Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Premature Termination of MexR Leads to Overexpression of MexAB-OprM Efflux Pump in Pseudomonas aeruginosa in a Tertiary Referral Hospital in India

  • Debarati Choudhury ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    Affiliation Department of Life Science & Bioinformatics, Assam University, Silchar, Assam, India

  • Anamika Ghosh ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    ‡ These authors may be considered as second authors on this work.

    Affiliation Department of Microbiology, Assam University, Silchar, Assam, India

  • Debadatta Dhar Chanda ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    ‡ These authors may be considered as second authors on this work.

    Affiliation Department of Microbiology, Silchar Medical College and Hospital, Silchar, Assam, India

  • Anupam Das Talukdar ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    Affiliation Department of Life Science & Bioinformatics, Assam University, Silchar, Assam, India

  • Manabendra Dutta Choudhury ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    Affiliation Department of Life Science & Bioinformatics, Assam University, Silchar, Assam, India

  • Deepjyoti Paul ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    Affiliation Department of Microbiology, Assam University, Silchar, Assam, India

  • Anand Prakash Maurya ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    Affiliation Department of Microbiology, Assam University, Silchar, Assam, India

  • Atanu Chakravorty ,

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    Affiliation Department of Microbiology, Silchar Medical College and Hospital, Silchar, Assam, India

  • Amitabha Bhattacharjee

    Contributed equally to this work with: Debarati Choudhury, Anamika Ghosh, Debadatta Dhar Chanda, Anupam Das Talukdar, Manabendra Dutta Choudhury, Deepjyoti Paul, Anand Prakash Maurya, Atanu Chakravorty, Amitabha Bhattacharjee

    ab0404@gmail.com

    Affiliation Department of Microbiology, Assam University, Silchar, Assam, India

Correction

11 Mar 2016: Choudhury D, Ghose A, Chanda DD, Talukdar AD, Choudhury MD, et al. (2016) Correction: Premature Termination of MexR Leads to Overexpression of MexAB-OprM Efflux Pump in Pseudomonas aeruginosa in a Tertiary Referral Hospital in India. PLOS ONE 11(3): e0151308. https://doi.org/10.1371/journal.pone.0151308 View correction

Abstract

Objectives

The present study was undertaken to investigate the mutations that are present in mexR gene of multidrug resistant (MDR) isolates of Pseudomonas aeruginosa collected from a tertiary referral hospital of north east India.

Methods

76 MDR clinical isolates of P. aeruginosa were obtained from the patients who were admitted to or attended the clinics of Silchar medical college and hospital. They were screened phenotypically for the presence of efflux pump activity by an inhibitor based method. Acquired resistance mechanisms were detected by multiplex PCR. Real time PCR was performed to study the expression of mexA gene of MexAB-OprM efflux pump in isolates with increase efflux pump activity. mexR gene of the isolates with overexpressed MexAB-OprM efflux pump was amplified, sequenced and analysed.

Results

Out of 76 MDR isolates, 24 were found to exhibit efflux pump activity phenotypically against ciprofloxacin and meropenem. Acquired resistance mechanisms were absent in 11 of them and among those isolates, 8 of them overexpressed MexAB-OprM. All the 8 isolates possessed mutation in mexR gene. 11 transversions, 4 transitions, 2 deletion mutations and 2 insertion mutations were found in all the isolates. However, the most significant observation was the formation of a termination codon at 35th position which resulted in the termination of the polypeptide and leads to overexpression of the MexAB-OprM efflux pump.

Conclusions

This study highlighted emergence of a novel mutation which is probably associated with multi drug resistance. Therefore, further investigations and actions are needed to prevent or at least hold back the expansion and emergence of newer mutations in nosocomial pathogens which may compromise future treatment options.

Introduction

Pseudomonas aeruginosa is one of the leading opportunistic pathogen and is often found to be associated with nosocomial infections mainly in immunocompromised patients [1]. Infections caused by this organism are hard to treat because of the intrinsic resistance and the outstanding ability to acquire resistance mechanisms to several classes of antimicrobial agents during therapy which ultimately results into treatment failure. Development of resistance after exposure to antibiotics and subsequent cross-resistance between agents confers multidrug-resistant (MDR) phenotype in P. aeruginosa [2]. In absence of acquired resistance determinants, multidrug resistance (MDR) is mediated by various intrinsic resistance mechanisms which include lower outer membrane permeability and increased activity of drug specific efflux pumps with wide substrate profiles [3].

Clinically significant efflux pumps of P. aeruginosa belong to resistance-nodulation-cell division (RND) family [3]. Of all the RND pumps of P. aeruginosa, MexAB-OprM has the most wide substrate profile and can pump out a number of antibiotics belonging to different classes including beta-lactam (carboxypenicillins, aztreonam, extended-spectrum cephalosporins, penems, the carbapenems such as meropenem and panipenem except imipenem and biapenem); fluoroquinolones; tetracyclines; chloramphenicol; macrolides; novobiocin; trimethoprin and sulfonamides. It is constitutively expressed in wild type cells and overexpression of this particular pump can lead to multidrug resistant phenotype [4].

One of the important regulatory gene of MexAB-OprM operon is mexR which is located upstream of the MexAB-OprM and encodes a repressor MexR that binds as a homodimer between the intergenic region of mexR and mexA resulting in transcriptional repression of MexAB-OprM and negative autoregulation of its expression [5]. Mutations in mexR (nalB mutants) lead to hyperexpression of MexAB-OprM. In case of nalB mutants, mutations (insertion, deletion, substitution or insertion of IS elements) in mexR leads to expression of a defective MexR protein which cannot act as repressor because of loss of its dimerization/ DNA binding ability. nalC type mutants overexpress MexAB-OprM at a lower level than nalB mutatnts. nalC type mutations are found within the PA3721 gene (nalC gene). The repressor NalC encoded by nalC gene negatively autoregulates PA3720-PA3719 operon. Mutations in nalC result in loss of NalC repressor that causes overexpression of PA3720-PA3719. PA3719 (renamed ArmR) ultimately interacts with MexR and causes upregulation of mexAB-oprM [3]. Another repressor of the MexAB-OprM operon, NalD is encoded by a gene nalD. It binds to a sequence downstream of mexR and upstream of mexAB-OprM. NalD represses expression of mexA by overlapping the proximal promoter of mexA [67]. Apart from mutation in regulatory gene, oxidative stress was also found to increase transcription of MexAB-OprM. Oxidation distorts the conformation of MexR that cannot bind to the mexR-mexA intergenic region which result in hyperexpression [3].

The rate of antimicrobial resistance in northeastern part of India is quite high [8] and data regarding the mutation pattern in mexR gene is lacking from this part of the world. This present study was undertaken with a view to examine whether the mutations from this region are same as existing knowledge or any new mutation is prevailing in this region. The objective of the current study was to investigate the mutations that are present in mexR genes of MDR isolates collected from a tertiary referral hospital of north east India.

Materials and Methods

Bacterial Isolates

A total of 76 MDR clinical isolates of P. aeruginosa were obtained from the patients who were admitted to or attended the clinics of Silchar medical college and hospital, Assam, India from March, 2014 to August, 2014. MDR P. aeruginosa were selected on the basis of non-susceptibility to at least one agent in at least 3 antimicrobial classes of the following: cephalosporin (ceftazidime), β-lactam/ β-lactamase inhibitor combination, (piperacillin/tazobactam), carbapenems (imipenem, meropenem), fluoroquinolones (ciprofloxacin), aminoglycosides (gentamicin, amikacin) [9]. P. aeruginosa PAO1 (Kindly donated by Prof. Keith Poole, Queens University, Canada) was taken as the quality control strain.

Ethical Approval

The work was approved by Institutional Ethical committee of Assam University, Silchar with reference no.: IEC/AUS/2013-003. The authors confirmed that written consent in a prescribe format was obtained from patient. Consent process was approved by the institutional ethics committee.

Antimicrobial susceptibility testing and Minimum Inhibitory Concentration determination

Antibiotic susceptibility testing was performed on Mueller Hinton agar (Himedia, Mumbai, India) plates by Kirby-Bauer disc diffusion method and interpreted as per CLSI recommendations [10]. The antibiotics tested viz., meropenem (10μg) ciprofloxacin (5μg), amikacin (30μg), gentamicin (10μg), carbenicillin (10μg), polymixin B (300 μg), ceftazidime (30 μg), Piperacillin-Tazobactam (100/10 μg), faropenem (5μg) (Himedia, Mumbai, India).

Minimum inhibitory concentration (MIC) was determined on Muller Hinton Agar plates by agar dilution method against meropenem and ciprofloxacin (Himedia, Mumbai, India) according to CLSI guidelines and interpreted according to CLSI breakpoint [10].

Assessment of efflux pump activity using inhibitor based method

Efflux pump activity of the strains were phenotypically detected by using meropenem (10 mg, Himedia, Mumbai) and ciprofloxacin (5 mg, Himedia, Mumbai) with and without CCCP (carbonyl cyanide m-chlorophenylhydrazone, 100mM, Himedia, Mumbai) [11].

MIC reduction assay was performed with meropenem and ciprofloxacin alone and in combination with CCCP at a concentration of 12.5 μM [11, 12]. An efflux pump-overexpressed phenotype was defined as any strain exhibiting at least a twofold decrease in MIC when tested in the presence of CCCP.

Detection of acquired resistance determinants

To confirm the absence of specific carbapenemase and fluroquinolone resistance determinants, PCR assay was performed for detection of blaVIM, blaNDM, blaIMP, blaOXA-48, blaOXA-23, -24/40, -58, qnrA, qnrB, qnrS, and qepA. The reaction conditions and primers were used as described previously [1317].

Detection of transcription of mexA and OprD gene by quantitative real time PCR

Expression of mexA and OprD gene was determined by qRT-PCR as described previously with some modifications [18, 19]. RNA was isolated from culture grown to log phase of growth using RNeasy Kit (Qiagen, Hilden, Germany). cDNA was prepared from mRNA using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). All the Preapared cDNA were subjected to semiquantitative PCR. mRNA transcription level was determined using SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA) in Step one plus real time PCR system (Applied Biosystem, USA). Relative quantities of gene expression were calculated using the ΔΔCt method. Expression of the 30S ribosomal gene rpsL was determined in parallel as internal control.

Samples were run in triplicate. 50 ng of RNA which was reverse transcribed, was used as template. MexAB-OprM efflux pump was considered overexpressed when transcription level was atleast 2-fold higher compared with that of P. aeruginosa PAO1 [20]. Reduced OprD expression was considered significant when it was ≤30% compared with that of P. aeruginosa PAO1 [19].

Detection of mutation in mexR gene

The mexR gene of MDR isolates which do not possess acquired resistance determinants along with P. aeruginosa PAO1 were amplified using mexR gene-specific primers (forward primer: 5’-TCAGAACCTGAAACAAGGTTG-3’ and reverse primer: 5’- ATCGCCGGCGTTTTTCATTGTG-3’) (This study). Each single reaction mixture (25μl) contained 4μl of template DNA (approx. 100 ng/μl), 1μl of each primer (10 picomole), 12.5μl of GoTaq green Master Mix 2X DNA polymerase (Promega, Madison, USA) and nuclease free water.

The reaction condition was 3 min at 95°C; 35 cycles of 25 s at 95°C, 1 min at 52°C and 2 min at 72°C, and finally, 10 min at 72°C. Reaction was run in Applied Biosystem Veriti® thermal cycler (Applied Biosystem, USA). The amplified products were analyzed by 1% (w/w) agarose gel electrophoresis and visualized after staining with ethidium bromide. They were sequenced, analyzed, and compared with that of the reference strain P. aeruginosa PAO1 [7]. 30μl of purified PCR products were used for sequencing along with 20μl of primers each (20 picomole each primers). Sequencing was done by Xcelaris Lab, Ahmedabad, India and sequence results were analyzed using BLAST suite program of NCBI (http://blast.ncbi.nlm.nih.gov).

Cloning of mexR gene in a ΔmexR strain and analysis of its effect on expression of MexAB-OprM

The mutated mexR gene from AM-D-529 and wildtype mexR gene from P. aeruginosa PAO1 were amplified using forward primer 5’AGTCTTGGACTTTGTTCCAAC3’ and reverse primer: 5’ TAGGGTCGGCGTTCTTGCATGG 3’. PCR amplification was performed using 50 μl of total reaction volume. Reactions were run under the following conditions: initial denaturation at 94°C for 2 min, 32 cycles of 94°C for 25 Sec., 52°C for 1min, 72°C for 3min and final extension at 72°C for 10 min. PCR products were examined on 1.0% (w/v) agarose gels and purified using the GeneJET Gel extraction Kit (Thermo Scientific). Amplified products were cloned into pET-30a vector (Novagen) between NdeI and XhoI sites and transformed in K767-PAO1 ΔmexR (Kindly donated by Prof. K. Poole of Queens University, Canada) by heat shock method.

Expression of mexA gene of transformant was determined by real time PCR as described above.

MIC of transformants against ciprofloxacin and meropenem was determined.

DNA fingerprinting by REP PCR

REP PCR was performed to determine clonal relatedness of all the isolates selected under the present work. The primers and reaction condition used were same as described previously [21].

Results

The antibiogram profile of MDR isolates are listed in Table 1. The study isolates were of multidrug resistant phenotype. Polymixin B was found to have moderate activity. Other group of antibiotics came up with low efficacy.

thumbnail
Table 1. Antibiogram profile of MDR P. aeruginosa.

https://doi.org/10.1371/journal.pone.0149156.t001

Among 76 MDR isolates 31 and 28 were found to exhibit enhanced efflux pump activity against meropenem and ciprofloxacin respectively. 24 isolates demonstrated efflux pump activity against both meropenem and ciprofloxacin. They were above breakpoint level for meropenem and ciprofloxacin a sharp reduction in MIC was observed in all the isolates when CCCP was added (Table 2). Multiplex PCR could not establish the presence of targeted acquired resistant determinants in 11 of them.

thumbnail
Table 2. MIC reduction assay of isolates that demonstrated synergy between CCCP and one of the tested antibiotics (meropenem and ciprofloxacin).

https://doi.org/10.1371/journal.pone.0149156.t002

As these 11 isolates were devoid of acquired resistance genes, so expression of MexAB-OprM efflux pump and OprD was investigated in 11 isolates that demonstrated efflux pump activity phenotypically. Studies revealed that 8 isolates overexpressed MexAB-OprM efflux pump and 2 isolates had reduced OprD expression (Table 3).

thumbnail
Table 3. mRNA expression of mexA and OprD gene.

https://doi.org/10.1371/journal.pone.0149156.t003

In order to determine the contribution of mutation in mexR gene in overexpression of MexAB-OprM in the isolates, sequencing of the mexR gene was done. A 577 base pair of region of DNA including the mexR gene was amplified for all the 11 isolates. Strains that did not overexpress mexA had mexR sequence identical to that of PAO1 (as published by Poole in reference 7). But all the 8 strains with overexpressed mexA gene were found to possess mutation in mexR. Five isolates (AM-D-64, AM-D-352, AM-D-173, AM-D-529 and AM-D-608) were found to have 19 point mutations (PMUT1) and the rest 3 isolates carried 22 point mutation (PMUT2) (Fig 1). 11 transversions and 4 transitions were common in all the isolates. Two insertion mutation of a single nucleotide was found between 22th and 23rd base and in between 242th and 243rd base by G and T respectively (starting with position 1 at the A of the start codon of mexR). At 48th and 60th base, deletion of single nucleotide was observed in case of all the 8 isolates. Mutations at multiple sites lead to premature termination of the peptide. Termination codon was formed at 35th, 43th, 52th and 67th position as a result of mutations. Other than that, changes in amino acids were also observed at number of positions (Fig 2). It can be clearly observed that mutations not only caused the premature termination of the peptide but also lead to the formation of an altered peptide. Isolates AM-D-67, AM-D-131 and AM-D-146 in addition to the above mutations also carried three extra mutations; one transition at 245th base and two tranverstions at 244th and 246th base (Fig 1). Two mexR gene sequences with PMUT1 and PMUT2 type of mutation pattern have been submitted in GenBank with accession numbers PMUT1 KT026105 and PMUT2 KT026106 respectively.

thumbnail
Fig 1. Sequence alignment of the two type of mexR sequences (PMUT1 and PMUT2) with the mexR sequence of PAO1.

PMUT1 sequence corresponds to the first type of mutation pattern found in five isolates (AM-D-64, AM-D-352, AM-D-173, AM-D-529 and AM-D-608). PMUT2 corresponds to the second type of mutation pattern found in three isolates (AM-D-131, AM-D-146, AM-D-67). The mutations have been highlighted in grey colour and were makred with ‘*’.

https://doi.org/10.1371/journal.pone.0149156.g001

thumbnail
Fig 2. Protein sequence alignment of mexR gene of one P. aeruginosa isolate (AM-D-529, having mutation in mexR gene) with mexR gene of P. aeruginosa PAO1.

(Similar amino acids were marked as ‘*’. Stop codons are highlighted in grey colour).

https://doi.org/10.1371/journal.pone.0149156.g002

In order to further support the finding that this novel mutation in mexR contributed in overexpression of MexAB-OprM pump, the mutated mexR gene and the wildtype mexR gene were cloned in a mutant strain that lacked mexR. The expression of mexA gene in case of the transformant carring the mutated mexR gene was found to be approximately 4 fold higher (RQ value of transformant = 4.2) than that of P. aeruginosa PAO1. Whereas, expression of mexA gene in transformant carrying the wildtype mexR gene was around in the same level as that of PAO1 (RQ value = 1.48). Transformant with mutated mexR was found to be intermediately resistant towards ciprofloxacin (MIC = 2 μg/ml) and susceptible towards meropenem (MIC = 4 μg/ml).

All the eight isolates with mutated mexR gene were found to be of same REP type (Fig 3).

thumbnail
Fig 3. REP PCR showing same REP types of eight P. aeruginosa isolates with mutated mexR gene.

Lane 1: Hyper ladder (1 kb); lane 2 to 9: test samples.

https://doi.org/10.1371/journal.pone.0149156.g003

Discussion

Efflux pump mediated resistance is posing a great threat to the treatment of infections associated with P. aeruginosa in hospital settings. Overexpression of MexAB-OprM efflux pump has known to confer multi drug resistance in clinical isolates of P. aeruginosa [1]. MexR, the product of the regulator gene mexR is a transcriptional repressor of the mexA-mexB-oprM efflux pump operon [7]. Mutations in mexR leading to overexpression of MexAB-OprM efflux pump has been reported by many authors [7, 20, 22, 23].

In this study, mutation in mexR gene of MDR isolates of P. aeruginosa from a tertiary referral hospital of north east India was investigated. Out of 76 MDR isolates, 11 were found to lack plasmid mediated resistance determinants. As these 11 isolates exhibited efflux pump activity, so expression of MexAB-OprM was investigated in them. It was found that 8 of them overexpressed MexAB-OprM and carried mutation in their mexR gene. A unique mutation pattern has been observed in the present study.

Several mutations in mexR gene have been reported in previous studies. Ziha-Zafiri et al. in 1998 reported several mutations (insertion, deletion and point mutation) in mexR genes of post therapy P. aeruginosa isolates resistant to antipseudomonal beta-lactam antibiotics. They reported a T to A transversion at 377th position which resulted in the substitution of Val to Glu [22]. In the present study, this particular point mutation was observed. They also reported two amino acids substitution at 8th and 66th codons (Asp8Glu and Ala66Val). Though in the present study, substitutions were found at the same position but in this case Asp8 was substituted by Gly and Ala66 by His. Val126 to Glu substitution observed in the present study had been reported previously by a number of authors [20, 22, 23]. The substitution was considered to be insignificant. Llanes et al. in 2004 reported a Lys44 to Met susbstitution [23] but we found Lys44 to be substituted by Ser. In this study, a large number of amino acid substitution was observed in the DNA binding domain (residues 37 to 97) [24] of the MexR peptide (Fig 2).

Contribution of mutation in mexR towards overexpression of mexA gene was further confirmed by cloning the mutated mexR gene in a strain that lack mexR gene. mexA was found to be overexpressed in the transformant. But this mutation conferred intermediate resistance towards ciprofloxacin with an MIC of 2 μg/ml but could not provide resistance to meropenem. This is however obvious as per existing literature overexpression of MexAB-OprM alone could confer resistance to quinolones but supplementary mechanisms (downregulation of porin OprD) in addition to MexAB-OprM overexpresssion is needed for resistance to meropenem [25].

Though some of the mutations have already been reported by previous studies (amino acid substitution at 8th, 44th, 66th, 126th) [20, 22, 23] the most important mutation found in this study was the formation of a stop codon at 35th position that leads to termination of the peptide. The other mutations beyond the termination codon can be considered as insignificant because the peptide had already been terminated. An interesting finding of the study is that a single clone (REP type) of P. aeruginosa carrying a novel mutation in the regulatory gene (mexR) which has not been reported earlier was responsible for expansion in the hospital environment and contributed overexpression of MexAB-OprM efflux pump. Another important point has to be noted that, all the novel mutation carrying P. aeruginosa were isolated from surgical ward and ICU of the hospital. However, the isolates showed a varying antibiogram pattern although all of them were multidrug resistant.

The present investigation warrants need for proteomics studies in order to verify the expression of a truncated protein at translational level. The antibiotic pressure in this particular region of the world might have played a significant role in selection of such mutation by bacteria. In the present study, we report a new mutation pattern in mexR gene that leads to overexpression of MexAB-OprM efflux pump in the clinical isolates of P. aeruginosa.

Conclusion

This study highlighted emergence of a novel mutation which is probably associated with multi drug resistance. This opportunistic pathogen continues to threat the global health by accumulating novel mutations, complicating infection control management. Therefore, additional investigation and actions are needed to prevent or at least hold back the expansion and emergence of newer mutations in nosocomial pathogens which may compromise future treatment options. Molecular biological approach directing the investigation of the inducing agents for such mutations is crucial to overcome such critical infections. Further genomics and proteomics studies should also be taken up in order to understand the factors that contribute such mutation and overexpression of efflux pump system.

Supporting Information

S1 Table. Clinical details of P. aeruginosa isolates that demonstrated efflux pump activity phenotypically.

https://doi.org/10.1371/journal.pone.0149156.s001

(DOCX)

Acknowledgments

The authors would like to acknowledge the help from Assam University Biotech Hub for providing laboratory facility to complete this work. They also acknowledge the help of HOD, Microbiology, Assam University for providing infrastructure. e-journal access facility provided by Bioinformatics Centre, Assam University, Assam funded by DBT, Govt. of India is acknowledged. The authors are indebted to Prof. K. Poole, Queens University, Canada, for providing strains (P. aeruginosa PAO1 and P. aeruginosa knockout mutant of MexAB-OprM).

Author Contributions

Conceived and designed the experiments: DC AB. Performed the experiments: DC AB DP AG APM. Analyzed the data: DC AB ADT MDC. Contributed reagents/materials/analysis tools: AB ADT MDC DDC AC. Wrote the paper: DC AB AG DP APM ADT MDC DDC AC.

References

  1. 1. Xavier ED, Picao CR, Girardello R, Fehlberg CCL and Gales CA. Efflux pumps expression and its association with porin down-regulation and b-lactamase production among Pseudomonas aeruginosa causing bloodstream infections in Brazil. BMC Microbiol. 2010; 10:217–223. pmid:20704733
  2. 2. Hirsch EB and Tam VH. Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes. Expert Rev Pharmacoecon Outcomes Res. 2010; 10(4): 441–451. pmid:20715920
  3. 3. Lister PD, Wolter DJ and Hanson ND. Antibacterial-Resistant Pseudomonas aeruginosa: Clinical Impact and Complex Regulation of Chromosomally Encoded Resistance Mechanisms. Clin Microbiol Reviews. 2009; 22 (4): 582–610.
  4. 4. Poole K. Multidrug Efflux Pumps and Antimicrobial Resistance in Pseudomonas aeruginosa and Related Organisms. J. Mol. Microbiol. Biotechnol. 2001; 3(2): 255–264. pmid:11321581
  5. 5. Evans K, Adewoye L, and Poole K. MexR repressor of the mexABoprM multidrug efflux operon of Pseudomonas aeruginosa: identification of MexR binding sites in the mexA-mexR intergenic region. J Bacteriol. 2001; 183: 807–812. pmid:11208776
  6. 6. Saito K, Eda S, Maseda H, and Nakae T. Molecular mechanism of MexR-mediated regulation of MexAB-OprM efflux pump expression in Pseudomonas aeruginosa. FEMS Microbiol Lett. 2001; 195:23–28. pmid:11166990
  7. 7. Poole K, Tetro K, Zhao Q, Neshat S, Heinrichs DE, and Bianco N. Expression of the multidrug resistance operon mexA-mexB-oprM in Pseudomonas aeruginosa: mexR encodes a regulator of operon expression. Antimicrob Agents Chemother. 1996; 40:2021–2028. pmid:8878574
  8. 8. Maurya AP, Das Talukdar A, Dhar (Chanda) D, Chakravarty A. and Bhattacharjee A. Integron borne expansion of VEB-1 Extended spectrum beta lactamase in Pseudomonas aeruginosa in a tertiary care hospital of India. Antimicrob Agents Chemother. 2014. 58: 6966–6969. pmid:25182643
  9. 9. Sievert DM, Ricks P, Edwards JR, Schneider A, Patel J, Srinivasan A et al. Antimicrobial-resistant pathogens associated with healthcare-associated infections: summary of data reported to the national healthcare safety network at the centers for disease and prevention, 2009–2010. Infect Control Hosp Epidemiol. 2013; 34(1): 1–14. pmid:23221186
  10. 10. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement. M100–S21. 2011. CLSI, Wayne, PA, USA.
  11. 11. Pournaras S, Maniati M, Spanakis N, Ikonomidis A, Tassios PT, Tsakris A. Spread of efflux pump-overexpressing, non-metallo-b lactamase producing, meropenem-resistant but ceftazidime-susceptible Pseudomonas aeruginosa in a region with blaVIM endemicity. J Antimicrob Chemother. 2005; 56, 761–764. pmid:16115825
  12. 12. Kriengkauykiat J, Porter E, Lomovskaya O, and Wong-Beringer A. Use of an Efflux Pump Inhibitor To Determine the Prevalence of Efflux Pump-Mediated Fluoroquinolone Resistance and Multidrug Resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2005; 49 (2):565–570. pmid:15673734
  13. 13. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K et al. Characterization of a New Metallo-β-Lactamase Gene, blaNDM-1, and a Novel Erythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiella pneumoniae Sequence Type 14 from India. Antimicrob Agents Chemother. 2009; 53:5046–5054. pmid:19770275
  14. 14. Y JH, Yi K, Lee H, Yong D, Lee K, Kim JM et al. Molecular characterization of metallo-β-lacatamase-producing Acinetobacter baumannii and Acinetbacter genomospecies 3 from Korea: identification of two new integrons carrying the blaVIM-2 gene cassettes. J Antimicrob Chemother. 2002; 49:837–840 pmid:12003980
  15. 15. Shibl A, Al-Agamy M, Memish Z, Senok A, Khader SA, and Assiri A. The emergence of OXA-48 and NDM-1-positive Klebsiella pneumoniae in Riyadh, Saudi Arabia. Int. J. Infect. Diseases. 2013; 17: 1130–33.
  16. 16. Mendes RE, Bell JM, Turnidge JD, Castanheira M, and Jones RN. Emergence and widespread dissemination of OXA-23, -24/40 and -58 carbapenemases among Acinetobacter spp. in Asia-Pacific nations: report from the SENTRY Surveillance Program. Jones. J. Antimicrob Chemother. 2009; 63: 55–59. pmid:18957398
  17. 17. Wu JJ, Ko WC, Tsai SH, Yan JJ. Prevalence of plasmid-mediated quinolone resistance determinants QnrA, QnrB, and QnrS among clinical isolates of Enterobacter cloacae in a Taiwanese hospital. Antimicrobial Agents Chemother. 2007; 51:1223–7.
  18. 18. Mesaros N, Glupczynski Y, Avrain L, Caceres NE, Tulkens PM and Van Bambeke F. Combined phenotypic and genotypic method for the detection of Mex efflux pumps in Pseudomonas aeruginosa. J Antimicrob Chemother. 2007; 59:378–386. pmid:17289770
  19. 19. Rodríguez-Martínez JM, Poirel L, and Nordmann P. Molecular Epidemiology and Mechanisms of Carbapenem Resistance in Pseudomonas aeruginosa. Antimicrobial Agents Chemother. 2009; 53 (11): 4783–4788.
  20. 20. Quale J, Bratu S, Gupta J and Landman D. Interplay of Efflux System, ampC, and oprD Expression in Carbapenem Resistance of Pseudomonas aeruginosa Clinical Isolates. Antimicrobial Agents Chemother. 2006; 50 (5): 1633–1641.
  21. 21. Versalovic J, Koueth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acid Res. 1991; 19: 6823–6831. pmid:1762913
  22. 22. Ziha-Zarifi I, Llanes C, Köhler T, Peche`re JC, and Ple´siat P. In vivo emergence of multidrug-resistant mutants of Pseudomonas aeruginosa overexpressing the active efflux system MexA-MexB-OprM. Antimicrob. Agents Chemother. 1999; 43:287–291. pmid:9925520
  23. 23. Llanes C, Hocquet D, Vogne C, Benali-Baitich D, Neuwirth C and Ple´siat P. Clinical Strains of Pseudomonas aeruginosa Overproducing MexAB-OprM and MexXY Efflux Pumps Simultaneously. Antimicrob. Agents Chemother. 2004; 48 (5) 1797–1802 pmid:15105137
  24. 24. Lim D, Poole K, and Strynadka NC. Crystal structure of the MexR repressor of the mexRAB-oprM multidrug efflux operon of Pseudomonas aeruginosa. J Biol Chem. 2002; 277:29253–29259. pmid:12034710
  25. 25. Livermore DM. Of Pseudomonas, porins, pumps and carbapenems. J Antimicro Chemother. 2001; 47: 247–250.