Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Histophilus somni Stimulates Expression of Antiviral Proteins and Inhibits BRSV Replication in Bovine Respiratory Epithelial Cells

  • C. Lin,

    Affiliation Department of Pathology, University of California San Diego, San Diego, CA, United States of America

  • J. T. Agnes,

    Affiliation Department of Pathology, University of California San Diego, San Diego, CA, United States of America

  • N. Behrens,

    Affiliation Department of Pathology, Microbiology, and Immunology, School of Veterinary Medicine, University of California Davis, Davis, CA, United States of America

  • M. Shao †,

    † Deceased.

    Affiliation Department of Pathology, Microbiology, and Immunology, School of Veterinary Medicine, University of California Davis, Davis, CA, United States of America

  • Y. Tagawa,

    Affiliation Bacterial and Parasitic Diseases Research Division, National Institute of Animal Health, NARO, Tsukuba, Ibaraki, Japan

  • L. J. Gershwin,

    Affiliation Department of Pathology, Microbiology, and Immunology, School of Veterinary Medicine, University of California Davis, Davis, CA, United States of America

  • L. B. Corbeil

    lcorbeil@ucsd.edu

    Affiliations Department of Pathology, University of California San Diego, San Diego, CA, United States of America, Department of Population Health and Reproduction, School of Veterinary Medicine, University of California Davis, Davis, CA, United States of America

Abstract

Our previous studies showed that bovine respiratory syncytial virus (BRSV) followed by Histophilus somni causes more severe bovine respiratory disease and a more permeable alveolar barrier in vitro than either agent alone. However, microarray analysis revealed the treatment of bovine alveolar type 2 (BAT2) epithelial cells with H. somni concentrated culture supernatant (CCS) stimulated up-regulation of four antiviral protein genes as compared with BRSV infection or dual treatment. This suggested that inhibition of viral infection, rather than synergy, may occur if the bacterial infection occurred before the viral infection. Viperin (or radical S-adenosyl methionine domain containing 2—RSAD2) and ISG15 (IFN-stimulated gene 15—ubiquitin-like modifier) were most up-regulated. CCS dose and time course for up-regulation of viperin protein levels were determined in treated bovine turbinate (BT) upper respiratory cells and BAT2 lower respiratory cells by Western blotting. Treatment of BAT2 cells with H. somni culture supernatant before BRSV infection dramatically reduced viral replication as determined by qRT PCR, supporting the hypothesis that the bacterial infection may inhibit viral infection. Studies of the role of the two known H. somni cytotoxins showed that viperin protein expression was induced by endotoxin (lipooligosaccharide) but not by IbpA, which mediates alveolar permeability and H. somni invasion. A naturally occurring IbpA negative asymptomatic carrier strain of H. somni (129Pt) does not cause BAT2 cell retraction or permeability of alveolar cell monolayers, so lacks virulence in vitro. To investigate initial steps of pathogenesis, we showed that strain 129Pt attached to BT cells and induced a strong viperin response in vitro. Thus colonization of the bovine upper respiratory tract with an asymptomatic carrier strain lacking virulence may decrease viral infection and the subsequent enhancement of bacterial respiratory infection in vivo.

Introduction

Human or bovine respiratory disease often has a multifactorial etiology. Interactions between viruses and bacteria are known to cause more severe disease than either one alone even though both may colonize the upper respiratory tract without causing disease [13]. Several studies have revealed mechanisms of viral predisposition to bacterial pneumonia [1, 3]. We have investigated viral bacterial interactions in bovine respiratory disease (BRD) which is caused by a variety of pathogens including the following bacteria: Mannheimia haemolytica, Pasteurella multocida, Mycoplasma bovis and Histophilus somni and viruses: bovine respiratory syncytial virus (BRSV), bovine viral diarrhea virus (BVDV), bovine parainfluenza 3 (BPIV-3) and bovine herpes virus 1 (BHV-1). Our team has reproduced experimental pneumonia in calves with either H. somni [46] or BRSV alone [710]. Studies of interactions of BRSV and H. somni showed that aerosol infection of calves with BRSV 6 days before intrabronchial inoculation of H. somni, resulted in more severe pneumonia of longer duration than either pathogen alone [11]. This was associated with higher increases in specific IgE anti-H. somni levels in the dual infection than in either single infection [11]. Since BRSV and H. somni infect both upper respiratory and lower respiratory tract cells in vivo and in vitro, we have used both bovine turbinate cells (BT) and bovine alveolar type 2 (BAT2) epithelial cells for further investigation of pathogenic mechanisms. To study bacterial viral synergy, BAT2 cells were infected with BRSV 60 h before treatment with H. somni concentrated culture supernatant (CCS) for 4 h. This resulted in increased retraction of the BAT2 cells and microarray analysis showed increased BAT2 cell expression of matrix metalloproteinase (MMP)1 and MMP3 over either treatment alone [12]. The dual treatment of BAT2 cells increased passage of H. somni across the alveolar cell monolayer and increased digestion of collagen IV, a major component of the alveolar basement membrane. Thus, dual infection facilitated invasion by the bacteria [12]. We found that the IbpA was the major factor in CCS which caused retraction of BAT2 cells [13]. IbpA consists of a surface fibrillar network that is released into culture supernatant from all strains isolated from disease and most strains from asymptomatic carriers [14, 15]. However, the ibpA gene was missing in four serum sensitive strains from asymptomatic preputial carriers (1P, 129Pt, 130Pf and 133P) [16]. The complete genome sequence of one of these IbpA negative asymptomatic carrier stains (129Pt) has been reported [17]. IbpA from disease isolates of H. somni has two direct repeats (DR1 and DR2), each with a cytotoxic fic motif which adenylylates Rho GTPases interfering with the cytoskeleton [18]. The motivation for the current study came from the observation that treatment of BAT2 cells with H. somni CCS as described above increased mRNA expression of four antiviral proteins over that of either BRSV or dual treated cells. Viperin (virus-inhibitory protein, endoplasmic reticulum associated, IFN-inducible) or RSAD2 (radical S-adenosyl methionine domain containing 2) and ISG15 (IFN-stimulated gene 15—ubiquitin-like modifier) were the most up-regulated antiviral genes. Therefore we hypothesized that release of H. somni factors on the surface of respiratory epithelial cells before viral infection may inhibit subsequent viral infection, the opposite of synergy. To test this hypothesis, we investigated up-regulation of viperin protein in BAT2 cells and BT cells as well as the role of H. somni toxins on increasing expression of antiviral proteins. To address antiviral function, we examined the effect of CCS treatment of BAT2 cells on BRSV replication and mechanisms of up-regulation of antiviral genes. Lastly, adherence to BT cells was investigated because H. somni does colonize the bovine upper respiratory tract in vivo [19], does form biofilms in vitro as well as in vivo and adherence is a step in biofilm formation [20, 21]. Sustained adherence to the epithelial surface would allow continuous release of H. somni secreted products which stimulate increased expression of antiviral proteins.

Materials and Methods

Bacteria

Pathogenic H. somni strain 2336 and asymptomatic carrier H. somni strain 129Pt, which have been previously described [4, 16, 17], were grown on Difco BHI agar (BD Diagnostics, Sparks, MD) plates with 5% bovine blood in Alsever's solution (Lampire Biological Laboratories, Pipersville, PA) in candle jars at 37°C. Strain 2336.A1, with the ibpA gene deleted [22], was grown on BHI blood agar supplemented with Kanamycin (145 μg/ml). Growth from 18 h plates was suspended in BHI broth containing 0.1% Tris base and 0.01% thiamine monophosphate (BHITT). For studies of interaction of live bacteria with BT or BAT2 cells, the cfus of bacteria were estimated spectrophotometrically, since 75% light Transmission at 610 nm equals approximately 2 x108 cfu/ml. Concentrated culture supernatant (CCS) was prepared by incubating H. somni for 7 h in BHITT, with an estimated starting concentration of 5 x 107 cfu/ml. After 7 h of incubation, (approximately late log phase) the culture supernatant was concentrated 40 times with Amicon Ultra-15 Centrifugal Filter Units (EMD Millipore, Billerica, MA) and filtered through 0.22 um sterile syringe filters (EMD Millipore, Billerica, MA) as previously described [12].

Bovine Respiratory Syncytial Virus preparation

A virulent clinical isolate of BRSV (strain CA-1) was propagated in primary bovine turbinate (BT) cells as previously described (12). A 1ml aliquot was used for measuring the plaque forming units (PFU) /ml and the rest stored at -80°C in aliquots of 1ml in BT cell media containing 10% horse serum and transferred to liquid nitrogen after 2–4 hours.

BAT2 and BT cell culture

Primary bovine alveolar type 2 (BAT2) cells were isolated from newborn calf lung and kindly provided by Riccardo Rosenbusch (Iowa State University) as previously described [13] and approved by the Institutional Animal Care and Use Committee at Iowa State University. They were grown in DMEM/Defined Keratinocyte-SFM (1:1, Life Technologies, Grand Island, NY) supplemented with 2% gamma-irradiated FBS, 5 mM L-glutamine (Life Technologies, Grand Island, NY), 0.02% lactalbumin dehydrogenase (Life Technologies, Grand Island, NY) for up to 13 passages. Bovine turbinate (BT) cells (ATCC, Manassas, VA) passages 8 and 9 from a bovine turbinate cell line, were grown in DMEM containing 10% horse serum (Hyclone, ThermoFisher Scientific, Waltham, MA). Penicillin (100U/mL) and streptomycin (100 ug/mL) (Life Technologies) were added to media of both cell types, unless cells were to be treated with live H. somni. Both cell types were grown at 37°C with 5% CO2 in flasks or plates coated with 0.1% porcine gelatin (Sigma, St. Louis, MO). When appropriate, the Trypan Blue exclusion assay was used to measure cell viability. The cell suspension was mixed with an equal volume of 0.4% trypan blue solution (ThermoFisher Scientific, Waltham, MA). Viable cells, which did not take up the dye, were counted using a hemocytometer under 20x magnification. For assays other than the microarray studies, 12 well plates (Costar, Corning, Tewksbury, MA) were seeded at 3 x104 cells per well and grown to confluence before treatment with H. somni or its secreted products as described in the results section. At the indicated time points, the medium was removed and cells were immediately lysed with 100ul/well protein lysis buffer (150mM NaCl, 1% Triton X-100, 1mM EDTA, 50mM pH7.5 Tris) with protease inhibitors (cOmplete protease Inhibitor Cocktail Tablets, Roche, Indianapolis, IN) and lysates were frozen at -20°C for later Western Blot analysis.

Microarray analysis

BAT2 cells at 50% confluence were treated with BAT2 media alone or with BRSV at 0.5 MOI for 60 h at which time cells were almost confluent. This was followed by 4 h incubation with H. somni strain 2336 CCS at 20X concentration (final concentration in cell culture media) or media alone. RNA was extracted with the RNeasy minikit (Qiagen, Maryland) and gene expression was profiled using Affymetrix GeneChip bovine genome arrays, which were processed in the UC Davis School of Medicine Microarray Core Facility. The experiment was done 3 times and the data analyzed using dChip (DNA–Chip Analyszer) and DAVID (The Database for Annotation, Visualization and Integrated Discovery).

Lipooligosaccharide (LOS) preparation and quantitation

Strain 2336 LOS (also called endotoxin) was prepared by hot phenol extraction as previously reported [23, 24]. The amount of endotoxin in CCS was determined with a Pierce LAL Chromogenic Endotoxin Quantitation Kit (Thermo Scientific, Rockford, IL) according to the manufacturer’s instructions. 1 ug/ml LOS was considered to be equal to 20,000 EU/ml as reported by others [25]. This LOS preparation was used in assays of viperin expression by BT cells to investigate the role of this H. somni toxin in stimulation of antiviral proteins as described in the Results section.

Western blotting

H. somni CCS, live bacteria or BT/BAT2 cell lysates boiled in SDS loading buffer (Biorad, Hercules, CA) were loaded onto 10% SDS PAGE gels, run at 180V for 65 min, and transferred onto nitrocellulose membranes in a cold room at 30V overnight and 70V for an additional 1 h the next morning. Membranes were blocked with TBSTG (TBS + 0.05% Tween-20 + 0.3% gelatin) for 1 h. To detect viperin and GAPDH, membranes were incubated with primary antibodies to viperin, 1:100 (MAP-VIP, a generous gift from Dr. Peter Cresswell, Yale University) or mouse anti GAPDH, 1:4,000 (Life Technologies, Grand Island, NY) for 2 h at room temperature. Bacterial antigens were detected with convalescent phase serum (calves E5/E7, 1:1, at 1:1000) or rabbit (405) antibody to IbpA DR2 at 1:1000 [13]. After washing, membranes were incubated with alkaline phosphatase labeled goat anti mouse IgG (H+L) at 1:10,000, goat anti bovine IgG (H+L) at 1:16,000 or goat anti rabbit IgG (H+L) at 1:8,000 (Kirkegaard & Perry Laboratories, KPL, Gaithersburg, MA) for 1 h and developed in NBT/BCIP (Thermo Scientific Pierce, Rockford, IL) for 10 min.

Bacterial adherence assay

Adherence of H. somni strains to BT cells was done because attachment to epithelial cells is sometimes a step in mucosal colonization and in biofilm formation. Continuous release of secreted factors from H. somni at the surface of the upper respiratory tract may increase the antiviral response. Since BT cells are from the upper respiratory tract and are susceptible to BRSV and H. somni infection, those cells were used in these experiments. Adherence was determined by ELISA in 96-well plates coated with 0.01% gelatin, and seeded with 1 x 104 BT cells per well, as previously described, with modifications [26]. Coated wells without BT cells served as controls. Cells were grown to confluency and fixed with 0.05% L-glutaraldehyde (Sigma, St. Louis, MO) for 1 h. Previous studies showed that adherence to fixed cells was the same as to fresh cells but with less variability [26]. Any remaining L-glutaraldehyde was neutralized with 100mM glycine, and then the plates were washed and stored for up to one week at 4°C. Mid-logarithmic phase H. somni growth in BHITT, was diluted to approximately 2 x 10 8 bacteria/ml by spectrophotometry and 100 ul of this bacterial suspension was added to each well of BT cells at 300 MOI. After 1.5 h incubation at 37°C, wells were washed 4 times with PBS, and fixed with 5% formalin (Sigma, St. Louis, MO) in PBS. ELISA plates were blocked with 3% gelatin in PBS with 0.02% sodium azide at 37°C overnight, incubated with convalescent phase bovine serum (calves E5+E7, 1:1) at 1:1000 dilution, followed by peroxidase labeled goat anti bovine IgG (KPL, Gaithersburg, MA) and then developed with TMB sure blue (KPL, Gaithersburg, MA). The plates were read on a dual wavelength Vmax kinetic microplate reader (Molecular Devices Corp., Menlo Park, CA) at 450/650nm. Morphology of H. somni adherence was determined by treating BT cells with live bacteria at 100 MOI in 12 well plates as above but with cells grown on coverslips in the wells. Conditions were the same as for ELISA evaluation of adherence. Coverslips were washed in the wells, fixed with 4% paraformaldehyde, stained with 0.5% crystal violet for 5 m, washed and air dried.

BRSV proliferation in BAT2 cells

Confluent BAT2 cells in 12 well plates coated with 0.1% gelatin were treated with 1X CCS final concentration in BAT2 media in appropriate wells. Control wells were treated with BAT2 media alone. Six hours post initial CCS treatment, media or CCS treated wells were infected with BRSV at a concentration of 5.0 MOI. Additional wells with and without CCS treatment were not treated with BRSV. Cells in appropriate wells were retreated with 1X CCS at 24-h intervals for all time points longer than 24-h. Cells and supernatant were harvested at 24 h, 36 h, 48 h, and 72 h.

For PCR, BAT2 cells were lysed in triplicate by standard freezing and thawing, through the addition of 2-4ml fresh cold media and placing the plate into -80°C for 5 min, then removing the plate and placing into a 56°C water bath until thawed. The freeze/thaw supernatants were then combined with the BAT2 cell culture supernatants. Viral supernatants were then processed to extract the total RNA using the E.Z.N.A Viral RNA kit (Omega Bio-Tek), according the manufacturer’s directions. Extracted RNA was stored at -80°C until use. Viral cDNA was synthesized by using SuperScript III First Strand synthesis system (Invitrogen, CA), according to the manufacturer’s directions. The cDNA thermocycling program consisted of 10 min at 25°C, followed by 50 min at 50°C, and a termination cycle of 85°C for 5 min. Synthesized cDNA was stored at -20°C until use. The qRT-PCR was performed on a 384-well plate, in a 20 ul reaction volume. The 20 ul reaction mixture contained 10ul Sybr green qPCR master mix, 2 ul of BRSV-NP-F forward primer (GCAATGCTGCAGGACTAGGTATAAT), 2 ul BRSV-NP-R reverse primer (ACACTGTAATTGATGACCCCATTC), 2ul Nuclease free water, and 4ul of fresh cDNA product. The RT-PCR thermocycling program consisted of 48°C for 30 min, 95°C for 5 min, followed by 40 cycles of 95°C for 1 min and 55°C for 1 min. Fluorescence was measured following each cycle and displayed graphically (AB Applied Biosystems ViiA-7 detection software, version 1.1). ViiA-7 software was used to determine a cycle threshold (Ct) value, which identifies the first cycle at which the fluorescence is detected above the baseline for each sample or standard. The calculated Ct values for both GAP213DH and BRSV were analyzed against a standard curve. The standard curve was created using live virus, which was independently titered by TCID50. By using the TCID50 calculations for PFU and titers as the base line, this eliminated the dead virus from the calculation, as the TCID50 provides live viral concentrations. The cDNA prepared from the live virus was diluted 6 times using 10-fold dilutions for a final dilution of 1:1,000,000. From the serial dilution of virus cDNA the software determined the Ct value for each dilution. This Ct value was then converted into a log copy number. The log copy number for the neat viral sample was converted into a BRSV viral copy number using the calculation of live viral particles from the TCID50, this created the high point for the standard curve and this value was then diluted ten fold for 6 dilutions. By using the TCID50 value only live virus is measured. The Ct value for each sample for the housekeeping gene, GAPDH, and BRSV was then converted to a copy number using the standard curve. The copy number for BRSV was then divided by the copy number for GAPDH, to get the final value for viral shedding.

Statistical analysis

All graphs and statistical analyses by unpaired t tests were made using GraphPad Prism, version 6. P values of <0.05 (*) and P < 0.01 (**) were considered significant. Data presented are the means and standard error of the mean (SEM).

Results

Induction of antiviral genes by BRSV, H. somni or dual treatment of BAT2 cells

We previously showed that treatment of BAT2 cells with BRSV, H. somni CCS (20X concentration) or BRSV plus CCS caused up-regulation of mmp1 and mmp3 genes [12], with the dual treatment causing significantly more up-regulation than BRSV or H. somni CCS alone. Therefore, we investigated other changes in gene expression by microarray analysis of BAT2 cells after exposure to BRSV, CCS or dual treatment. We found that CCS alone induces up-regulation of mRNA transcripts for antiviral genes IFIH1 (interferon induced with helicase C domain 1), ISG15, MX1 (Myxovirus resistance 1), and RSAD2, also called viperin (Table 1). Interestingly, infection with BRSV or the dual treatment of BRSV followed by CCS up-regulated antiviral gene expression much less than CCS alone. These results were of special interest because H. somni may inhibit viral infection, unlike the viral bacterial synergy which is seen when the viral infection precedes the bacterial infection. Thus, we further investigated H. somni up-regulation of antiviral genes with a view to defining the role of increased antiviral proteins in inhibition of virally induced disease. ISG15 and viperin gene expression were up-regulated the most by treatment of BAT2 cells with H. somni CCS (Fig 1). We focused on viperin for studies of up-regulation of antiviral protein expression by H. somni and for studies of mechanism of up-regulation.

thumbnail
Fig 1. Histophilus somni CCS up-regulation of mRNA expressions of antiviral proteins.

BAT2 cells were treated with medium alone or H. somni strain 2336 CCS (concentrated 20X) for 6h, and mRNA was purified for microarray analysis. Fold increase was calculated as the mean number of transcripts for cells treated with CCS over that of control cells treated with medium alone. Means were calculated from three independent experiments. The IFIH1 value is the mean of the 2 IFIH1 EST results in Table 1. Note that four antiviral protein genes (IFIH1, ISG15, MX1 and RSAD2 or viperin) were greatly up-regulated in CCS treated cells as compared with BRSV treated cells. Significant differences were analyzed by two tailed unpaired t test (*, P < 0.05; **, P < 0.01, NS, not significant).

https://doi.org/10.1371/journal.pone.0148551.g001

thumbnail
Table 1. Microarray analysis of BAT2 cell gene expression after treatment with BRSV and/or H. somni CCS.

https://doi.org/10.1371/journal.pone.0148551.t001

Up-regulation of viperin protein expression in cells treated with H. somni or its secreted products

The kinetics of viperin induction by CCS was determined for both bovine upper respiratory and lower respiratory cells (bovine turbinate and alveolar epithelial cells) because H. somni can be carried in the upper respiratory tract but is found primarily in the alveolus during experimental pneumonia [4] and because BRSV infects both cell types. Although functional studies and microarray studies with BAT2 cells were done by stimulating cells with CCS concentrated 20 times [12, 13], dose response studies showed that this CCS could be diluted at least 1000 times before less viperin protein expression was detected in BT cells or BAT2 cells by Western blotting (Fig 2A and 2B). Therefore, subsequent studies used 1X CCS (equivalent to undiluted culture supernatant, which should be physiologic). Preliminary studies using the trypan blue exclusion method, showed that this concentration did not kill or inhibit proliferation of BT cells. The time course of viperin protein expression was then studied by stimulating cells with 1x concentrated CCS (equivalent to undiluted culture supernatant). Western blots of cell lysates showed that viperin protein expression was detectable in BT cells for at least 12 h (Fig 2C) and in BAT2 cells for at least 48 h after addition of CCS (Fig 2D). Thus, H. somni CCS up-regulates viperin protein expression in a dose dependent and time dependent manner in both BT and BAT2 cells.

thumbnail
Fig 2. Dose response and time course of H. somni 2336 induction of viperin protein expression.

For the dose response: BT (A) or BAT2 (B) cells were incubated with dilutions of H. somni 2336 CCS (concentrated 20X) or with BHI medium (M). Cells were lysed at indicated time points. For the time course: BT (C) or BAT 2 (D) cells were treated with H. somni 2336 1X CCS or medium (M) alone and cell lysates were collected after 6 h. In each case, cell lysates were separated by SDS PAGE and Western Blots reacted with antibody to viperin and to GAPDH. Controls with dilutions of concentrated BHI did not induce viperin expression (data not shown). Molecular weight markers are on the right.

https://doi.org/10.1371/journal.pone.0148551.g002

Effect of antiviral proteins on BRSV replication

Up-regulation of antiviral proteins in respiratory epithelial cells should result in decreased viral load in cells treated with H. somni or its culture supernatant, if the protein is functional. We tested this hypothesis in by treating BAT2 cells with H. somni CCS before infecting with BRSV since viperin protein expression was increased for longest in that cell type. BRSV was detected by qRT PCR of BAT2 control cells by 36 hours but only at very low levels of BRSV were detected in cells treated with H. somni culture supernatant throughout the 72 h study (Fig 3). So pretreatment of BAT2 cells with H. somni secreted products greatly depressed BRSV replication.

thumbnail
Fig 3. Effect of H. somni culture supernatant on BRSV replication in BAT2 cells.

Cells were treated with 1X CCS or BAT2 control medium at the time of BRSV infection (0 time) and at 24 and 48 hours post BRSV infection based on the time course of viperin expression shown in Fig 2D. BRSV proliferation determined by qRT-PCR was depressed after treatment of cells with CCS. Significant differences were analyzed by one-tailed unpaired t test (*, P < 0.05; **, P < 0.01).

https://doi.org/10.1371/journal.pone.0148551.g003

Virulence factors in H. somni CCS

Pathogenic H. somni strain 2336 culture supernatant is potent in stimulating antiviral proteins expression. Since H. somni releases two known toxins (LOS or endotoxin and the IbpA cytotoxin), we hypothesized that one of these factors in CCS may be stimulating viperin expression. BT cells were used in these experiments since inhibition of BRSV or other respiratory virus in the upper respiratory tract could result in fewer virus particles reaching the lung to produce pneumonia. Western blotting against convalescent phase serum showed that CCS contained the high molecular weight “ladder” of immunoglobulin binding proteins (IgBPs) as is characteristic of the IbpA cytotoxin as well as immunodominant 78, 60 and 40 K antigens which have not been shown to be cytotoxic (Fig 4A). Antibodies to IbpA DR2 revealed many IbpA bands from above 250 K to below 60 K, perhaps at least partly due to the multiple start codons in the IbpA gene as demonstrated earlier [27, 28]. The amount of endotoxin or LOS (the second cytotoxin) was determined by LAL assay in 3 different CCS preparations (which had been used for cytotoxicity assays in the past). Average levels of LOS in CCS were shown to be about 5.8 ug/ml (Fig 4B). To determine whether one of the two toxins (IbpA cytotoxin or LOS endotoxin) were involved in viperin induction, we compared BT cells challenged with live H. somni 2336 and the homologous strain with ibpA gene deleted (2336.A1) [22] at 10 MOI.Both the wild type (2336) and the knockout (2336.A1) induced viperin protein expression in a similar dose dependent manner, showing that the IbpA gene and protein were not necessary for H. somni up-regulation of viperin expression (Fig 5A and 5B). To determine whether H. somni LOS stimulated viperin, BT cells were treated with LOS extracted from H. somni strain 2336. Treatment of BT cells with serial dilutions of purified LOS from strain 2336 showed that as little as 8 ng/ml LOS induced a detectable amount of viperin as determined by Western blotting (Fig 5C). This is comparable to the amount of endotoxin in the highest dilution of CCS (10−3) which induced viperin expression (Fig 2), or 5.8 ng/ml as calculated from the LAL assay (Fig 4B). Whether other factors in CCS, such as H. somni OMPs, might contribute to up-regulation of viperin expression was not determined.

thumbnail
Fig 4. Virulence factors of H. somni released into the culture supernatant.

(A) Western blotting of strain 2336 CCS against convalescent phase serum (from calves E5 and E7) or rabbit antibodies to IbpA DR2 showing many high molecular weight IgBPs reacting slightly with the convalescent phase serum but strongly with anti-IbpA as well as immunodominant 78K, 60 K and 40 K antigens. Antigens are labeled on the left and molecular weight markers on the right. (B) Endotoxin levels in 3 batches of strain 2336 CCS (at 1 x concentration) as determined by LAL assay.

https://doi.org/10.1371/journal.pone.0148551.g004

thumbnail
Fig 5. Histophilus somni toxins involved in stimulating viperin expression in BT cells.

(A) Pathogenic strain 2336 and (B) the IbpA deleted strain (2336 A1) live bacteria induce viperin expression equally as shown by Western Blotting of cell lysates after 6 hrs of treatment. Therefore, IbpA is not necessary to for up-regulation of viperin. (C) Purified H. somni strain 2336 lipooligosaccharide (LOS) induces viperin expression even at very low doses, showing that LOS is sufficient to up-regulate viperin expression. All compared with treatment by medium (M) alone or strain 2336 CCS as negative and positive controls, respectively. Molecular weight markers are on the right.

https://doi.org/10.1371/journal.pone.0148551.g005

The ability of a naturally occurring ibpA negative strain 129Pt [17] to stimulate viperin expression in bovine upper respiratory epithelial cells was then determined since this strain was isolated from the epithelium of an asymptomatic carrier bull [29]. An ibpA negative strain was chosen because it lacks a critical virulence factor, so would not cause disease. Live H. somni 129Pt at a low MOI (2.5) induced viperin expression, and CCS from strain 129Pt at a 1:10,000 dilution induced as strong a viperin protein expression in BT cells as strain 2336 (Fig 6A and 6B compared with Figs 2A and 4A). These were similar results to those with the virulent strain 2336. Since colonization of the bovine upper respiratory tract with viperin inducing, non-virulent H. somni may induce antiviral protein expression and attachment is one step in colonization by biofilm formation, we examined attachment of strains 129Pt and 2336 to BT cells in vitro. Both microscopy (Fig 7A, 7B and 7C) and ELISA based assays (Fig 7D) showed that H. somni strain 129Pt adheres to BT cells approximately as well as the pathogenic strain 2336.

thumbnail
Fig 6. Viperin expression in BT cells after treatments with the IbpA negative asymptomatic carrier strain of H. somni strain129Pt.

Both CCS and live strain 129Pt induced viperin expression as determined by Western blotting. Media (M) and strain 2336 CCS were included as negative and positive controls, respectively. Molecular weight markers are on the right. Viperin induction by strain 129Pt CCS or live strain 129Pt was comparable to that of strain 2336 in Figs 2 and 5 respectively.

https://doi.org/10.1371/journal.pone.0148551.g006

thumbnail
Fig 7. Adherence of H. somni strain 2336 and 129Pt to BT cells.

Live bacteria were co-incubated with BT cells at 300 MOI in 96-well plates for 2 h, free bacteria were washed off and adherence determined by ELISA with H. somni specific antibody. The morphology of adherence is shown in Giemsa stained BT cells on coverslips treated with 100 MOI H. somni 2336, 129Pt or no bacteria. Arrows indicate adhered bacteria. Although there was variation from field to field, adherence of both strains was similar. Significant differences were analyzed by two-tailed unpaired t test (**, P < 0.01, NS, not significant).

https://doi.org/10.1371/journal.pone.0148551.g007

Discussion

This study shows that H. somni live bacteria and culture supernatant stimulate an antiviral response in the bovine upper and lower respiratory tract epithelial cells. This has implications for host resistance since bacterial/viral interactions are critical to the etiology of this polymicrobial disease, and respiratory epithelial cells are a first line of defense. All or some of the four up-regulated antiviral proteins in this study (IFIH1, ISG15, MX1 and RSAD/viperin) also were shown to be up-regulated in epithelial cells by cigarette smoke, or several viruses [3034]. In our studies, H. somni up-regulated the antiviral response strongly, but BRSV infection alone up-regulated it only a little, if any. Surprisingly, BRSV, followed by H. somni CCS, down-regulated these antiviral genes as compared with CCS alone. This suggests that antiviral responses may be up-regulated if the bacterial infection occurs first but down regulated if the BRSV infection occurs first. Although many viruses and some bacterial products have been shown to induce an antiviral response, there has been little investigation of the effect of bacterial stimulation of antiviral proteins on viral infection.

Induction of bacterial inhibition by bacterial respiratory pathogens has been demonstrated previously. We showed that some isolates of bovine nasal flora inhibit in vitro growth of bovine bacterial respiratory pathogens, others enhance pathogen growth while still others have no effect [35]. Other investigators found that human bacterial pathogens, such as Streptococcus pneumoniae and Haemophilus influenzae, compete with each other in vitro and in vivo [2]. Viral predisposition to bacterial infection has been reported by our team and by others [2, 11, 12]. However, bacterial influence on viral infection is less well investigated. Bosch et al [1] cite several studies that suggest a preceding bacterial infection may increase susceptibility to a subsequent viral infection. Our studies indicate that H. somni infection of respiratory epithelial cells may have the opposite effect on BRSV infection. With a qRT-PCR assay based on the dose response and time course of viperin protein expression, we showed that the antiviral response induced by secreted factors of H. somni was associated with decreased production of BRSV by BAT2 cells. Many studies have shown that antiviral responses initiated by many DNA and RNA viruses do inhibit viral production [3639]. For example, replication of human RSV virus in respiratory tract cells is inhibited by viperin in vitro and in vivo [34]. Large numbers of interferon stimulated genes were screened recently for antiviral activity against a panel of 14 viruses [40]. Infectivity of RSV was inhibited by several ISGs. The roles of ISG15 and RSAD2 in vivo and in vitro have been reviewed [41]. Most of the in vivo and in vitro ISG studies involved single genes investigated by ectopic expression or gene deletion. Although we did not do combinatorial studies of gene networks, our studies did look at several antiviral proteins expressed together in response to bacterial stimulation. The fact that this increased expression of several antiviral genes occurred when target respiratory epithelial cells from the natural host were treated with shed factors from bacteria involved in the disease complex suggests that the results may be relevant to disease prevention. Others have shown that infection with Salmonella typhimurium, Listeria monocytogenes, Lactobacillus acidophilus or Streptococcus agalactiae resulted in up-regulation of viperin expression by macrophages or dendritic cells but the effect on viral replication was not tested and epithelial cells responses were not examined [4244]. Little information is available on induction of antiviral proteins by bacteria with subsequent inhibition of viral replication in vitro or in vivo. Therefore, we investigated the mechanisms of H. somni induction of antiviral responses, showing that H. somni LOS but not IbpA increased viperin protein expression. Both are toxic for bovine respiratory tract epithelial and endothelial cells [13, 15, 45]. We expected that IbpA may be involved in the antiviral response, since Bordetella pertussis FHA stimulates human peripheral blood mononuclear cells to up-regulate the ISG15 antiviral protein gene [46] and H. somni IbpA and FHA are quite homologous in the N terminal region. This was not the case. The C terminal portion of H. somni IbpA, with the two fic toxic domains, has no homology to FHA and was also not associated with the antiviral response. On the other hand, very low amounts of H. somni endotoxin (LOS) stimulated strong viperin responses in a dose dependent manner. This is consistent with other studies showing that endotoxin or lipopolysaccharide is a strong inducer of antiviral proteins, including IFIH1, ISG15, MX1 and viperin [47, 48] but this has not been extended to studies of in vitro or in vivo inhibition of viral replication.

Since we showed that H. somni strain, 2336.A1, lacking the critical IbpA fic cytotoxic virulence factor, could stimulate a strong antiviral response, we determined whether a naturally occurring ibpA negative isolate from an asymptomatic carrier would have a similar effect. Future attempts to introduce a naturally occurring ibpA negative strain may be more acceptable than a genetically modified strain and an ibpA negative strain would lack the ability to cause invasive disease. We previously showed that four naturally occurring asymptomatic strains which lack the ibpA gene [16], were serum sensitive, did not cause cytotoxicity and were likely non-pathogenic members of the mucosal microbiome. We chose to study strain 129Pt, from among these four, because it has been well characterized and its genome fully sequenced [17]. It does not cause retraction of BAT2 cells, unlike IbpA positive strains [13, 15]. Both CCS and live bacteria of strain 129Pt stimulated strong viperin protein production in BT cells. We determined the ability of strain 129Pt to adhere to BT cells, as an example of bovine upper respiratory tract cells because adherence is the first step in biofilm formation. Attachment and biofilm formation in the upper respiratory tract with ibpA negative strains should result in release of LOS over time in vivo, and up-regulation of antiviral proteins to inhibit BRSV and perhaps other respiratory viral infections. This may occur naturally in cattle carrying H. somni in the upper respiratory tract and may partially explain individual animal differences in susceptibility to respiratory infection. Although biofilm formation by H. somni strain 129Pt in the upper respiratory tract of cattle has not been tested experimentally, the in vitro results provide hope that it may be possible to introduce a bovine asymptomatic carrier isolate of H. somni (like strain 129Pt) to the upper respiratory microbiome of calves by intranasal inoculation to stimulate antiviral responses and decrease susceptibility to respiratory disease. Lactobacilli are often used as probiotics in the gut, and Lactobacillus acidophilus induces strong antiviral protein gene up-regulation [43]. Maybe a similar approach could be used prophylactically in the upper respiratory tract.

Acknowledgments

We thank Lauren Crum for technical assistance, Riccardo Rosenbusch for originally supplying the BAT2 cells and Peter Cresswell for the monoclonal antibodies to viperin (MAP-VIP)

Author Contributions

Conceived and designed the experiments: LBC LJG. Performed the experiments: CL JTA NB MS YT. Analyzed the data: CL JTA NB MS. Contributed reagents/materials/analysis tools: YT. Wrote the paper: CL LBC.

References

  1. 1. Bosch AA, Biesbroek G, Trzcinski K, Sanders EA, Bogaert D. Viral and bacterial interactions in the upper respiratory tract. PLoS Pathog. 2013;9(1):e1003057. pmid:23326226
  2. 2. Murphy TF, Bakaletz LO, Smeesters PR. Microbial interactions in the respiratory tract. Pediatr Infect Dis J. 2009;28(10 Suppl):S121–6. pmid:19918134
  3. 3. Caswell JL. Failure of respiratory defenses in the pathogenesis of bacterial pneumonia of cattle. Vet Pathol. 2014;51(2):393–409. pmid:24021557
  4. 4. Gogolewski RP, Leathers CW, Liggitt HD, Corbeil LB. Experimental Haemophilus somnus pneumonia in calves and immunoperoxidase localization of bacteria. Vet Pathol. 1987;24(3):250–6. pmid:3300006
  5. 5. Gogolewski RP, Schaefer DC, Wasson SK, Corbeil RR, Corbeil LB. Pulmonary persistence of Haemophilus somnus in the presence of specific antibody. J Clin Microbiol. 1989;27(8):1767–74. pmid:2768464
  6. 6. Geertsema RS, Zekarias B, La Franco Scheuch L, Worby C, Russo R, Gershwin LJ, et al. IbpA DR2 subunit immunization protects calves against Histophilus somni pneumonia. Vaccine. 2011;29(29–30):4805–12. pmid:21557979
  7. 7. Kalina WV, Wollums AR, Berghaus RD, Gershwin LJ. Formalin-inactivated bovine RSV vaccine enhances a Th2 mediated immune response in infected cattle. Vaccine. 2004;22(11–12):1465–74. pmid:15063570
  8. 8. Kalina WV, Woolums AR, Gershwin LJ. Formalin-inactivated bovine RSV vaccine influences antibody levels in bronchoalveolar lavage fluid and disease outcome in experimentally infected calves. Vaccine. 2005;23(37):4625–30. pmid:15967545
  9. 9. Woolums AR, Gunther RA, McArthur-Vaughan K, Anderson ML, Omlor A, Boyle GA, et al. Cytotoxic T lymphocyte activity and cytokine expression in calves vaccinated with formalin-inactivated bovine respiratory syncytial virus prior to challenge. Comp Immunol Microbiol Infect Dis. 2004;27(1):57–74. pmid:14656542
  10. 10. Schmidt U, Beyer J, Polster U, Gershwin LJ, Buchholz UJ. Mucosal immunization with live recombinant bovine respiratory syncytial virus (BRSV) and recombinant BRSV lacking the envelope glycoprotein G protects against challenge with wild-type BRSV. J Virol. 2002;76(23):12355–9. pmid:12414977
  11. 11. Gershwin LJ, Berghaus LJ, Arnold K, Anderson ML, Corbeil LB. Immune mechanisms of pathogenetic synergy in concurrent bovine pulmonary infection with Haemophilus somnus and bovine respiratory syncytial virus. Vet Immunol Immunopathol. 2005;107(1–2):119–30. pmid:15979157
  12. 12. Agnes JT, Zekarias B, Shao M, Anderson ML, Gershwin LJ, Corbeil LB. Bovine respiratory syncytial virus and Histophilus somni interaction at the alveolar barrier. Infect Immun. 2013;81(7):2592–7. pmid:23649093
  13. 13. Zekarias B, Mattoo S, Worby C, Lehmann J, Rosenbusch RF, Corbeil LB. Histophilus somni IbpA DR2/Fic in virulence and immunoprotection at the natural host alveolar epithelial barrier. Infect Immun. 2010;78(5):1850–8. pmid:20176790
  14. 14. Corbeil LB, Bastida-Corcuera FD, Beveridge TJ. Haemophilus somnus immunoglobulin binding proteins and surface fibrils. Infect Immun. 1997;65(10):4250–7. pmid:9317034
  15. 15. Zekarias B, O'Toole D, Lehmann J, Corbeil LB. Histophilus somni IbpA Fic cytotoxin is conserved in disease strains and most carrier strains from cattle, sheep and bison. Vet Microbiol. 2011;149(1–2):177–85. pmid:21112704
  16. 16. Cole SP, Guiney DG, Corbeil LB. Two linked genes for outer membrane proteins are absent in four non-disease strains of Haemophilus somnus. Mol Microbiol. 1992;6(14):1895–902. pmid:1508038
  17. 17. Challacombe JF, Duncan AJ, Brettin TS, Bruce D, Chertkov O, Detter JC, et al. Complete genome sequence of Haemophilus somnus (Histophilus somni) strain 129Pt and comparison to Haemophilus ducreyi 35000HP and Haemophilus influenzae Rd. J Bacteriol. 2007;189(5):1890–8. pmid:17172329
  18. 18. Worby CA, Mattoo S, Kruger RP, Corbeil LB, Koller A, Mendez JC, et al. The fic domain: regulation of cell signaling by adenylylation. Mol Cell. 2009;34(1):93–103. pmid:19362538
  19. 19. Humphrey JD, Stephens LR. ‘Haemophilus somnus’: A Review. Vet Bull 1983;53:987–1003.
  20. 20. Sandal I, Hong W, Swords WE, Inzana TJ. Characterization and comparison of biofilm development by pathogenic and commensal isolates of Histophilus somni. J Bacteriol. 2007;189(22):8179–85. pmid:17644581
  21. 21. Sandal I, Shao JQ, Annadata S, Apicella MA, Boye M, Jensen TK, et al. Histophilus somni biofilm formation in cardiopulmonary tissue of the bovine host following respiratory challenge. Microbes Infect. 2009;11(2):254–63. pmid:19095078
  22. 22. Hoshinoo K, Sasaki K, Tanaka A, Corbeil LB, Tagawa Y. Virulence attributes of Histophilus somni with a deletion mutation in the ibpA gene. Microb Pathog. 2009;46(5):273–82. pmid:19269314
  23. 23. Inzana TJ, Iritani B, Gogolewski RP, Kania SA, Corbeil LB. Purification and characterization of lipooligosaccharides from four strains of "Haemophilus somnus". Infect Immun. 1988;56(11):2830–7. pmid:3169988
  24. 24. Gogolewski RP, Kania SA, Inzana TJ, Widders PR, Liggitt HD, Corbeil LB. Protective ability and specificity of convalescent serum from calves with Haemophilus somnus pneumonia. Infect Immun. 1987;55(6):1403–11. pmid:3570472
  25. 25. Gu XX, Chen J, Barenkamp SJ, Robbins JB, Tsai CM, Lim DJ, et al. Synthesis and characterization of lipooligosaccharide-based conjugates as vaccine candidates for Moraxella (Branhamella) catarrhalis. Infection and Immunity. 1998;66(5):1891–7. pmid:9573066
  26. 26. Sanders JD, Bastida-Corcuera FD, Arnold KF, Wunderlich AC, Corbeil LB. Genetic manipulation of immunoglobulin binding proteins of Haemophilus somnus. Microb Pathog. 2003;34(3):131–9. pmid:12631474
  27. 27. Cole SP, Guiney DG, Corbeil LB. Molecular analysis of a gene encoding a serum-resistance-associated 76 kDa surface antigen of Haemophilus somnus. J Gen Microbiol. 1993;139(9):2135–43. pmid:8245839
  28. 28. Tagawa Y, Sanders JD, Uchida I, Bastida-Corcuera FD, Kawashima K, Corbeil LB. Genetic and functional analysis of Haemophilus somnus high molecular weight-immunoglobulin binding proteins. Microb Pathog. 2005;39(5–6):159–70. pmid:16169703
  29. 29. Corbeil LB, Blau K, Prieur DJ, Ward AC. Serum susceptibility of Haemophilus somnus from bovine clinical cases and carriers. J Clin Microbiol. 1985;22(2):192–8. pmid:4031034
  30. 30. Proud D, Hudy MH, Wiehler S, Zaheer RS, Amin MA, Pelikan JB, et al. Cigarette smoke modulates expression of human rhinovirus-induced airway epithelial host defense genes. PLoS One. 2012;7(7):e40762. pmid:22808255
  31. 31. Zhao C, Collins MN, Hsiang TY, Krug RM. Interferon-induced ISG15 pathway: an ongoing virus-host battle. Trends in Microbiology. 2013;21(4):181–6. pmid:23414970
  32. 32. Smirnova NP, Webb BT, Bielefeldt-Ohmann H, Van Campen H, Antoniazzi AQ, Morarie SE, et al. Development of fetal and placental innate immune responses during establishment of persistent infection with bovine viral diarrhea virus. Virus Research. 2012;167(2):329–36. pmid:22659490
  33. 33. Proud D, Turner RB, Winther B, Wiehler S, Tiesman JP, Reichling TD, et al. Gene Expression Profiles during In Vivo Human Rhinovirus Infection Insights into the Host Response. American Journal of Respiratory and Critical Care Medicine. 2008;178(9):962–8. pmid:18658112
  34. 34. McGillivary G, Jordan ZB, Peeples ME, Bakaletz LO. Replication of respiratory syncytial virus is inhibited by the host defense molecule viperin. J Innate Immun. 2013;5(1):60–71. pmid:23018837
  35. 35. Corbeil LB, Woodward W, Ward ACS, Mickelsen WD, Paisley L. Bacterial interactions in bovine respiratory and reproductive infections. Journal of Clinical Microbiology. 1985;21(5):803–7. pmid:3998115
  36. 36. Seo JY, Yaneva R, Hinson ER, Cresswell P. Human cytomegalovirus directly induces the antiviral protein viperin to enhance infectivity. Science. 2011;332(6033):1093–7. pmid:21527675
  37. 37. Morales DJ, Lenschow DJ. The antiviral activities of ISG15. J Mol Biol. 2013;425(24):4995–5008. pmid:24095857
  38. 38. Sadler AJ, Williams BRG. Interferon-inducible antiviral effectors. Nature Reviews Immunology. 2008;8(7):559–68. pmid:18575461
  39. 39. Verhelst J, Hulpiau P, Saelens X. Mx Proteins: Antiviral Gatekeepers That Restrain the Uninvited. Microbiology and Molecular Biology Reviews. 2013;77(4):551–66. pmid:24296571
  40. 40. Schoggins JW, MacDuff DA, Imanaka N, Gainey MD, Shrestha B, Eitson JL, et al. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity. Nature. 2014;505(7485):691–5. pmid:24284630
  41. 41. Schoggins JW. Interferon-stimulated genes: roles in viral pathogenesis. Curr Opin Virol. 2014;6:40–6. pmid:24713352
  42. 42. Saitoh T, Satoh T, Yamamoto N, Uematsu S, Takeuchi O, Kawai T, et al. Antiviral protein Viperin promotes Toll-like receptor 7- and Toll-like receptor 9-mediated type I interferon production in plasmacytoid dendritic cells. Immunity. 2011;34(3):352–63. pmid:21435586
  43. 43. Weiss G, Rasmussen S, Zeuthen LH, Nielsen BN, Jarmer H, Jespersen L, et al. Lactobacillus acidophilus induces virus immune defence genes in murine dendritic cells by a Toll-like receptor-2-dependent mechanism. Immunology. 2010;131(2):268–81. pmid:20545783
  44. 44. Charrel-Dennis M, Latz E, Halmen KA, Trieu-Cuot P, Fitzgerald KA, Kasper DL, et al. TLR-Independent Type I Interferon Induction in Response to an Extracellular Bacterial Pathogen via Intracellular Recognition of Its DNA. Cell Host & Microbe. 2008;4(6):543–54.
  45. 45. Sylte MJ, Corbeil LB, Inzana TJ, Czuprynski CJ. Haemophilus somnus induces apoptosis in bovine endothelial cells in vitro. Infect Immun. 2001;69(3):1650–60. pmid:11179340
  46. 46. Dieterich C, Relman DA. Modulation of the host interferon response and ISGylation pathway by B. pertussis filamentous hemagglutinin. PLoS One. 2011;6(11):e27535. pmid:22140447
  47. 47. Severa M, Coccia EM, Fitzgerald KA. Toll-like receptor-dependent and -independent viperin gene expression and counter-regulation by PRDI-binding factor-1/BLIMP1. J Biol Chem. 2006;281(36):26188–95. pmid:16849320
  48. 48. Kandasamy S, Kerr DE. Genomic analysis of between-cow variation in dermal fibroblast response to lipopolysaccharide. Journal of Dairy Science. 2012;95(7):3852–64. pmid:22720940