Figures
Abstract
The chromosome arm 1RS of rye (Secale cereal L.) has been used worldwide as a source of genes for agronomic and resistant improvement. However, the 1RS arm in wheat has end-use quality defects that are partially attributable to the presence of ω-secalins, which are encoded by genes at the Sec-1 locus. Various attempts in removing the Sec-1 genes from the 1RS.1BL translocation chromosome have been made. In the present study, two new primary 1RS.1BL translocation lines, T917-26 and T917-15, were developed from a cross between wheat variety “A42912” and Chinese local rye “Weining.” The lines T917-15 and T917-26 carried a pair of intact and homogeneous 1RS.1BL chromosomes. The line T917-26 also harbored an expression deletion of some genes at the Sec-1 locus, which originated from a mutation that occurred simultaneously with wheat-rye chromosome translocations. These results suggest that the accompanying mutations of the evolutionarily significant translocations are remarkable resources for plant improvement. Comparison of translocation lines with its wheat parent showed improvements in the end-use quality parameters, which included protein content (PC), water absorption (WA), sodium dodecyl sulfate sedimentation (SDSS), wet gluten (WG), dry gluten (DG) and dough stickiness (DS), whereas significant reduction in gluten index (GI) and stability time (ST) were observed. These findings indicate that 1RS in wheat has produced a higher amount of protein, although these comprised worse compositions. However, in the T917-26 line that harbored an expression deletion mutation in the Sec-1 genes, the quality parameters were markedly improved relative to its sister line, T917-15, especially for GI and DS (P < 0.05). These results indicated that expression deletion of Sec-1 genes significantly improves the end-use quality of wheat cultivars harboring the 1RS.1BL translocation. Strategies to remove the Sec-1 genes from the 1RS.1BL translocation in wheat improvement are discussed.
Citation: Li Z, Ren T, Yan B, Tan F, Yang M, Ren Z (2016) A Mutant with Expression Deletion of Gene Sec-1 in a 1RS.1BL Line and Its Effect on Production Quality of Wheat. PLoS ONE 11(1): e0146943. https://doi.org/10.1371/journal.pone.0146943
Editor: Aimin Zhang, Institute of Genetics and Developmental Biology, CHINA
Received: October 20, 2015; Accepted: December 24, 2015; Published: January 14, 2016
Copyright: © 2016 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper.
Funding: This work was funded by National Natural Science Foundation of China (#31271722) (received by ZR) (http://www.nsfc.gov.cn/).
Competing interests: The authors have declared that no competing interests exist.
Introduction
Rye (Secale cereale L.) long has been recognized as valuable sources of genes for wheat improvement [1], and the short arm of rye chromosome 1R via the 1RS.1BL and 1RS.1AL translocations now resides within the genome of a large number of wheat breeding lines and elite cultivars [2,3,4,5,6,7]. Rabinovich [8] listed around 300 cultivars that harbor the 1RS chromosome arm. From the 1980s until the 2000s, approximately 70% of wheat cultivars released in southwestern China and 55% in northern China carry this chromosome arm [9, 10]. The widespread distribution of 1RS around the world has provided advantages in wheat improvement programs. A number of resistant genes of rye (Secale cereale L.) are located in chromosome arm 1RS such as genes for resistance to different rust pathogens (Lr26, Sr31, Yr9, and YrCn17), powdery mildew (Pm8 and PmCn17) [11, 12, 13, 14, 15], greenbug (Gb2) [16, 17, 18], and the Russian wheat aphid (Dn7) [19, 20]. In addition to disease and pest resistance, the 1RS arm in wheat-rye translocation also confers higher yield and adaptive advantages to wheat in various environments [5, 21, 22, 23, 24]. Comparison of the genotypes carrying the 1RS.1BL translocation with those harboring its homologous 1B chromosomes revealed that 1RS.1BL lines have higher grain and aboveground biomass yield, increased kernel weight, and better post-anthesis stress tolerance [25, 26, 27]. Furthermore, Howell et al. [28] discovered a small distal region in the 1RS arm of the 1RS.1BL translocation that has a positive impact on wheat yield and canopy water status. Ren et al. [29] identified a gene(s) in the 1RS chromosome arm that generates a stay green trait at the later filling stage that interacts with the wheat background. Based on these findings, it is thus expected that the 1RS.1BL translocation will continue to impact breeding programs around the world [30].
Unfortunately, 1RS also is known to have detrimental effects on grain processing quality [31, 32, 33]. The most typical defects include the production of sticky dough, poor fermentation, inferior dough-mixing properties, and low SDS sedimentation volumes [34, 35]. These undesirable dough properties are considered to be partially caused by the presence of ω-secalins, which are a family of small monomeric proteins, with a molecular range (Mr) of 45–55 kD, and encoded by the genes at the Sec-1 locus on the 1RS arm [36,37,38].
Several strategies have been utilized to eradicate the deleterious quality effects of the genes at the locus Sec-1 on the 1RS.1BL translocation. It is quite clear that the magnitude of the effect of 1RS on quality varies with genetic background [23, 39, 40]. Significant differences among primary 1RS.1BL lines that originated from different wheat and rye parents have been observed [27]. These primary translocation lines would have the best chances to produce 1RS.1BL lines with acceptable dough strength. Chromosome engineering by induced homoeologous recombination could also be exploited to remove the associated breadmaking quality defect of the 1RS.1BL translocation [41, 42]. Another approach is to use RNA interference methods to silence the expression of target genes [43]. However, Sec-1, which is located on the 1RS arm, is a complex locus [44, 45], and more attempts for removing these genes from this particular arm would be necessary.
In the present paper, we report a new primary 1RS.1BL translocation line that we have determined to be an expression deletion mutant of some genes at the Sec-1 locus.
Materials and Methods
Plant material
A common wheat (Triticum aestivum L.) genotype, A42912, was crossed with a Chinese local rye (S. cereal L.) variety, Weining. The F1 seedlings were soaked in 0.05% colchicine + 3% dimethyl sulfoxide for 8 h to produce the amphidiploid (C1). The C1 plants were backcrossed once or twice using the parental wheat variety A42912 to produce 1R monosomic wheat/rye addition lines. The 1R monosomic addition lines were then propagated by selfing in the isolation field. From the progeny population of monosomic addition lines, the primary 1RS.1BL translocation lines were selected [46, 47, 48]. Weining rye was collected from southwestern China. Wheat variety A42912 is a pure line of the common wheat that harbors the kr2 gene and can easily be crossed with rye. No rye chromatin in the genome of A42912 was detected by using the genome in situ hybridization (GISH) technique. A42912 is highly susceptible to stripe rust (caused by Puccinia striiformis f. sp. tritici, Pst) and powdery mildew (caused by Blumeria graminis f. sp. tritici, Bgt) in China. However, the A42912-1R monosomic addition line is resistant to these two diseases. Seeds of A42912 used in the present study were produced by single spike descent across several generations to create pure genetic stocks. Wheat cultivars Chuan-Nong 10 (CN10), which inherited their 1RS.1BL translocation chromosome from the Russian wheat cultivar Aurora, and Chuan-Nong 17 (CN17), of which the 1RS arm was derived from rye inbred line L155 (from Hohenheim, Germany), were used as controls. CN10 and CN17 were released in 2000 and 2003, respectively, and distributed across Southwest China.
Selection of translocation lines and identification of translocation chromosomes
The root mitotic metaphase cells of each plant from the progeny population of monosomic addition lines were prepared according to the methods described by Ren [48] and Han [49]. Fluorescence in situ hybridization (FISH) and GISH were used to identify the mitotic metaphase cells. The genomic DNA of Weining rye, the Aegilops tauschii clone pAs1, and the rye clone pSc119.2 were used as probes to identify the chromosomes of wheat and rye [50, 51]. The clones pAWRC.1, 6c6, and sequence CCCTAAACCCTAAACCCTAAACCCTAAA were used as probes to identify the centromeres and telomeres, respectively [52, 53]. The genomic DNA of Weining rye and the repetitive sequences pAs1 and pAWRC.1 were labeled with Texas Red-5-dUTP (Invitrogen). The repetitive sequences pSc119.2 and 6c6 and the telomere probe were labeled with Alexa Fluor-488-5-dUTP (Invitrogen). Probe labeling and in situ hybridization were also performed according to Han et al [49]. Images were captured using an epifluorescence microscope (BX51, Olympus) equipped with a cooled charge-coupled device camera, operated using an HCIMAGE Live software (version 2.0.1.5), and processed with Photoshop CS 3.0.
The plants that were determined to contain a translocation chromosome were further grown in an isolated field for the selection of pure lines of translocation. The translocation line, which contains a pair of homozygous translocation chromosomes and exhibits consistent main traits, was considered as a new primary translocation line.
Electrophoretic detection of ω-secalin and gliadin proteins (A-PAGE)
A-PAGE was conducted according to the procedure of Payne et al. [54], with minor modifications. For the extraction of gliadin and ω-secalin proteins, the crushed seeds were incubated in 70% (v/v) ethanol (3.3 μL per mg grain) for 2–3 h at room temperature with vortex mixing. The suspension was then centrifuged at 8,000g for 5 min in a microfuge. Then, the supernatant was mixed with 0.84 of its volume of 60% (v/v) glycerol and 0.05% (w/v) pyronin G, and the sample was centrifuged again to collect the sediment. Approximately 50 μL of the supernatant was used for electrophoresis. Samples were loaded onto 2 mm-thick 6% acrylamide gels and 0.3% (w/v) methylenebisacrylamide buffered at pH 3.1. The proteins were fractionated at a constant voltage of 180V for approximately 60 min until the tracking dye, pyronin G, ran off the gel. The gels were stained in 12% trichloroacetic acid (TCA) with 0.04% Coomassie brilliant blue G-250 and destained in 12% TCA [13, 38, 55, 56].
Evaluations of grain and flour quality
All 1RS.1BL translocation lines and their parents were planted with three replications in the field in Qionglai District (30°25′N, 103°28′E, and 493.3 m above sea level), Chengdu, Sichuan, China between 2012 and 2014. Each plot was 2 m long and 25 cm apart, and contained four rows with 80 seeds in each row. Field management followed standard agricultural practices. After harvesting grain samples of the new 1RS.1BL lines, its wheat parent and controls were analyzed in the laboratory. Evaluation of grain and flour quality was performed according to the procedures described by Kumlay et al. [24], Burnett et al. [34], Carver and Rayburn [35], Martin and Stewart [57], and Martín et al. [58], with minor modifications. Whole wheat was milled with a 0.5-mm screen (FOSS 1093 Cyclotec Sample Mill, Sweden). The flour was milled using a Laboratory Mill (Brabender Measurement and Control Systems, Germany). The wet gluten content (WG) and gluten index (GI) were examined with a Glutenmatic 2200 (Perten, Sweden). Protein content (PC) was detected by using a distillation unit B-324 (Buchi, Sweden) [59]. Sodium dodecyl sulfate sedimentation (SDSS) was measured according to Dexter et al. [60]. Dough stickiness was assessed following a procedure by Burnett et al. [35] and Dhaliwal and MacRitchie [36].
Results
Development of the new primary 1BL.1RS translocation lines
The wheat variety A42912, which harbored a pair of intact 1B chromosomes (Fig 1A), was easily crossed with rye variety Weining (Fig 1B). The amphidiploid plants (C1) were backcrossed twice with the wheat parent. From the progenies of hybrids (BC2F1), a monosomic addition plant of 1R (2n = 43) was selected, which exhibited a high level of resistance to stripe rust and powdery mildew and was designated as line 98–917. The progenies of the 98–917 plant were grown in an isolation field. The progeny plants showing resistance to strip rust and powdery mildew were sequentially selected and reproduced. In the BC2F5 population, five plants were selected and identified by means of FISH and GISH techniques to harbor a pair of 1RS.1BL translocation chromosomes (Fig 1C and 1D). No major differences among these translocation chromosomes of the five plants were observed using the FISH and GISH techniques (Fig 1). FISH analysis using clone 6c6 as a centromeric probe and a repetitive sequence as telomeric probe demonstrated that all these plants carried 42 intact chromosomes (Fig 1E). FISH using clones of 6c6 and species-specific probe of centromere of rye, pAWRC.1, showed that an intact 1RS chromosome arm existed in the 1RS.1BL translocation. The five plants were further reproduced as lines, respectively. Similar morphological traits for plant height, spike, leaves, seeds, and growth habit were observed among the five primary translocation lines. Compared to their wheat parent, these translocation lines showed better agronomic traits and were highly resistant to strip rust and powdery mildew in the field.
(A)–(D), FISH and GISH using rye genomic DNA (red), pSc119.2(green), and pAs1 (red) as probes. (A) and (B), Wheat and rye parents. (C) and (D), new primary 1RS.1BL translocation lines. (E), FISH using 6c6 (green) and telomere sequence (red) as probes, indicating the integrity of all chromosomes. (F), FISH using 6c6 (green) and pAWRC.1 (red) as probes, indicating that the 1RS arm is intact in the translocation.
Identification of expression deletion of ω-secalins
The expression of the genes at the sec-1 locus in the five primary 1RS.1BL translocation lines was investigated by A-PAGE. The three lines exhibited normal expression for the genes at the Sec-1 locus, whereas two lines showed an absence of expression of some genes at the Sec-1 locus (Fig 2). Because these primary 1RS.1BL translocation lines originated from the same plant with a 1R monosomic addition (2n = 43), these exhibited similar morphological characteristics. The two lines that did not express some genes at the Sec-1 locus were named T917-26, whereas the other three lines that showed intact expression of genes at the Sec-1 locus are designated as T917-15. Fig 2 shows the consistent observation that some genes at the Sec-1 locus were not expressed in the seeds harvested after two years (lanes 5 and 6, and 7 and 8), which indicated that the expression deletion mutation of the genes at Sec-1 locus in 1RS.1BL translocation line T917-26 was stable.
(L to R) 1 = wheat parent A42912, 2 = Weining rye, 3 = Chuan-nong 10, 4 = Chuan-nong 17, 5–8 = different lines of T917-26, the seeds from two years, 9 and 10 = different lines of T917-15. Arrowheads indicate the absence of expression of ω-secalins.
Effects of expression deletion of wheat Sec-1 genes on grain processing quality
Significant differences in several traits (P < 0.05) between the primary 1RS.1BLtranslocation lines and its wheat parent were observed, which included WG, dry gluten (DG), SDSS, water absorption capacity (WA), and stability time (ST), and dough stickiness (DS), with the exception of development time (DT) (Table 1). The introduction of the 1RS arm from Weining rye into wheat line A42912 resulted in a marked increase in PC, WG and DG content, SDSS, and WA, but a remarkable decrease for GI and ST, and a trend of greater DS. These alterations in 1RS.1BL translocation lines may actually lead to deleterious effects on various end-use quality traits. However, comparison of the 1RS.1BL translocation line T917-15 with its sister line T917-26 showed that the expression deletion of some genes at the Sec-1 locus on the 1RS arm notably improved its quality traits (Table 1).
Discussion
Alleviating deleterious effects of 1RS.1BL translocation on end-use quality traits
Wheat bread-making quality is influenced by a complex collection of various factors such as genetic background, environmental conditions, and agricultural practice, which function mainly by controlling grain protein concentration and compositions [61]. The effects of the 1RS chromosome arm on PC in 1RS.1BL translocation lines are very diverse, and depend on the origin of rye and its interaction with a wheat genetic background [27]. In the present study, comparison of translocation line T917-15 with its wheat parent A42912 showed that genetic difference only existed between the 1RS and 1BS arms. A significantly higher PC was observed in the new primary 1RS.1BL translocation line T917-15 compared to its wheat parent A42912 (Table 1), which was also accompanied by an increase in WG, DG, SDSS, WA and DS. However, the remarkable decrease in GI and ST simultaneously occurred, which are the main wheat quality parameters in the commercial market [62]. The decrease in GI and ST generally leads to low flour quality. These results suggest that the introduction of the 1RS arm into wheat resulted in higher protein yield, although the composition of proteins encoded by the genes on the 1RS arm was of an inferior quality to those of the 1BS arm. These undesirable protein properties are believed to be partly caused by the production of ω-secalins, which are a family of small monomeric proteins with a Mr of 45–55 kd. They replaced the ω-gliadins that are encoded by wheat genes on the 1BS arm [36]. Several strategies have been exploited to minimize the deleterious effects of the 1RS.1BL translocation on the composition of proteins, including the utilization of genetic diversity [23, 27, 39, 40], chromosome engineering by induced homoeologous recombination [41, 42], and directly removal of the Sec-1 genes by using RNA interference [43]. However, Sec-1 on the 1RS arm is a complex locus [44, 45], and thus, all attempts to remove the Sec-1 genes have got few results so far.
In the present study, we developed a new 1RS.1BL translocation line, T917-26, by crossing wheat with rye. The line T917-26 harbors an expression deletion mutation of some genes at the Sec-1 locus on the 1RS arm, which affects ω-secalins and in turn, the end-use quality traits of wheat.
Effects of expression deletion of wheat Sec-1 genes on grain processing quality
The lines T917-26 and T917-15 were fully homogeneous. They have same genetic background of wheat and 1RS, in which T917-26 is different from T917-15 only in expression deletion of Sec-1 genes and some mutations of low-molecular prolamin. Notable differences between the two translocation lines were observed for PC, SDSS, WG, ST, and WA and DS (Table 1). The quality difference between them would originate from expression deletion of Sec-1 genes and from some low-molecular prolamin mutations. However, effect of Sec-1 genes on wheat quality is much more important than effect of low-molecular prolamin [63, 64]. This results indicating that the expression deletion of some genes at the Sec-1 locus has modified the compositions of wheat proteins. Significant differences in GI and DS (P < 0.05) were also observed as a consequence of the expression deletion of some genes at the Sec-1 locus. GI and DS is an important parameter for wheat quality in the commercial market [62]. These results indicated that attempts to remove the Sec-1 genes from 1RS.1BL translocation were successful.
Origin of the expression deletion mutant of Sec-1 genes
Rye (S. cereal L.) is a cross-pollinating species consisting of genetically diverse populations with morphologically similar features. The presence of diverse genes in the 1RS arms from different plants of such populations is not unexpected. Because of genetic differences among 1RS arms and the interaction between genes on 1RS and wheat background, it is easy to understand that genetic diversity occurs in 1RS.1BL translocations derived from the same wheat parent and rye variety. However, in the present study, 1RS.1BL translocation lines T917-26 and T917-15 derived from the same 1R monosomic addition plant, which originated from a wheat pure line and one 1R chromosome. The T917-26 and T917-15 is thus assumed to contain identical wheat chromosomes and 1RS arm. The experimental results identified differences in the Sec-1 between these two sister lines. The expression deletion of the Sec-1 genes was a mutation that simultaneously occurred with the wheat-rye chromosome translocation. Frequent aberrations of wheat and rye chromosomes have been observed, which were induced by the monosomic addition of rye chromosomes into that of wheat [50]. The results of the present study described the effects of induction of evolutionarily significant translocations in wheat and rye chromosomes. The accompanying mutations may be utilized as valuable resources for plant improvement.
Strategies to improve the quality of the wheat cultivars harboring the 1RS.1BL chromosome
Various methods have been utilized to improve the processing quality of 1RS.1BL wheat. The procedure to remove Sec-1 genes could directly improve the composition of wheat proteins. In the present study, we have developed a mutant that harbored expression deletion of some genes at the Sec-1 locus on the 1RS arm. The mutation simultaneously occurred with evolutionarily significant translocations between chromosomes of wheat and rye. Using this approach, different new 1RS.1BL lines may be developed, which could contain various expression deletion mutations of genes at the Sec-1 locus on the 1RS arm. Through genetic recombination of different expression deletion mutants of Sec-1 genes, we have developed new 1RS.1BL lines, which carried the 1RS.1BL chromosome with partial or whole gene deletions at the Sec-1 locus. Using a combination of suitable gluten in alleles and deletion mutants of Sec-1 genes, it is possible to improve the end-use quality of wheat cultivars that harbor the 1RS.1BL chromosome [33, 39, 65].
Conclusions
The simultaneous occurrence of the evolutionarily significant translocation of the wheat-rye chromosomes also results in gene mutations, which we call accompanying mutations. The accompanying mutations are valuable resources for plant improvement. A mutant with the expression deletion of some genes at the Sec-1 locus on the 1RS arm was selected and identified by using FISH, GISH, and biochemical analyses. The new 1RS.1BL translocation line with an expression deletion mutation of Sec-1 genes possessed better end-use quality traits than its sister line, which did not carry this particular mutation. The disadvantageous genes in evolutionarily significant translocations may be effectively removed by using this new method.
Acknowledgments
We gratefully acknowledge the financial support from the National Natural Science Foundation of China (#31271722). We also acknowledge excellent technical assistance provided by Mrs H.Q. Zhang.
Author Contributions
Conceived and designed the experiments: TR ZR. Performed the experiments: ZL TR MY. Analyzed the data: ZL TR. Contributed reagents/materials/analysis tools: BY FT ZR. Wrote the paper: ZL TR.
References
- 1. Ren TH, Chen F, Zou YT, Jia YH, Zhang HQ, Yan BJ, et al. (2011) Evolutionary trends of microsatellites during speciation process and phylogenetic relationships in the genus Secale. Genome 54, 316–326. pmid:21491974
- 2.
Mettin D, Bluthner WD, Schlegel G (1973) Additional evidence on spontaneous 1B/1R wheat–rye substitutions and translocation. In: Sears ER, Sears LMS (eds) Proceedings fourth International Wheat Genetic Symposium, Mo Agric Exp Stn Columbia 179–184.
- 3.
Zeller FJ (1973) 1B/1R wheat-rye chromosome substitutions and translocations. In: Sears ER, Sears LMS (eds) Proceedings fourth International Wheat Genetic Symposium. Mo Agric Exp Stn Columbia 209–221.
- 4. Baum M, Appels R (1991) The cytogenetic and molecular architecture of chromosome 1R-one of the most widely utilized sources of alien chromatin in wheat varieties. Chromosoma 101, 1–10. pmid:1769268
- 5. Lelley T, Eder C, Grausgruber H (2004) Influence of 1BL.1RS wheat-rye chromosome translocation on genotype by environment interaction. Journal of Cereal Science 39, 313–320.
- 6. Schlegel R, Korzun V (1997) About the origin of 1RS.1BL wheat–rye chromosome translocations from Germany. Plant Breed 116, 537–540.
- 7.
Sebesta EE, Wood EA (1978) Transfer of greenbug resistance from rye to wheat with X-rays. Agron Abstr American Society of Agronomy, Madison, Wisconsin 61–62.
- 8. Rabinovich SV (1998) Importance of wheat-rye translocations for breeding modern cultivars of Triticum aestivum L. Euphytica 100, 323–340.
- 9. Yang ZJ, Ren ZL (1997) Expression of gene Pm8 for resistance to powdery mildew in wheat for Sichuan. J Sichuan Agric Univ 15:452–456.
- 10. Zhou Y, He ZH, Zhang GS, Xia LQ, Chen XM, Gao YC, et al. (2004) Utilization of 1BL/1RS translocation in wheat breeding in China. Acta Agron Sin 30:531–535.
- 11. Zeller FJ, Fuchs E (1983) Cytology and disease resistance of 1A/1R and some 1B/1R wheat–rye translocation cultivars. Z. Pflanzenzücht 90:285–296.
- 12. Singh NK, Shepherd KW, McIntosh RA (1990) Linkage mapping of genes for resistance to leaf, stem and stripe rusts and ω-secalins on short arm of rye chromosome 1R. Theoretical Applied Genetics 80, 609–616. pmid:24221066
- 13. Berzonsky WA, Clements RL, Lafever HN (1991) Identification of ‘Amigo’ and ‘Kavkaz’ translocations in Ohio soft red winter wheats (Triticum aestivum L.). Theoretical and Applied Genetics 81, 629–634. pmid:24221378
- 14. Mago R, Miah H, Lawrence GJ, Wellings CR, Spielmeyer W, et al. (2005) High- resolution mapping and mutation analysis separate the rust resistance genes Sr31, Lr26 and Yr9 on the short arm of rye chromosome 1. Theoretical Applied Genetics 112, 41–50. pmid:16283230
- 15. Ren TH, Yang ZJ, Yan BJ, Zhang HQ, Fu SL, Ren ZL (2009) Development and characterization of a new 1BL.1RS translocation line with resistance to stripe rust and powdery mildew of wheat. Euphytica 169:207–213.
- 16. Hollenhors MM, Joppa LR (1983) Chromosomal location of the genes for resistance to greenbug in 'Lago' and `Amigo' wheats. Crop Science 23, 91–93.
- 17. Tyler JM, Webster JA, Merkle OG (1987) Designations for genes in wheat germplasm conferring greenbug resistance. Crop Science. 27, 526–527.
- 18. Mater Y, Baenziger S, Gill K, Graybosch R, Whitcher L, Baker C, et al. (2004) Linkage mapping of powdery mildew and greenbug resistance genes on recombinant 1RS from ‘Amigo’ and ‘Kavkaz’ wheat–rye translocations of chromosome 1RS.1AL. Genome 47, 292–298. pmid:15060581
- 19. Marais GF, Horn M, Du Toit F (1994) Intergeneric transfer (rye to wheat) of a gene(s) for Russian wheat aphid resistance. Plant Breeding 113, 265–271.
- 20. Lapitan NLV, Peng J, Sharma V (2007) A high-density map and PCR markers for Russian wheat aphid resistance gene Dn7 on chromosome 1RS/1BL. Crop Science 47, 811–820.
- 21. Villareal RL, del Toro E, Rajaram S, Mujeeb-Kazi A (1996) The effect of chromosome 1AL/1RS translocation on agronomic performance of 85 F2-derived F6 lines from three Triticum aestivum L. crosses. Euphytica 89, 363–369.
- 22. McKendry AL, Tague DN, Miskin KE (1996) Effect of 1RS.1BL on agronomic performance of soft red winter wheat. Crop Science 36, 844–847.
- 23. Kim W, Johnson JW, Baenziger PS, Lukaszewski AJ, Gaines CS (2004) Agronomic effect of wheat-rye translocation carrying rye chromatin (1R) from different sources. Crop Science 44, 1254–1258.
- 24. Kumlay AM, Baenziger PS, Gill KS, Shelton DR, Graybosch RA, Lukaszewski AJ, et al. (2003) Understanding the effect of rye chromatin in bread wheat. Crop Science 43, 1643–1651.
- 25. Villareal RL, Rajaram S, Mujeeb-Kazi A, Del Toro E (1991) The effect of chromosome 1B/1R translocation on the yield potential of certain spring wheats (Triticum aestivum L.). Plant Breeding 106, 77–81.
- 26. Moreno-Sevilla B, Baenziger PS, Peterson CJ, Graybosch RA, McVey DV (1995) The 1BL/1RS translocation: agronomic performance of F3-derived lines from a winter wheat cross. Crop Science 35, 1051–1055.
- 27. Ren TH, Chen F, Yan BJ, Zhang HQ, Ren ZL (2012) Genetic diversity of wheat–rye 1BL.1RS translocation lines derived from different wheat and rye sources. Euphytica 183, 133–146.
- 28. Howell T, Hale I, Jankuloski L, Bonafede M, Gilbert M, Dubcovsky J (2014) Mapping a region within the 1RS.1BL translocation in common wheat affecting grain yield and canopy water status. Theoretical Applied Genetics 127, 2695–2709. pmid:25322723
- 29. Ren TH, Yan BJ, Zhang HQ, Ren ZL (2009) Effect of 1RS.1BL translocation chromosome on stay green trait in common wheat (Triticum aestivum L.). Journal of Triticeae Crops, 29, 419–423.
- 30. Zhao CH, Cui F, Wang XQ, Shan SC, Li XF, Bao YG, Wang HG (2012) Effects of 1BL/1RS translocation in wheat on agronomic performance and quality characteristics. Field Crops Research 127, 79–84.
- 31. Shewry PR, Parmar S, Fulrath N, Kasarda DD, Miller TE (1986) Chromosomal locations of the structural genes for secalins in wild perennial rye (Secale montanum Guss.) and cultivated rye (S. cereale L.) determined by two-dimensional electrophoresis. Canadian Journal of Genetics and Cytology 28, 76–83.
- 32. Moreno-Sevilla B, Baenziger PS, Shelton DR, Graybosch RA, Peterson CJ (1995) Agronomic performance and end-use quality of 1B vs. 1BL/1RS genotypes derived from winter wheat ‘Rawhide’. Crop Science 35, 1607–1612.
- 33. Graybosch RA (2001) Uneasy unions: Quality effects of rye chromatin transfers to wheat. Journal of Cereal Science 33, 3–16.
- 34. Burnett CJ, Lorenz KJ, Carver BF (1995) Effects of the 1B/1R translocation in wheat on composition and properties of grain and flour. Euphytica 86, 159–166.
- 35. Carver BF, Rayburn AL (1995) Comparison of related wheat stocks possessing 1B or T1BL.1RS chromosomes: grain and flour quality. Crop Science 35, 1316–1321.
- 36. Dhaliwal AS, MacRitchie F (1990) Contributions of protein fractions to dough handling properties of wheat-rye translocations cultivars. Journal of Cereal Science 12, 113–122.
- 37. Graybosch RA, Peterson CJ, Hansen LE, Worrall D, Shelton DR, Lukaszewski A (1993) Comparative flour quality and protein characteristics of 1BL/1RS and 1AL/1RS wheat-rye translocation. Journal of Cereal Science 17, 95–106.
- 38. Hussain A, Lukow OM (1994) Characterization of the 1B/1R translocation in wheat using water extractable protein concentrate. Euphytica 78, 109–113.
- 39. Gobaa S, Brabant C, Kleijer G, Peter Stamp P (2008) Effect of the 1BL.1RS translocation and of the Glu-B3 variation on fifteen quality tests in a doubled haploid population of wheat (Triticum aestivum L.). Journal of Cereal Science 48, 598–603.
- 40. Moiraghi M, Vanzetti L, Pflüger L, Helguera M, Teresa Pérez GT (2013) Effect of high molecular weight glutenins and rye translocations on soft wheat flour cookie quality. Journal of Cereal Science 58, 424–430.
- 41. Lukaszewski AJ (2001) Breeding behavior of the cytogenetically engineered wheat-rye translocation chromosomes 1RS.1BL. Crop Science 41, 1062–1065.
- 42. Anugrabwati DR, Shepherd KW, Verlin DC, Zhang P, Mirzaghaderi G, Walker E, et al. (2008) Isolation of wheat-rye 1RS recombinants that break the linkage between the stem rust resistance gene SrR and secalin. Genome 51, 341–349. pmid:18438437
- 43. Chai JF, Lu X, Jia JZ (2005) Homoelogous cloning of ω-secalin gene family in a wheat 1BL/1RS translocation. Cell Research 15, 658–664. pmid:16117855
- 44. Clarke BC, Appels R (1999) Sequence variation at the Sec-1 locus of rye, Secale cereale (Poaceae). Plant Systematics and Evolution 214, 1–14.
- 45. Clarke BC, Mukai Y, Appels R (1996) The Sec-1 locus on the short arm of chromosome 1R of rye (Secale cereale). Chromosoma 105, 269–275. pmid:8939819
- 46. Ren ZL, Lelley T, Röbbelen G (1990) The use of monosomic rye addition lines for transferring rye chromatin into bread wheat. I. The occurrence of translocations. Plant Breeding 105, 257–264.
- 47. Ren ZL, Lelley T, Röbbelen G (1990) The use of monosomic rye addition lines for transferring rye chromatin into bread wheat. II. The breeding value of homozygous wheat/rye translocations. Plant Breeding 10, 265–270.
- 48. Ren ZL, Zhang HQ (1997) Induction of small-segment-translocation between wheat and rye chromosomes. Science in China (Ser C) 40, 323–331.
- 49. Han FP, Lamb JC, Birchler JA (2006) High frequency of centromere inactivation resulting in stable dicentric chromosomes of maize. Proc Natl Acad Sci USA 103, 3238–3243. pmid:16492777
- 50. Fu S, Yang M, Fei Y, Tan F, Ren Z, Yan B, et al. (2013) Alterations and abnormal mitosis of wheat chromosomes induced by wheat-rye monosomic addition lines. PLoS ONE 8(7), e70483. pmid:23936213
- 51. Tang Z, Li M, Chen L, Wang Y, Ren Z, Fu S (2014) New types of wheat chromosomal structural Variations in derivatives of wheat-rye hybrids. PLoS ONE 9(10), e110282. pmid:25302962
- 52. Francki MG (2001) Identification of Bilby, a diverged centromeric Ty1-copia retrotransposon family from cereal rye (Secale cereale L.). Genome 44, 266–274. pmid:11341737
- 53. Tang ZX, Fu SL, Ren ZL, Zhang HQ, Yang ZJ, Yan BJ (2009) Characterization of three wheat cultivars possessing new 1BL.1RS wheat-rye translocations. Plant Breeding 128, 524–527.
- 54. Payne PI, Holt LM, Worland AJ, Law CN (1982) Structural and genetical studies on the high-molecular- weight subunits of wheat glutenin. 3. Telocentric mapping of subunit genes on the long arms of the homoeologous group 1 chromosomes. Theoretical and Applied Genetics 63, 129–138. pmid:24270760
- 55. Jones BL, Lookhart GL, Hall SB, Finney KF (1982) Identification of wheat cultivars by gliadin electrophoresis: electrophoregrams of the 88 wheat cultivars most commonly grown in the U.S. in 1979. Cereal Chemistry 59, 181–188.
- 56. Zhou JW, Han CX, Cao H, Zhen SM, Yu ZT, Li XH, et al. (2013) Fast identification of wheat 1BL.1RS translocation by reversed-phase ultra-performance liquid chromatography (RP-UPLC). Crop Pasture Sci 64: 865–873.
- 57. Martin DJ, Stewart BG (1990) Dough stickiness in rye-derived wheat cultivars. Euphytica 51, 77–86.
- 58. Martín P, Gómez M, Carrillo JM (2001) Interaction between allelic variation at the Glu-D1 locus and a 1BL.1RS translocation on flour quality in bread wheat. Crop Science 41, 1080–1084.
- 59. Li HM, Tang ZX, Zhang HQ, Yan BJ, Ren ZL (2013) Major quality trait analysis and QTL detection in hexaploid wheat in humid rain-fed agriculture. Genetics and Molecular Research 12, 1740–1751. pmid:23765980
- 60. Dexter JE, Matsuo RR, Kosmolak FG, Leisle D, Marchylo BA (1980). The suitability of the SDS-sedimentation test for assessing gluten strength in durum wheat. Can J Plant Sci 60, 25–29.
- 61. Singh M, Khatkar BS (2005) Structural and functional properties of wheat storage proteins: a review. Journal of Food Science and Technology 42, 455–471.
- 62. Har Gil D, Bonfilb DJ, Svoray T (2011) Multi scale analysis of the factors influencing wheat quality as determined by Gluten Index. Field Crops Research 123, 1–9.
- 63. Wieser H, Seilmeier W, Belitz HD (1994) Quantitative determination of gliadin subgroups from different wheat cultivars. J Cereal Sci, 19, 149–155.
- 64. Gianibelli MC, Larroque OR, MacRitchie F (2001) Biochemical, genetic, molecular characterization of wheat glutenin and its component subunits. Cereal Chem, 78:635–646
- 65. Bonafede MD, Tranquilli G, Pflüger LA, Pena RJ, Dubcovsky J (2015) Effect of allelic variation at the Glu-3/Gli-1 loci on breadmaking quality parameters in hexaploid wheat (Triticum aestivum L.). Journal of Cereal Science 62, 143–150.