Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Adenomatous Polyposis Coli Mutation Leads to Myopia Development in Mice

  • Zhen Liu ,

    Contributed equally to this work with: Zhen Liu, Fangfang Qiu

    Current address: Medical College of Xiamen University, 4th Floor, Chengyi Building, Xiang-an campus of Xiamen University, South Xiang-an Road, Xiamen, Fujian, China

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯
  • Fangfang Qiu ,

    Contributed equally to this work with: Zhen Liu, Fangfang Qiu

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯
  • Jing Li,

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯
  • Zhenzhen Zhu,

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯
  • Wenzhao Yang,

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯
  • Xiangtian Zhou,

    Affiliations School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China, Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang, China

    ⨯
  • Jianhong An,

    Affiliations School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China, Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang, China

    ⨯
  • Furong Huang,

    Affiliations School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China, Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang, China

    ⨯
  • Qiongsi Wang,

    Affiliations School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China, Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang, China

    ⨯
  • Peter S. Reinach,

    Affiliations School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China, Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang, China

    ⨯
  • Wei Li,

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯
  • Wensheng Chen,

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯
  • Zuguo Liu

    zuguoliu@xmu.edu.cn

    Current address: Medical College of Xiamen University, 4th Floor, Chengyi Building, Xiang-an campus of Xiamen University, South Xiang-an Road, Xiamen, Fujian, China

    Affiliation Eye Institute of Xiamen University, Fujian Provincial Key Laboratory of Ophthalmology and Visual Science, Xiamen, China

    ⨯

Abstract

Myopia incidence in China is rapidly becoming a very serious sight compromising problem in a large segment of the general population. Therefore, delineating the underlying mechanisms leading to myopia will markedly lessen the likelihood of other sight compromising complications. In this regard, there is some evidence that patients afflicted with familial adenomatous polyposis (FAP), havean adenomatous polyposis coli (APC) mutation and a higher incidence of myopia. To clarify this possible association, we determined whether the changes in pertinent biometric and biochemical parameters underlying postnatal refractive error development in APCMin mice are relevant for gaining insight into the pathogenesis of this disease in humans. The refraction and biometrics in APCMin mice and age-matched wild-type (WT) littermates between postnatal days P28 and P84 were examined with eccentric infrared photorefraction (EIR) and customized optical coherence tomography (OCT). Compared with WT littermates, the APCMin mutated mice developed myopia (average -4.64 D) on P84 which was associated with increased vitreous chamber depth (VCD). Furthermore, retinal and scleral changes appear in these mice along with: 1) axial length shortening; 2) increased retinal cell proliferation; 3) and decreased tyrosine hydroxylase (TH) expression, the rate-limiting enzyme of DA synthesis. Scleral collagen fibril diameters became heterogeneous and irregularly organized in the APCMin mice. Western blot analysis showed that scleral alpha-1 type I collagen (col1α1) expression also decreased whereas MMP2 and MMP9 mRNA expression was invariant. These results indicate that defective APC gene function promotes refractive error development. By characterizing in APCMin mice ocular developmental changes, this approach provides novel insight into underlying pathophysiological mechanisms contributing to human myopia development.

Introduction

Myopia is a global public health problem severely impacting on the quality of life [1]. Higher degrees of myopia are a risk factor for ocular complications, such as glaucoma, retinal degeneration, and choroidal neovascularization leading to permanent visual impairment and even blindness [2,3]. Although numerous potential human risk factors have been identified, the underlying mechanisms contributing to ocular growth regulation and refractive error development remain largely unclear.

Recent studies on myopia in humans and animal models suggest that excessive axial length elongation [4,5], increased retinal proliferation [6], degenerative scleral changes [7,8] are associated with myopia development. Although the molecular mechanisms underlying these changes require further elucidation, this condition alters expression levels of various neurotransmitter mediators, and hormones including muscarinic receptors [9]. Dopamine (DA) pharmacology [10] and responses induced by retinoic acid [11], glucagon [12] and EGR-1(also named ZENK) [13] which contribute to myopia and visual development are also modified by, DA control modulation affects ocular growth by acting mostly as a ‘stop signal’ of this process [14]. Such a role is indicated for DA since retinal DA levels and TH activity declined in eyes deprived of sharp vision by using either diffusers (form deprivation myopia, FDM) or minus lenses (lens induced myopia, LIM) [15–17].

The adenomatous polyposis coli (APC) gene has 15 exons, localized to the long arm of chromosome 5(5q21- q22) [18]. APC is an ubiquitously expressed tumor suppressor protein, which has essential roles in regulating cell cycle progression, migration, differentiation and apoptosis [19]. During early embryonic eye development, APC mRNA is abundantly expressed in the neural retinal and retinal pigment epithelial (RPE) cells [20]. The majority of sequence aberrations in APC are frameshift or nonsense mutations leading to truncated protein expression [21]. More than 50 adenomatous polyps in the colon and rectum [22] are characteristic of familial adenomatous polyposis (FAP) caused by APC mutations. Congenital retinal pigment epithelial hypertrophy (CHRPE) is the most frequent manifestation of FAP [22]. Several APC-mutant mouse models have been generated resembling the FAP and colon cancer phenotype [23]. Mice with a disrupted APC gene also develop RPE hypertrophy [24]. It has been reported that 10 out of 14 FAP individuals with refraction anomalies had myopia ranging from -0.5 to -10.0 diopters (mean, -3.1 diopters) [22]. These considerations are suggestive of a potential role for an APC mutation contributing to refractive error development.

In the present study, we examined in APCMin mice the association between myopia development and time dependent changes in refractive and biometric parameters to elucidate the functional role of an APC mutation (APCMin) in this process. The APCMin mice generated by random ethylnitrosourea (ENU) mutagenesis, carries in the APC gene a nonsense mutation at codon 850 leading to adult onset anemia and multiple intestinal neoplasia (Min) [25]. We observed a greater myopic shift, increased vitreous chamber depth and scleral collagen fibril rearrangement. In addition, retinal proliferation increased whereas TH expression declined.

Materials and Methods

Experimental Animals

Age-matched male APCMin mice (stock number 002020) on the C57BL/6 background and wild-type (WT) male C57BL/6 mice (purchased from Nanjing Biomedical Research Institute of Nanjing University, China) were used for this study. All animals were housed in cages at 25°C, on a 12:12 light-dark hour cycle, with food and water available ad libitum. Luminance in the cages was approximately 200 lux. All procedures were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The protocols in our study were approved by the Committee on the Ethics of Animal Experiments of Xiamen University (Permit Number: XMUMC2012-12-9)

APCMin mice were genotyped following a PCR protocol recommended by the Jackson Laboratory. A total of 26 mice were separated into 13 APCMin mice and 13 wild-type mice. Each group underwent a series of ocular measurements at each of the following 6 postnatal time points: 28, 35, 42, 56, 70 and 84 days. All samples and measurements were obtained during the light period, at least two hours after lights-on and two-hours before lights-off. First, their refractive state was measured. Subsequently, mice were anesthetized by intraperitoneal injection of 1.2% ketamine (70 mg/kg body weight) /1.6% xylazine (10 mg/kg body weight) mixture and ocular dimensions were measured.

Biometric Measurements

Postnatal refractive state development of the right eyes was characterized based on measurements of corneal radius of curvature (CRC), pupil diameter (PD), ocular anterior chamber depth (ACD), lens thickness (LT), vitreous chamber depth (VCD) and axial length (AL) on 28, 35, 42, 56, 70 and 84 days. There was no systematic left vs right eye anisometropia. Briefly, refractive state and PD were measured in a darkened room with an eccentric infrared photorefractor (EIR)[26]. The mice were gently positioned in front of the photoretinoscope, and swiftly repositioned until a clear first Purkinje image appeared in the center of the pupil. The measured refractive errors were then recorded by using software designed by Schaeffel et al [27]. Measurements were repeated at least three times for each eye. The CRC was measured with a keratometer (OM-4; Topcon Corporation, Dongguan, Japan), modified by mounting a +20.0 diopter (D) aspherical lens [28]. Each eye was measured three times to obtain a mean value. A custom-made real-time OCT instrument measured the AL and other ocular parameters [29]. After being anesthetized, each mouse was observed using a video viewing system for final orientation and positioning. The ACD was defined as the distance from the posterior surface of the cornea to the anterior surface of the lens. The VCD was defined as the distance from the back of the lens to the nerve fiber layer of the retina. The AL was defined as the distance between the anterior surface of the cornea and the vitreous-retina interface. Finally, after evaluating the refractive indices for each component of the eye, they were used to convert the recorded optical path length into a geometric path length. Each eye was scanned three times.

Transmission Electron Microscopy

APCMin and wild type mice were sacrificed by cervical dislocation at P84. The right eyes of five wildtype and APCMin mice were evaluated. The anterior segment of the eye including the cornea, iris, and crystalline lens was cut away from the anterior scleral rim, and the vitreous body and retina were also dissected and discarded, leaving only the sclera. Posterior scleral tissue was fixed in a mixture composed of 2.5% glutaraldehyde and 4% paraformaldehyde in PBS (pH = 7.4) for 2 h. Then, the scleras were cut into 1×1mm pieces for further fixing, embedding, slicing, staining, and examined with a transmission electron microscope (JEM2100HC; JEOL, Tokyo, Japan).

Immunostaining

Cryostat sections (10 μm in thickness) of each eyeball were fixed in cold acetone, and blocked with 2% normal bovine serum for 1h at room temperature. Sections of central retina were incubated with primary antibodies for TH (Millipore, AB152, 1:1000) and Ki67 (Abcam, ab15580, 1:300) overnight at 4°C and washed thoroughly with PBS. After further incubation in FITC-conjugated IgG (Invitrogen, 1:300), sections were counterstained with DAPI (Vector, H-1200) mounted, and photographed using a confocal laser scanning microscope (Fluoview 1000, Olympus, Tokyo, Japan).

Western Blot

Retinal and scleral homogenates were resolved by SDS-PAGE and then blotted with specific antibodies for Ki67 (Abcam, ab15580, 1:200), TH (Millipore, AB152, 1:1000) and col1α1 (Santa Cruz, sc-28657, 1:1000) overnight at 4°C. Detection was achieved with an anti-rabbit-horseradish peroxidase (RD, HAF008, 1:1000). The signal was detected with a chemiluminescence kit (ECL, Thermo, 32106). Each protein band was normalized to β-actin expression levels in the same gel.

Quantitative Real-time Reverse Transcription (RT)-PCR

Total RNA of sclera was isolated using TRIzol reagent (Invitrogen, USA), and its purity was confirmed by the OD260/280 nm absorption ratio (>1.8). Total RNAs (1μg) was reverse transcribed to cDNA using a cDNA Synthesis Kit (Takara, China). Quantitative real-time RT- PCR (Q-RT-PCR) was performed with a StepOne Real-Time PCR detection system (Applied Biosystems, Carlsbad, CA, USA) using an SYBR Premix Ex Taq Kit (Takara, China) according to the manufacturer’s instructions. Q-RT-PCR was performed in a 20 μL reaction under the following conditions: 95°C for 10 min, followed by 40 cycles of amplification at 95°C for 10 s and 60°C for 30 s. All experiments were performed in triplicate. The specific gene products were amplified using the following primer pairs: β-actin, 5- agccatgtacgtagccatcc -3 and 5-ctctcagctgtggtggtgaa -3; col1α1, 5- gagagcgaggccttcccgga-3 and 5- gggagccagcgggaccttgt-3; MMP2, 5- gttcaacggtcgggaataca-3 and 5- gccatacttgccatccttct-3; MMP9, 5- gactacgataaggacggcaaat-3 and 5- agatgaacgggaacacacag -3. A non-template control was included to evaluate the level of DNA contamination. The mRNA levels were analyzed by the comparative Ct method and normalized using β-actin.

Statistical Analysis

Data analysis was conducted with commercial software (SPSS, ver.13.0; SPSS, Chicago, IL and Prism 5). Differences between WT and APCMin genotypes at indicated postnatal days were analyzed by the independent Student t-tests. The Spearman linear correlation was used to test for significant relationships between the refractive error and the other ocular parameters. The value of each parameter is reported as the mean ± SEM of the right eyes of 13 mice in each age group. Values of western blot and Q-RT-PCR are shown as mean ± SD. A value of P < 0.05 was considered statistically significant. Significance levels are denoted by asterisks (*P <0.05, **P <0.01, ***P <0.001; ns, not significant).

Results

Relative myopia development in APCMin mice from P28 to P84

APCMin mice seldom live longer than 140 days because they develop intestinal bleeding and severe anaemia [23]. This limitation accounts for why ocular dimensions in each of ten APCMin mice and age-matched wildtype (WT) mice were only measured from P28 to P84 (Table 1). Consistent with previous reports [26], the refractive error of the WT mice, measured by EIR, increased rapidly in the hyperopic direction. Although APCMin mice also developed myopic shifts before P56, there was no diopter difference between them and WT mice. Nevertheless, APCMin mice were an average of -4.64D more myopic than the WT littermates on P84 (WT: n = 13, APCMin: n = 13, P<0.05, Fig 1A). To further characterize ocular growth in APCMin mice, we measured AL and VCD with custom-built biometric equipment specifically designed for mice. VCD in both genotypes decreased with time, and there was a significant difference between the two genotypes after P28 (P<0.05) (Fig 1B). The VCD in APCMin mice was longer than in WT littermates after P28 (e.g. 0.59 ± 0.04 mm VS 0.55 ± 0.01 mm at P84), which is consistent with VCD elongation observed in myopic human eyes [30]. AL in both genotypes increased during postnatal development. However, the AL in APCMin mice was significantly shorter at each time point compared with that in WT mice (e.g. 2.86 ± 0.03 mm VS 2.92 ± 0.02 mm at P84; Fig 1C), which is inconsistent with the clinical features of myopia [30].

thumbnail
Fig 1. APCMin mice have a greater myopic shift and longer vitreous chamber depth (VCD) than the WT littermates during postnatal development.

Comparison of refractive status (A), VCD (B), and AL (C), between APCMin mice and WT littermates at the indicated postnatal time points from P28 to P84. The asterisk denotes a significant difference between APCMin mice and WT mice. *P <0.05, ** P<0.01, independent Student- t-tests, WT: n = 13, APCMin mice: n = 13.

https://doi.org/10.1371/journal.pone.0141144.g001

thumbnail
Table 1. Comparison of biometric parameters in WT and APCMin mice.

https://doi.org/10.1371/journal.pone.0141144.t001

Abnormal anterior segment growth in APCMin Mice

Both PD and CRC increased during postnatal development, and there was no significant difference between the two genotypes at any time point (Fig 2A and 2B). Similarly, ACD and LT increased during postnatal development in both genotypes, whereas ACD in APCMin mice was shorter than in the WT from P28 to P56. On the other hand, this difference did not persist after P70 (Fig 2C). Meanwhile, LT in APCMin mice was significantly shorter than that in the WT mice (P<0.05), and the anterior lens surface radius of curvature of (RCALS) after P28 was the same in both groups (P>0.05) (Fig 2D and 2E).

thumbnail
Fig 2. Comparison of changes in biometric parameters of APCMin mice and WT littermates during postnatal development.

APCMin mice and WT littermates were evaluated for pupil diameter (PD) (A), radius of corneal curvature (CRC) (B), anterior chamber depth (ACD) (C), lens thickness (LT) (D), radius of curvature of anterior lens surface (RCALS) (E) and body weight (F) from P28 to P84. There was no difference in PL, CRC, and RCALS during this time period. However, ACD is shorter in APCMin mice than in WT from P28 to P56; LT in APCMin mice is smaller than in WT from P28 and P84; body weight in the APCMin mice were heavier than the WT mice from P28 toP35. The asterisk denotes a significant difference between APCMin mice and WT mice. *P <0.05, ** P<0.01, independent sample Student t-tests, WT: n = 13, APCMin mice: n = 13.

https://doi.org/10.1371/journal.pone.0141144.g002

To evaluate whether the development of myopia is confounded by a change in APCMin mice body weight, we weighed them during postnatal development. Their weights progressively increased without any difference between the two genotypes after P42, but the APCMin mice were heavier than the WT mice at P28 and P35 (Fig 2F).

Retinal morphological and proliferative changes in APCMin mice

During myopia development, retinal structural and functional changes occur [31,32]. Given the myopic shift in APCMin mice, retinal histologic cross-sections were examined in APCMin mice and age-matched WT mice at P84. Hematoxylin- eosin staining (H&E) staining showed an intact RPEmembrane in WT mice at P84 (Fig 3A). In contrast, RPE cell layer ruptures were evident in the APCMin mice at the same time point (Fig 3B). Clinical studies also showed defects in the RPE membrane in the macular region of the highly axially myopic eyes [33].

thumbnail
Fig 3. Comparison of retinal morphology at P84 in APCmin mice and age-matched WT littermates.

H&E stained cross-sections show that the RPE membrane (arrows) is broken and the retina is thicker, especially in the INL and IPL (B) but not in age-matched WT control (A). Ki67 immunostaining of eye sections of WT (C) and APCMin mice (D), The thickness of the INL and IPL was quantified in the APCMin mice and WT mice (E). Fifty microgram of retinal proteins from P84 APCMin mice and age-matched wild type (WT) mice was used for Western blot analysis of Ki67 (F), semiquantified by densitometry and normalized by β-actin levels (G) (mean ± S.D., n = 5), * P<0.05. RPE, retinal pigment epithelium; ONL, outer nuclear layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, Ganglion cell layer.

https://doi.org/10.1371/journal.pone.0141144.g003

Compared with age matched WT controls, the retina was significantly thicker in APCMin mice at P84 (Fig 3A and 3B). On the other hand, there was no difference between APCMin and age-matched WT in the outer nuclear layer (ONL) thickness. Nevertheless, inner nuclear layer (INL) and inner plexiform layer (IPL) of the APCMin mice were thicker compared with those in WT mice (27.68±0.37 μm VS 18.27±0.29 μm, 37.36±0.37 μm VS 26.68±0.33 μm, APCMin VS WT, P<0.001, n = 5, Fig 3E). To determine whether an increase in cell proliferation accounts for INL and IPL thickening, Ki67 expression levels were evaluated in western blots (n = 5). Previously, Geller et al. suggested that cellular Ki67 labeling (clone MIB-1) is a more accurate means of evaluating cellular proliferation in the retina and elsewhere in the CNS [34]. We found that Ki67 increased more in the APCMin retinas than in age-matched WT mice (Fig 3C, 3D and 3F). Therefore, the current results provide evidence that the refractive error of the APCMin mice is accompanied by increased retinal cell proliferation, which is consistent with a previous study [6].

Tyrosine hydroxylase (TH) expression in APCMin Mice

DA has been implicated as a stop signal of ocular growth [14]. It is to be noted here that since retinal DA levels in the untreated control eye and FDM eye exhibit large inter-individual variability (more than 200%) [35], we therefore examined on P84 TH expression levels (the rate-limiting enzyme of DA synthesis [36]) to clarify if there is an association between between retinal DA levels and retinal proliferation in the APCMin mice. Western blot and immunofluorescence analyses showed that TH levels, as compared with the WT retina, significantly decreased in the APCMin mice (Fig 4). This decline suggests that in APCMin mice down-regulated DA levels may enhance retinal proliferation, which has been previously reported [37].

thumbnail
Fig 4. Diminished tyrosine hydroxylase (TH) retinal expression in P84 APCMin mice.

(Panels A and B). TH immunostaining of eye sections of WT (A) and APCMin mice (B), showing decreased TH in the sub retinal space of APCMin mice. The nucleus was counterstained with 4, 6-diamidino-2-phenylindole (DAPI) (blue). C, Fifty micrograms of retinal protein was used for western blot analysis of TH. D, Protein levels were semiquantified with densitometry, normalized by β-actin levels, and compared between APCMin mice and WT mice littermates (mean ± SD, n = 5), ** P< 0.01.

https://doi.org/10.1371/journal.pone.0141144.g004

Association between myopia and posterior scleral collagen fibril diameter changes

Scleral pathology underlies permanent declines in high myopes [38]. To clarify the possible structural basis for myopia development in APCMin mice, we compared changes in their posterior scleral collagen diameter with those in WT littermates at P84. Ultrastructural analysis by electron microscopy revealed that the morphology of scleral collagen fibrils was dramatically altered in the APCMin mice (Fig 5A and 5B). In the APCMin mice, some areas had a higher density of small-diameter fibrils, whereas others had large-diameter irregular fibrils. This aberrant fibril structure is consistent with abnormal fusion of fibrils. To further determine the biochemical basis for these scleral changes, we compared col1α1 expression levels, since alterations in its expression are associated with myopia development [7]. Western blot analysis in APCMin mice showed that scleral col1α1 expression declined, while its mRNA expression level increased compared to those in age matched WT mice (Fig 5C and 5D). These results suggest that in APCMin mice altered col1α1 fiber metabolism may account for scleral disorganization. To determine whether the change in scleral col1α1 protein expression is accompanied by selective modulation of MMP2 and MMP9 mRNA gene expression, real-time PCR evaluated their scleral levels in APCMin and WT mice. Analysis of MMP2 and MMP9 gene expression, normalized to the expression of the housekeeping gene β-actin, showed that there was no change in their levels in APCMin mice, compared to those in the WT mice (Fig 5E). These results suggest that scleral col1α1 fiber downregulation in APCMin mice is not attributable to any changes in MMP2 and MMP9 expression levels.

thumbnail
Fig 5. Scleral morphological changes in P84 APCmin mice and age-matched normal WT littermates.

TEM compares collagen fibril morphology in cross-section from the posterior sclera of wild type (A) and APCMin mice (B). A, WT fibrils have a regular, cylindrical contour whereas APCMin mice sclera is more irregular and disorganized. The fibril contour diameters are variable having in some places a small diameter whereas in other locations it is larger (arrows). C, Col1α1 protein expression levels detected by western blot progressively decreased with development in APCmin scleras, as compared with WT mice littermates. D, Histogram illustrations of densitometry results of col1α1 protein expression levels. (Mean ± SD, n = 5), ** P< 0.01. E, real-time PCR measurements of col1α1, MMP2 and MMP9 in the retinas of APCMin and WT mice. All mRNA levels are normalized to the control level of WT in P84 (mean ± SD, n = 5, *P < 0.05, **P < 0.01).

https://doi.org/10.1371/journal.pone.0141144.g005

Discussion

Myopia is a common cause of vision loss in a number of ocular disorders [39], but the mechanisms underlying its pathogenesis are not fully understood. It was reported that 10 out of 14 FAP patients with refractive error had myopia ranging from -0.5D to -10D [22]. The incomplete penetrance of myopia phenotype in these patients may be due to the differences in APC mutation sites, which has been shown to affect clinical manifestations [19]. In this study, we examined the alterations in the refractive and biometric parameters of APCMin mice to elucidate the functions of APC during myopia progression.

To examine this issue, we used a custom-made real-time OCT and an eccentric infrared photo refractor (EIR) to compare refractive development in APCMin mice with their age matched WT littermates. Such instrumentation designed by Xiangtian Zhou et al [29] allowed us to more accurately measure refractive status and other biometric parameters in mice. Our data suggest that APC expression is required for proper eye growth because APCMin mice experience an extraordinary myopic shift and lenticular, retinal and scleral changes compared with age-matched WT littermates. Their development of this large myopic shift is consistent with abnormal eye size development. In contrast to invariant ACD and LT in human axial myopia [40], ACD became shallower and lenses shrunk in size in APCMin mice relative to their age-matched WT littermates (Fig 2C and 2D). In addition, longer eye axis identified in a clinical setting is typically indicative of myopia [5]. Paradoxically, APCMin mice instead usually have shortened- axial lengths and smaller eyes than their age-matched WT littermates (Fig 1C).

Myopia is a mismatch between the light-focusing power of the anterior segment and the axial length of the eye. As a result, the visual image comes to a focus in front of the retina [41]. Our results suggest that changes in thickness of lens and retina may not be able to compensate for the longer VC depth in later developmentwhich results in myopia in the APCMin mice. Regardless of the underlying molecular mechanisms, the short-eyed myopia found in our study is different from that described in other gene-knockout myopia models [42–44]. Studies employing APCMin mice may therefore provide novel insight into ocular development that is not readily accessible using instead other traditional models.

Developmental studies have revealed that proliferation of neurons in the marginal retina is highly correlated with the axial length of the eye during myopia development [6,45]. Accordingly, the addition of new neurons to the margin of the retina may compensate for retinal stretch that is imposed during myopia development [46]. Our analysis also indicated in P84 APCMin mice that the retina was accompanied by more Ki67 expression than in normal eyes, which is indicative of rises in retinal layer cell proliferation and retinal thickness. The relationship between retinal thickness and myopia has been extensively investigated. In some reports, average macular thickness was invariant despite changes in myopia degree [47]. However, others found that in myopic eyes retinal thickness was greater at both its foveal center and in the rest of the fovea than that in the non-myopic group [48] [49]. On the other hand, the retina was instead significantly thinner in other zones of the macula in myopic eyes, compared with non-myopic eyes. Interestingly, we found that the retina in P84 APCMin mice thickened. The exact mechanism underlying this enlargement needs further investigation. Thus, the APC gene mutation identified in FAP patients may contribute to increases in retinal cell proliferation.

There is emerging evidence suggesting that retinal DA level modulation affects eye growth [50]. Intravitreal injection of a dopaminergic neurotoxin, 6-hydroxydopamine, increased goldfish rod neuroblast proliferation [37]. Furthermore, in an APC mouse mutant model, the DA content is abnormally distributed in different brain regions, and these changes are associated with behavioral and phenotypic changes described in some neurological diseases [51]. In the context of the current study, it is conceivable that increases in retinal cell proliferation may be associated with decreased DA expression, which has been implicated as a ‘stop signal’ mediator of ocular growth [14]. To examine such a possibility, we measured changes in retinal TH expression, the rate-limiting enzyme of DA synthesis [52] and assumed they are reflective of variations in DA content. As the retinal TH protein expression level decreased in APCMin mice (Fig 5), changes in APC gene expression may contribute to DA and TH expression regulation and retinal cell proliferation. Paradoxically, we found in APCMin mice that the lenses were instead smaller than in their age-matched WT littermates. Additional studies are needed to clarify the underlying mechanism accounting for this response. Nevertheless, the current finding of a putative decline in retinal TH expression is consistent with previous indications that such an effect is associated with myopia development. Future studies are needed to determine whether DA receptor agonist and antagonist treatment change retinal proliferation and myopia development in the APCMin mice. The molecular mechanism responsible for putatively downregulating DA expression in APCMin mice requires future clarification.

Previous studies in humans and in myopia animal models suggest that scleral biology plays a pivotal role in eye size control and progression of this disease [53]. A possible function for the APC gene could include eye growth control by modulating scleral collagen expression. Our scleral ultrastructural analysis revealed regional heterogeneity in the fibril structures within delimited areas where there were either abnormally small- to very large-diameter fibrils. This result is consistent with findings in myopic tree shrews [54] and the Lum-/-Fmod-/- double-null mouse [42]. Our western blot analysis in APCMin mice showed that col1α1 decreased in scleral tissue (Fig 5C and 5D), while real-time PCR analysis showed no changes in MMP2 and MMP9 gene expression (Fig 5E) in APCMin mice, compared to that in the WT mice. One explanation for the discrepancy between increased col1α1 degradation and invariant MMP2 and MMP9 gene expression is that other MMPs may be alternatively involved in cleaving type I collagen. Changes in col1α1 posttranscriptional regulation are another possibility to account for why its expression level declined. Taken together, these findings suggest that the effect of APC on the scleral changes is partially through regulation of col1α1 expression levels, which, in turn, could result in alterations in scleral architecture and severely affect vision.

APC suppresses Wnt signal transduction cascade by modulation the cellular expression levels of β-catenin [19]. Wnt signal is involved in the homeostasis of many tissues, such as intestine, skin, bone, eye and hematopoietic system In adults [55]. In addition, recent studies indicate the possible role of Wnt pathway in the development of myopia [56,57]. In this study, we found that APCMin mice, in which Wnt signaling is activated, displayed myopic shift. Therefore, it provides additional evidence for the role of the Wnt signal pathway in the myopia development. Furthermore, previous study reported that stimulation of the Wnt pathway through inhibition of GSK-3β, a key enzyme in Wnt signal pathway that destabilizes β-catenin, increased retinal Ki67 expression. [58]. The thickened retina and increased Ki67 in the APCMin mice in our study suggest that the Wnt signal pathway may be involved in the control of proliferation of retina, which needs further study.

Previous study found that the APC gene mutation causes significant histological abnormalities in several proliferative tissues [59]. Similarly, our results in Table 1 found that the ocular biometric parameters in APCMin mice proportionally grow larger than in WT animals, whereas changes in body weight increase less over time than in WT mice. Our finding is consistent with a previous study that the APC gene mutation has apparently different effect in different tissues [59][59]. The mechanism and signaling pathways responsible for the observed changes remain to be elucidated in the future.

Our study has the following limitations. 1), it is not clear whether the ocular and refractive changes in the APCMin mice are the same as those occurring in other mutation sites. 2), we did not evaluate whether the ocular biometric parameter changes accompanying myopia development in APCMin mice also appear in human subjects with APC mutations, which could be of interest in further investigations.

In summary, this study describes for the first time refractive development in APCMin mice. The results suggest that APC expression in mice is essential for post natal development of error-free refraction based on measurements of time dependent changes in LT, VCD, and AL. Furthermore, our findings prompt additional genetic studies on APC polymorphism and its related signaling pathways as they may be related to myopia development.

Supporting Information

S1 ARRIVE Checklist. ARRIVE Guidelines Checklist.

Animal Research: Reporting In Vivo Experiments.

https://doi.org/10.1371/journal.pone.0141144.s001

(PDF)

Acknowledgments

The authors thank Jia Qu, Fang Zheng, Si Li and Hao Wu for providing the support on our biometric measurements and Dequan Li (Baylor College of Medicine) for critical reading of the manuscript. We acknowledge support from National Basic Research Program of China (Project 973) Grant 2011CB504606.

Author Contributions

Conceived and designed the experiments: Zuguo L. WL XZ. Performed the experiments: Zhen L. JL ZZ WY JA FH QW. Analyzed the data: Zhen L. FQ WC. Contributed reagents/materials/analysis tools: XZ JA FH QW. Wrote the paper: Zhen L. PSR WL Zuguo L.

References

  1. 1. Pizzarello L, Abiose A, Ffytche T, Duerksen R, Thulasiraj R, et al. (2004) VISION 2020: The Right to Sight: a global initiative to eliminate avoidable blindness. Arch Ophthalmol 122: 615–620. pmid:15078680
  2. 2. Wu SY, Nemesure B, Leske MC (1999) Refractive errors in a black adult population: the Barbados Eye Study. Invest Ophthalmol Vis Sci 40: 2179–2184. pmid:10476781
  3. 3. Saw SM, Gazzard G, Shih-Yen EC, Chua WH (2005) Myopia and associated pathological complications. Ophthalmic Physiol Opt 25: 381–391. pmid:16101943
  4. 4. Smith EL 3rd, Hung LF, Kee CS, Qiao Y (2002) Effects of brief periods of unrestricted vision on the development of form-deprivation myopia in monkeys. Invest Ophthalmol Vis Sci 43: 291–299. pmid:11818369
  5. 5. Mallen EA, Gammoh Y, Al-Bdour M, Sayegh FN (2005) Refractive error and ocular biometry in Jordanian adults. Ophthalmic Physiol Opt 25: 302–309. pmid:15953114
  6. 6. Tkatchenko AV, Walsh PA, Tkatchenko TV, Gustincich S, Raviola E (2006) Form deprivation modulates retinal neurogenesis in primate experimental myopia. Proc Natl Acad Sci U S A 103: 4681–4686. pmid:16537371
  7. 7. Gentle A, Liu Y, Martin JE, Conti GL, McBrien NA (2003) Collagen gene expression and the altered accumulation of scleral collagen during the development of high myopia. J Biol Chem 278: 16587–16594. pmid:12606541
  8. 8. Rada JA, Nickla DL, Troilo D (2000) Decreased proteoglycan synthesis associated with form deprivation myopia in mature primate eyes. Invest Ophthalmol Vis Sci 41: 2050–2058. pmid:10892842
  9. 9. Arumugam B, McBrien NA (2012) Muscarinic antagonist control of myopia: evidence for M4 and M1 receptor-based pathways in the inhibition of experimentally-induced axial myopia in the tree shrew. Invest Ophthalmol Vis Sci 53: 5827–5837. pmid:22836762
  10. 10. Stone RA, Lin T, Laties AM, Iuvone PM (1989) Retinal dopamine and form-deprivation myopia. Proc Natl Acad Sci U S A 86: 704–706. pmid:2911600
  11. 11. Seko Y, Shimizu M, Tokoro T (1998) Retinoic acid increases in the retina of the chick with form deprivation myopia. Ophthalmic Res 30: 361–367. pmid:9731117
  12. 12. Feldkaemper MP, Schaeffel F (2002) Evidence for a potential role of glucagon during eye growth regulation in chicks. Vis Neurosci 19: 755–766. pmid:12688670
  13. 13. Fischer AJ, McGuire JJ, Schaeffel F, Stell WK (1999) Light- and focus-dependent expression of the transcription factor ZENK in the chick retina. Nat Neurosci 2: 706–712. pmid:10412059
  14. 14. Zhang N, Favazza TL, Baglieri AM, Benador IY, Noonan ER, et al. (2013) The rat with oxygen-induced retinopathy is myopic with low retinal dopamine. Invest Ophthalmol Vis Sci 54: 8275–8284. pmid:24168993
  15. 15. McBrien NA, Cottriall CL, Annies R (2001) Retinal acetylcholine content in normal and myopic eyes: a role in ocular growth control? Vis Neurosci 18: 571–580. pmid:11829303
  16. 16. Dong F, Zhi Z, Pan M, Xie R, Qin X, et al. (2011) Inhibition of experimental myopia by a dopamine agonist: different effectiveness between form deprivation and hyperopic defocus in guinea pigs. Mol Vis 17: 2824–2834. pmid:22128230
  17. 17. Iuvone PM, Tigges M, Fernandes A, Tigges J (1989) Dopamine synthesis and metabolism in rhesus monkey retina: development, aging, and the effects of monocular visual deprivation. Vis Neurosci 2: 465–471. pmid:2577263
  18. 18. Kinzler KW, Nilbert MC, Su LK, Vogelstein B, Bryan TM, et al. (1991) Identification of FAP locus genes from chromosome 5q21. Science 253: 661–665. pmid:1651562
  19. 19. Goss KH, Groden J (2000) Biology of the adenomatous polyposis coli tumor suppressor. J Clin Oncol 18: 1967–1979. pmid:10784639
  20. 20. Liou GI, Samuel S, Matragoon S, Goss KH, Santoro I, et al. (2004) Alternative splicing of the APC gene in the neural retina and retinal pigment epithelium. Mol Vis 10: 383–391. pmid:15218453
  21. 21. Luchtenborg M, Weijenberg MP, Roemen GM, de Bruine AP, van den Brandt PA, et al. (2004) APC mutations in sporadic colorectal carcinomas from The Netherlands Cohort Study. Carcinogenesis 25: 1219–1226. pmid:14976131
  22. 22. Ruhswurm I, Zehetmayer M, Dejaco C, Wolf B, Karner-Hanusch J (1998) Ophthalmic and genetic screening in pedigrees with familial adenomatous polyposis. Am J Ophthalmol 125: 680–686. pmid:9625552
  23. 23. Fodde R, Smits R (2001) Disease model: familial adenomatous polyposis. Trends Mol Med 7: 369–373. pmid:11516998
  24. 24. Marcus DM, Rustgi AK, Defoe D, Brooks SE, McCormick RS, et al. (1997) Retinal pigment epithelium abnormalities in mice with adenomatous polyposis coli gene disruption. Arch Ophthalmol 115: 645–650. pmid:9152133
  25. 25. Moser AR, Pitot HC, Dove WF (1990) A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science 247: 322–324. pmid:2296722
  26. 26. Zhou X, Shen M, Xie J, Wang J, Jiang L, et al. (2008) The development of the refractive status and ocular growth in C57BL/6 mice. Invest Ophthalmol Vis Sci 49: 5208–5214. pmid:18689702
  27. 27. Schaeffel F, Burkhardt E, Howland HC, Williams RW (2004) Measurement of refractive state and deprivation myopia in two strains of mice. Optom Vis Sci 81: 99–110. pmid:15127929
  28. 28. Zhou X, Huang Q, An J, Lu R, Qin X, et al. (2010) Genetic deletion of the adenosine A2A receptor confers postnatal development of relative myopia in mice. Invest Ophthalmol Vis Sci 51: 4362–4370. pmid:20484596
  29. 29. Zhou X, Xie J, Shen M, Wang J, Jiang L, et al. (2008) Biometric measurement of the mouse eye using optical coherence tomography with focal plane advancement. Vision Res 48: 1137–1143. pmid:18346775
  30. 30. McBrien NA, Adams DW (1997) A longitudinal investigation of adult-onset and adult-progression of myopia in an occupational group. Refractive and biometric findings. Invest Ophthalmol Vis Sci 38: 321–333. pmid:9040464
  31. 31. Lam DS, Leung KS, Mohamed S, Chan WM, Palanivelu MS, et al. (2007) Regional variations in the relationship between macular thickness measurements and myopia. Invest Ophthalmol Vis Sci 48: 376–382. pmid:17197557
  32. 32. Chen JC, Brown B, Schmid KL (2006) Delayed mfERG responses in myopia. Vision Res 46: 1221–1229. pmid:16095653
  33. 33. Jonas JB, Ohno-Matsui K, Spaide RF, Holbach L, Panda-Jonas S (2013) Macular Bruch's membrane defects and axial length: association with gamma zone and delta zone in peripapillary region. Invest Ophthalmol Vis Sci 54: 1295–1302. pmid:23361505
  34. 34. Geller SF, Lewis GP, Anderson DH, Fisher SK (1995) Use of the MIB-1 antibody for detecting proliferating cells in the retina. Invest Ophthalmol Vis Sci 36: 737–744. pmid:7890504
  35. 35. Feldkaemper M, Schaeffel F (2013) An updated view on the role of dopamine in myopia. Exp Eye Res 114: 106–119. pmid:23434455
  36. 36. Witkovsky P (2004) Dopamine and retinal function. Doc Ophthalmol 108: 17–40. pmid:15104164
  37. 37. Negishi K, Stell WK, Teranishi T, Karkhanis A, Owusu-Yaw V, et al. (1991) Induction of proliferating cell nuclear antigen (PCNA)-immunoreactive cells in goldfish retina following intravitreal injection with 6-hydroxydopamine. Cell Mol Neurobiol 11: 639–659. pmid:1685943
  38. 38. McBrien NA, Gentle A (2003) Role of the sclera in the development and pathological complications of myopia. Prog Retin Eye Res 22: 307–338. pmid:12852489
  39. 39. Kempen JH, Mitchell P, Lee KE, Tielsch JM, Broman AT, et al. (2004) The prevalence of refractive errors among adults in the United States, Western Europe, and Australia. Arch Ophthalmol 122: 495–505. pmid:15078666
  40. 40. Xie R, Zhou XT, Lu F, Chen M, Xue A, et al. (2009) Correlation between myopia and major biometric parameters of the eye: a retrospective clinical study. Optom Vis Sci 86: E503–508. pmid:19349927
  41. 41. Meng W, Butterworth J, Malecaze F, Calvas P (2011) Axial length of myopia: a review of current research. Ophthalmologica 225: 127–134. pmid:20948239
  42. 42. Chakravarti S, Paul J, Roberts L, Chervoneva I, Oldberg A, et al. (2003) Ocular and scleral alterations in gene-targeted lumican-fibromodulin double-null mice. Invest Ophthalmol Vis Sci 44: 2422–2432. pmid:12766039
  43. 43. Schippert R, Burkhardt E, Feldkaemper M, Schaeffel F (2007) Relative axial myopia in Egr-1 (ZENK) knockout mice. Invest Ophthalmol Vis Sci 48: 11–17. pmid:17197510
  44. 44. Pardue MT, Faulkner AE, Fernandes A, Yin H, Schaeffel F, et al. (2008) High susceptibility to experimental myopia in a mouse model with a retinal on pathway defect. Invest Ophthalmol Vis Sci 49: 706–712. pmid:18235018
  45. 45. Teakle EM, Wildsoet CF, Vaney DI (1993) The spatial organization of tyrosine hydroxylase-immunoreactive amacrine cells in the chicken retina and the consequences of myopia. Vision Res 33: 2383–2396. pmid:7902629
  46. 46. Fischer AJ, Reh TA (2000) Identification of a proliferating marginal zone of retinal progenitors in postnatal chickens. Dev Biol 220: 197–210. pmid:10753510
  47. 47. Lim MC, Hoh ST, Foster PJ, Lim TH, Chew SJ, et al. (2005) Use of optical coherence tomography to assess variations in macular retinal thickness in myopia. Invest Ophthalmol Vis Sci 46: 974–978. pmid:15728555
  48. 48. Cheng SC, Lam CS, Yap MK (2010) Retinal thickness in myopic and non-myopic eyes. Ophthalmic Physiol Opt 30: 776–784. pmid:21205263
  49. 49. Song AP, Wu XY, Wang JR, Liu W, Sun Y, et al. (2014) Measurement of retinal thickness in macular region of high myopic eyes using spectral domain OCT. Int J Ophthalmol 7: 122–127. pmid:24634877
  50. 50. McCarthy CS, Megaw P, Devadas M, Morgan IG (2007) Dopaminergic agents affect the ability of brief periods of normal vision to prevent form-deprivation myopia. Exp Eye Res 84: 100–107. pmid:17094962
  51. 51. Onouchi T, Kobayashi K, Sakai K, Shimomura A, Smits R, et al. (2014) Targeted deletion of the C-terminus of the mouse adenomatous polyposis coli tumor suppressor results in neurologic phenotypes related to schizophrenia. Mol Brain 7: 21. pmid:24678719
  52. 52. Daubner SC, Le T, Wang S (2011) Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys 508: 1–12. pmid:21176768
  53. 53. Rada JA, Shelton S, Norton TT (2006) The sclera and myopia. Exp Eye Res 82: 185–200. pmid:16202407
  54. 54. McBrien NA, Cornell LM, Gentle A (2001) Structural and ultrastructural changes to the sclera in a mammalian model of high myopia. Invest Ophthalmol Vis Sci 42: 2179–2187. pmid:11527928
  55. 55. Clevers H (2006) Wnt/beta-catenin signaling in development and disease. Cell 127: 469–480. pmid:17081971
  56. 56. Ma M, Zhang Z, Du E, Zheng W, Gu Q, et al. (2014) Wnt signaling in form deprivation myopia of the mice retina. PLoS One 9: e91086. pmid:24755605
  57. 57. Cheng CY, Schache M, Ikram MK, Young TL, Guggenheim JA, et al. (2013) Nine loci for ocular axial length identified through genome-wide association studies, including shared loci with refractive error. Am J Hum Genet 93: 264–277. pmid:24144296
  58. 58. Inoue T, Kagawa T, Fukushima M, Shimizu T, Yoshinaga Y, et al. (2006) Activation of canonical Wnt pathway promotes proliferation of retinal stem cells derived from adult mouse ciliary margin. Stem Cells 24: 95–104. pmid:16223856
  59. 59. You S, Ohmori M, Pena MM, Nassri B, Quiton J, et al. (2006) Developmental abnormalities in multiple proliferative tissues of Apc(Min/+) mice. Int J Exp Pathol 87: 227–236. pmid:16709231