate analysis by logistic regression was performed on 12 parameters for Phetchabun and 4 parameters for Khon Kaen (Table 3). In the Phetchabun cohort, independent factors associated with HCV seropositive were male gender (adjusted OR 5.7, 95% CI: 3.7, 8.7), education between grade 7 to 9 (adjusted OR 9.6, 95% CI: 1.2, 76.1), agricultural occupation (adjusted OR 2.9, 95% CI: 1.1, 7.8), IVDU (adjusted OR 14.4, 95% CI: 5.3, 38.6), and having tattoo (adjusted OR 2.2, 95% CI: 1.5, 3.1) after adjusted for age (10 years interval), history with oral drug abuse, received operation, therapeutic injection by medical and non-medical staff, sharing razor blade and having hepatitis disease in family member. In the Khon Kaen cohort, after adjusted for history with oral drug abuse, the significant risk factors were male gender (adjusted OR 6.0, 95% CI: 2.8, 12.8), IVDU (adjusted OR 73.7, 95% CI: 5.1, 1074.1) and having tattoo (adjusted OR 2.0, 95% CI: 1.1, 3.9).
The 15.5% HCV seropositivity in Phetchabun from this study was 4 times higher than the rate in the adjacent province of Khon Kaen (Fig 3). In addition, seroprevalence in Phetchabun was consistently higher than that of Khon Kaen among all age groups and was 16.5 times higher than the national average.
HCV seroprevalence is indicated by the line graphs (left scale). The number of individuals according to age groups included in the study is represented by the bar graphs (right scale).
HCV co-infection with HBV or HIV
We assessed the prevalence of two additional bloodborne viruses, HBV and HIV, in HCV seropositive samples. HBsAg was found reactive in 13/259 (5.0%, male/female = 9/4) of the Phetchabun cohort and 2/51 (3.9%, male/female = 2/0) in the Khon Kaen cohort. From 266 individuals who provided consent for HIV Ag/Ab testing, only one individual in the Phetchabun cohort tested reactive for HIV Ag/Ab (1/228).
Determination of HCV genotype
HCV RNA was found in 203 (78.4%) and 31 (60.8%) of the seropositive samples from Phetchabun and Khon Kaen, respectively (Table 4 and S1 Fig). Nucleotide sequence analysis showed that genotypes 3a and 6f were most commonly found in both provinces, while genotype 6c was present in only one sample. In Phetchabun where there were more HCV-positive samples, genotype 1a comprised a significant proportion of HCV identified. In Khon Kaen, genotype 1b was also frequently found. Overall, there was no statistically significant association between HCV genotypes and the presence of HBsAg, HIV status, transmission routes, or risk factors. Among the 13 HBsAg-positive samples, HCV RNA was present in 6 samples [genotype 3a (n = 3), 6f (n = 2) and 6n (n = 1)]. One sample positive for HIV Ag/Ab had HCV genotype 6n.
Estimates of HCV carriers
We next estimated the number of individuals with anti-HCV antibody, and HCV RNA carriers for each age group (between 30 and 64 years) and gender (S2 Table). In Phetchabun, anti-HCV antibody-positive individuals and HCV RNA carriers were estimated at 14261 per 100000 (male-to-female = 5.5:1) and 11061 per 100000 (male-to-female = 7.1:1), respectively. In Khon Kaen, HCV prevalence was estimated at 3424 per 100000 (male-to-female = 5.5:1) anti-HCV positive individuals and 2224 per 100000 (male-to-female = 6.9:1) viremic carriers.
HCV infection screening score
To develop an algorithm for screening HCV in a given population, which can be used to ascertain HCV burden in the community prior to invasive diagnostics, statistically significant parameters in multivariate analysis were applied. Variables from Table 3 were selected and scored according to their odd ratios as follow: gender score = 3 for male and = 0 for female; education score = 4 for below grade 7, = 5 for grade 7–9 level, and = 0 for others; occupation score = 2 for agriculture and = 0 for others; IVDU score = 8 and = 0 for non-user; and tattooing score = 2 and = 0 for no tattoo. The sum scores of gender, education, occupation, IVDU and tattooing yield a total maximum risk score of 20. Validity of the risk screening score was analyzed by the receiving operating curve (ROC) and accuracy of the test was interpreted based on the area under the curve (AUC) (Fig 4). When applied to the data, AUC was 0.77 for Phetchabun (95% CI: 0.74, 0.80), 0.71 for Khon Kaen (95% CI: 0.62, 0.79) and 0.76 overall (95% CI: 0.73, 0.79). At the cut-off score ≥ 6.0, the sensitivity and specificity of the screening test of the overall data were 84.2% and 34.5%, respectively (Fig 4). Individuals who attained a cut-off score ≥ 6 by this screening test would therefore be advised to undergo further diagnostic test for HCV infection.
The ROC represents an area under the curve (AUC) of HCV screening tool derived from factors associated with HCV infection. To maximize ascertainment of individuals with HCV, the cut-off score at 6 was chosen for the relatively high sensitivity at the expense of specificity.
Discussion
It was estimated that Thailand has a moderate HCV seroprevalence (1.7 to 2.3%) [3] and that 2.7% of Thais 15 years and older are HCV-seropositive [18]. A recent national study involving serosurvey of individuals residing in multiple provinces, however, revealed a more accurate and much lower overall HCV seroprevalence of 0.9% [9]. Nevertheless, there are regional variations in the past and present HCV exposure within Thailand. A small sero-survey in rural Phetchabun suggested that as high as 16% of the residents possessed HCV antibodies, which led us to examine the burden of HCV in a larger cohort in Phetchabun and in neighboring Khon Kaen where HCV data from previous studies only showed ~3.0% HCV seropositivity (S3 Table) [9,14].
The association of anti-HCV antibody with male gender, history of IVDU and tattooing is consistent with previous published reports [19–22]. In particular, IVDU is a major risk factor associated with HCV (adjusted OR 14.4 in Phetchabun and 73.7 in Khon Kaen) and is confirmed in several cohort studies [23,24]. Active infection as measured by the presence of serum HCV RNA was as high as 70% among IVDU compared to other modes of illicit drugs [25]. In fact, HCV seropositivity was a surrogate for the history of injected drug use in an HIV study [26]. Among HIV-positive young men, HCV co-infection was 20.0% in IVDU compared to 5.7% in non-IVDU [27].
Socioeconomic conditions such as education, occupation and income were reported as independent factors for HCV infection and indeed associated with HCV seropositivity in Phetchabun [28]. Among blood donors, HCV seropositivity was significantly associated with primary educational level [19]. In industrialized countries, education less than high school was identified as an independent risk factor for HCV infection in the United States [24], Denmark [28], France [22] and Italy [29]. Interestingly, agriculture-related occupation appears to be an independent risk factor for HCV in Thailand [19], although the specific behavior which led to the significant high prevalence of anti-HCV antibody in these individuals could not be ascertained from this study. It is possible that laborers comprising of mostly men with lower education often pursue agricultural work and have limited knowledge of the transmission of bloodborne pathogen, thus are at an increased risk of acquiring HCV.
HCV genotypes 1, 3, and 6 are known to be predominant in Thailand [9,16] and were the leading subtypes found in this study. The preponderance of subtype 6f in this region has fueled the speculation that this genotype originates in Southeast Asia [30–32]. The estimated number of HCV carriers derived from this study, if accurate, represents a significant burden of HCV and possible future cases of liver cirrhosis and hepatocellular carcinoma in Phetchabun. Treatment options with highly effective antivirals can promote viral clearance, but they are expensive and inaccessible for many individuals living in rural Thailand. Monitoring of clinical symptoms in actively infected individuals, prevention of transmission to family members and others in the community through public health interventions should therefore be a priority.
HBV and HIV, both of which are bloodborne with similar transmission routes and associated risk factors as HCV, were also examine. In this study, the HBV co-infection rate was 3.9% to 5.0% similar to the previously determined carrier rate (~4.5%) in the general Thai population of adults ≥ 27 year born before the implementation of the universal HBV immunization program [33]. In contrast to the relatively high prevalence of HCV, HIV burden was extremely low (only one instance in Phetchabun), suggesting that HCV dissemination in this region may have preceded the HIV epidemic that began around 3 decades ago.
There are many developing countries with similar socio-economic status, HCV seroprevalence, and challenges in HCV eradication as Thailand. To provide a tool for HCV risk assessment, which could be utilized in other world regions, we used the associated parameters linked to HCV seropositivity to develop a screening test. We found that the validity (AUC) of the test was 0.71 to 0.77. When the cut-off score was ≥ 6.0, the test showed 84.2% sensitivity and 34.5% specificity. We recommend this cut-off score as a preclinical screening threshold to include people who are at high risk of HCV infection prior to validating with laboratory diagnostics. Consequently, individuals who possess a cut-off score ≥ 6 should therefore avoid donating blood.
This study highlights the substantial burden of HCV infection in some rural areas of Thailand, but it has limitations. Information on HCV-associated clinical data such as liver enzyme functions, hepatic fibrosis, cirrhosis, and HCC were not sufficiently available for analysis. HCV seroprevalence was not determined for residents outside of the 30–64 year age range and living in other parts of Phetchabun. Since perhaps individuals with lower HCV risk were not included in this study, some parameters showed significance in univariate but not in multivariate analysis. Nevertheless, these data revealed the extent of HCV infection in Phetchabun, which may serve as a model for the Thai Ministry of Public Health and healthcare providers towards a better understanding of HCV epidemiology in rural Thailand. It is hoped that these data will foster a more effective public health policy and open up access to affordable treatment in endemic regions through universal health care coverage.
Supporting information
S1 Fig. Phylogenetic analysis of HCV core sequence of reference strains and those identified in this study.
Region of 295 nucleotides in length were compared to the reference HCV sequences of genotypes 1 to 7 (bolded) using MEGA. Bootstrap values >80 are indicated at the nodes. The scale bar denote nucleotide difference between close relatives.
https://doi.org/10.1371/journal.pone.0177022.s001
(TIF)
S1 Table. Unassociated factors in univariate analysis with HCV infection in Phetchabun and Khon Kaen.
https://doi.org/10.1371/journal.pone.0177022.s004
(DOCX)
S2 Table. The estimated number of HCV-seropositive and actively infected individuals in the Lom Kao and Lom Sak districts in Phetchabun and in the Chum Phae district of Khon Kaen.
https://doi.org/10.1371/journal.pone.0177022.s005
(DOCX)
S3 Table. HCV seroprevalence in Chum Phae district in Khon Kaen in 2014 [9] and this study.
https://doi.org/10.1371/journal.pone.0177022.s006
(DOCX)
Acknowledgments
We would like to thank the staff of the Center of Excellence in Clinical Virology, Faculty of Medicine, Chulalongkorn University, Lom Kao Crown Prince Hospital and Chumpae Hospital for their valuable technical and administrative assistance.
Author Contributions
- Conceptualization: RW YP.
- Data curation: RW PV N. Posuwan CA SK.
- Formal analysis: RW YP.
- Funding acquisition: YP.
- Investigation: RW PV N. Posuwan CA SK.
- Methodology: RW YP.
- Project administration: RW PV NS N. Posuwan CA SK S. Saiyatha CT YP.
- Resources: NP NT VV S. Saiyatha CT S. Sochoo S. Suwanpatoomlerd N. Pongsuwan YP.
- Software: RW YP.
- Supervision: KP PT YP.
- Visualization: RW SV KP YP.
- Writing – original draft: RW.
- Writing – review & editing: RW SV YP.
References
- 1.
WHO. Hepatitis C. 2016. http://www.who.int/mediacentre/factsheets/fs164/en/.
- 2. Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol 2006;45:529–538. pmid:16879891
- 3. Mohd Hanafiah K, Groeger J, Flaxman AD, Wiersma ST. Global epidemiology of hepatitis C virus infection: new estimates of age-specific antibody to HCV seroprevalence. Hepatology 2013;57:1333–1342. pmid:23172780
- 4. Jaeckel E, Cornberg M, Wedemeyer H, Santantonio T, Mayer J, Zankel M, et al. Treatment of acute hepatitis C with interferon alfa-2b. N Engl J Med 2001;345:1452–1457. pmid:11794193
- 5. Hajarizadeh B, Grebely J, Dore GJ. Epidemiology and natural history of HCV infection. Nat Rev Gastroenterol Hepatol 2013;10:553–562. pmid:23817321
- 6. Engle RE, Bukh J, Alter HJ, Emerson SU, Trenbeath JL, Nguyen HT, et al. Transfusion-associated hepatitis before the screening of blood for hepatitis risk factors. Transfusion 2014;54:2833–2841. pmid:24797372
- 7. Hoofnagle JH. Course and outcome of hepatitis C. Hepatology 2002;36:S21–29. pmid:12407573
- 8. Sunanchaikarn S, Theamboonlers A, Chongsrisawat V, Yoocharoen P, Tharmaphornpilas P, Warinsathien P, et al. Seroepidemiology and genotypes of hepatitis C virus in Thailand. Asian Pac J Allergy Immunol 2007;25:175–182. pmid:18035806
- 9. Wasitthankasem R, Posuwan N, Vichaiwattana P, Theamboonlers A, Klinfueng S, Vuthitanachot V, et al. Decreasing Hepatitis C Virus Infection in Thailand in the Past Decade: Evidence from the 2014 National Survey. PLoS One 2016;11:e0152451. pmid:27191955
- 10. Poovorawan K, Pan-Ngum W, White LJ, Soonthornworasiri N, Wilairatana P, Wasitthankasem R, et al. Estimating the Impact of Expanding Treatment Coverage and Allocation Strategies for Chronic Hepatitis C in a Direct Antiviral Agent Era. PLoS One 2016;11:e0163095. pmid:27631382
- 11. Songsivilai S, Jinathongthai S, Wongsena W, Tiangpitayakorn C, Dharakul T. High prevalence of hepatitis C infection among blood donors in northeastern Thailand. Am J Trop Med Hyg 1997;57:66–69. pmid:9242321
- 12. Luksamijarulkul P, Thammata N, Tiloklurs M. Seroprevalence of hepatitis B, hepatitis C and human immunodeficiency virus among blood donors, Phitsanulok Regional Blood Center, Thailand. Southeast Asian J Trop Med Public Health 2002;33:272–279. pmid:12236425
- 13. Ishida T, Takao S, Settheetham-Ishida W, Tiwawech D. Prevalence of hepatitis B and C virus infection in rural ethnic populations of Northern Thailand. J Clin Virol 2002;24:31–35. pmid:11744426
- 14. Buathong R, Hanshaoworakul W, Sutdan D, Thonghong A, Wichit W, Sridurongtham P, et al. Risk Factors of viral Hepatitis C infection among adults in a northern province, Thailand, 2006. Weekly Epidemiological Surveillance Report 2013;44:S47–56.
- 15. Akkarathamrongsin S, Praianantathavorn K, Hacharoen N, Theamboonlers A, Tangkijvanich P, Tanaka Y, et al. Geographic distribution of hepatitis C virus genotype 6 subtypes in Thailand. J Med Virol 2010;82:257–262. pmid:20029811
- 16. Wasitthankasem R, Vongpunsawad S, Siripon N, Suya C, Chulothok P, Chaiear K, et al. Genotypic distribution of hepatitis C virus in Thailand and Southeast Asia. PLoS One 2015;10:e0126764. pmid:25962112
- 17. Mellor J, Holmes EC, Jarvis LM, Yap PL, Simmonds P. Investigation of the pattern of hepatitis C virus sequence diversity in different geographical regions: implications for virus classification. The International HCV Collaborative Study Group. J Gen Virol 1995;76:2493–507. pmid:7595353
- 18. Gower E, Estes C, Blach S, Razavi-Shearer K, Razavi H. Global epidemiology and genotype distribution of the hepatitis C virus infection. J Hepatol 2014;61:S45–S57. pmid:25086286
- 19. Luksamijarulkul P, Thammata N, Sujirarat D, Tiloklurs M. Hepatitis C virus infection among Thai blood donors: antibody prevalence, risk factors and development of risk screening form. Southeast Asian J Trop Med Public Health 2004;35:147–154. pmid:15272759
- 20. Thaikruea L, Thongsawat S, Maneekarn N, Netski D, Thomas DL, Nelson KE. Risk factors for hepatitis C virus infection among blood donors in northern Thailand. Transfusion 2004;44:1433–1440. pmid:15383015
- 21. Tanwandee T, Piratvisuth T, Phornphutkul K, Mairiang P, Permpikul P, Poovorawan Y. Risk factors of hepatitis C virus infection in blood donors in Thailand: a multicenter case-control study. J Med Assoc Thai 2006;89:S79–83.
- 22. Meffre C, Le Strat Y, Delarocque-Astagneau E, Dubois F, Antona D, Lemasson JM, et al. Prevalence of hepatitis B and hepatitis C virus infections in France in 2004: social factors are important predictors after adjusting for known risk factors. J Med Virol 2010;82:546–555. pmid:20166185
- 23. Armstrong GL, Wasley A, Simard EP, McQuillan GM, Kuhnert WL, Alter MJ. The prevalence of hepatitis C virus infection in the United States, 1999 through 2002. Ann Intern Med 2006;144:705–714. pmid:16702586
- 24. Denniston MM, Jiles RB, Drobeniuc J, Klevens RM, Ward JW, McQuillan GM, et al. Chronic hepatitis C virus infection in the United States, National Health and Nutrition Examination Survey 2003 to 2010. Ann Intern Med 2014;160:293–300. pmid:24737271
- 25. Verachai V, Phutiprawan T, Theamboonlers A, Chinchai T, Tanprasert S, Haagmans BL, et al. Prevalence and genotypes of hepatitis C virus infection among drug addicts and blood donors in Thailand. Southeast Asian J Trop Med Public Health 2002;33:849–851. pmid:12757237
- 26. Rangsin R, Kana K, Chuenchitra T, Sunantarod A, Mungthin M, Meesiri S, et al. Risk Factors for HIV Infection among Young Thai Men during 2005–2009. PLoS One 2015;10:e0136555. pmid:26308085
- 27. Jatapai A, Nelson KE, Chuenchitra T, Kana K, Eiumtrakul S, Sunantarod E, et al. Prevalence and risk factors for hepatitis C virus infection among young Thai men. Am J Trop Med Hyg 2010;83:433–439. pmid:20682895
- 28. Omland LH, Osler M, Jepsen P, Krarup H, Weis N, Christensen PB, et al. Socioeconomic status in HCV infected patients—risk and prognosis. Clin Epidemiol 2013;5:163–172. pmid:23766659
- 29. Morisco F, Loperto I, Stroffolini T, Lombardo FL, Cossiga V, Guarino M, et al. Prevalence and risk factors of HCV infection in a metropolitan area in southern Italy: Tail of a cohort infected in past decades. J Med Virol 2017;89:291–297. pmid:27431017
- 30. Lu L, Li C, Fu Y, Thaikruea L, Thongswat S, Maneekarn N, et al. Complete genomes for hepatitis C virus subtypes 6f, 6i, 6j and 6m: viral genetic diversity among Thai blood donors and infected spouses. J Gen Virol 2007;88:1505–1518. pmid:17412980
- 31. Pybus OG, Barnes E, Taggart R, Lemey P, Markov PV, Rasachak B, et al. Genetic history of hepatitis C virus in East Asia. J Virol 2009;83:1071–1082. pmid:18971279
- 32. Smith DB, Bukh J, Kuiken C, Muerhoff AS, Rice CM, Stapleton JT, et al. Expanded classification of hepatitis C virus into 7 genotypes and 67 subtypes: updated criteria and genotype assignment web resource. Hepatology 2014;59:318–327. pmid:24115039
- 33. Posuwan N, Wanlapakorn N, Sa-Nguanmoo P, Wasitthankasem R, Vichaiwattana P, Klinfueng S, et al. The Success of a Universal Hepatitis B Immunization Program as Part of Thailand's EPI after 22 Years' Implementation. PLoS One 2016;11:e0150499. pmid:26938736