Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Cyclooxygenase-2, a Potential Therapeutic Target, Is Regulated by miR-101 in Esophageal Squamous Cell Carcinoma

  • Ying Shao,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Peng Li,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Sheng-tao Zhu,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Ji-ping Yue,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Xiao-jun Ji,

    Affiliation Intensive Care Unit, Beijing Friendship Hospital, Capital Medical University, Beijing, China

    ⨯
  • Zhen He,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Dan Ma,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Li Wang,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Yong-jun Wang,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Ye Zong,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Yong-dong Wu,

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯
  • Shu-tian Zhang

    zhangshutian@ccmu.edu.cn

    Affiliation Department of Gastroenterology, Beijing Friendship Hospital, Capital Medical University, National Clinical Research Center for Digestive Disease, Beijing Key Laboratory for Precancerous Lesion of Digestive Diseases, Beijing, China

    ⨯

Abstract

Background & Aims

Cyclooxygenase-2 (COX-2) is known to promote the carcinogenesis of esophageal squamous cell carcinoma (ESCC). There are no reports on whether microRNAs (miRNAs) regulate COX-2 expression in ESCC. This study investigated the effect of miR-101 on ESCC through modulating COX-2 expression in ESCC.

Methods

Real-time quantitative reverse transcription–polymerase chain reaction (RT-PCR) was used to quantify miR-101 expression in ESCC clinical tissues and cell lines. The effects of miR-101 on ESCC progression were evaluated by cell counting kit-8 (CCK8), transwell migration and invasion assays, as well as by flow cytometry. The COX-2 and PEG2 levels were determined by western blot and enzyme-linked immunosorbent assays (ELISA). The luciferase reporter assay was used to verify COX-2 as a direct target of miR-101. The anti-tumor activity of miR-101 in vivo was investigated in a xenograft nude mouse model of ESCC.

Results

Downregulation of miR-101 was confirmed through comparison of 30 pairs of ESCC tumor and adjacent normal tissues (P < 0.001), as well as in 11 ESCC cell lines and a human immortalized esophageal cell line (P < 0.001). Transfection of miR-101 in ESCC cell lines significantly suppressed cell proliferation, migration, and invasion (all P < 0.001). The antitumor effect of miR-101 was verified in a xenograft model. Furthermore, COX-2 was shown to be a target of miR-101.

Conclusions

Overexpression of miR-101 in ESCC inhibits proliferation and metastasis. Therefore, the miR-101/COX-2 pathway might be a therapeutic target in ESCC.

Citation: Shao Y, Li P, Zhu S-t, Yue J-p, Ji X-j, He Z, et al. (2015) Cyclooxygenase-2, a Potential Therapeutic Target, Is Regulated by miR-101 in Esophageal Squamous Cell Carcinoma. PLoS ONE 10(11): e0140642. https://doi.org/10.1371/journal.pone.0140642

Editor: Yifeng Zhou, Medical College of Soochow University, CHINA

Received: July 12, 2015; Accepted: September 29, 2015; Published: November 10, 2015

Copyright: © 2015 Shao et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Data Availability: All relevant data are available within the paper.

Funding: This work was funded by national 973 Plan of China (approval number: 2012CB526600) to STZ (http://www.973.gov.cn/), and the National Natural Science Foundation of China (approval number: 81341061) to YS (http://www.nsfc.gov.cn/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Esophageal cancer, one of the most common malignant tumors, is the eighth most common cancer and the sixth most common causes of cancer mortality in the world. Histologically, esophageal cancer can be divided into two main forms: esophageal squamous cell carcinoma (ESCC) and adenocarcinoma. Adenocarcinoma is common in western countries but ESCC is predominant in East Asia, especially in China [1]. In China, approximately 210,000 patients die each year of ESCC, or 52% of all ESCC deaths worldwide [2]. Although advances have been made in the treatment of ESCC, the prognosis of ESCC patients remains very poor, and the overall 5-year survival rate of patients with ESCC is still less than 10–15% [3]. Therefore, it is urgent to discover more biomarkers and therapeutic targets for ESCC.

Cyclooxygenases 1 and 2 (COX-1 and COX-2) are the rate-limiting enzymes involved in the biosynthesis of prostaglandins (PGs). COX-1 is constitutively expressed in most tissues, while COX-2 is the inducible isoform, which is responsible for the elevated production of PGs in response to various inflammatory stimuli, hormones, and growth factors [4]. Accumulating evidence has demonstrated that COX-2 plays an important role both in tumor development and progression [5–10], including ESCC [11–16]. Epidemiological studies have indicated that the regular use of aspirin can reduce the risk of esophageal cancer by up to 90% [17–19]. We and others have shown that (1) COX-2 expression is a frequent phenomenon in human ESCC tissue samples and that positive expression is related to lymphatic metastasis [11–16]; (2) COX-2 inhibitors inhibit cell proliferation and induce apoptosis by inducing G0 / G1 cell-cycle arrest and down-regulating Bcl-2 expression [20, 21] and the inhibition of COX-2 leads to tumor reduction in vivo [22]; and (3) a COX-2 inhibitor can inhibit migration and invasion of ESCC cells [23] These findings thus provide compelling evidence that COX-2 is an obligatory player in ESCC and that blocking COX-2 is an important therapeutic targets of ESCC.

So far, there are three main COX-2 block methods: COX-2 inhibitors, inhibitory transcription factors and post-transcriptional control. The application of the first two methods is restricted because of the adverse reaction of COX-2 inhibitors [24, 25] and the non-specificity of transcription factors. Because post-transcriptional control has better effect, it is currently the focus of much research. MicroRNAs (miRNAs), which encode small non-coding RNAs of approximately 22 nucleotides, are now recognized as an effective method of post-transcriptional control. Previously, we searched seven databases (Targetscan, Pictar, MiRanda, MiRwalk, Dianamt, Ebi and Microrna) and found four putative miRNAs that could bind to the 3 ‘- untranslated region (UTR) of COX-2 (according to at least five databases), which are miR-101, miR-144, miR-26a and miR-143. Among four these miRNAs, miR-101 has been reported to be down-regulated in an ESCC cell line [26]. Thus, we hypothesized that miR-101 could inhibit ESCC through inhibiting COX-2.

In this study, we validated the down-regulation of miR-101 in ESCC tissue specimens and cell lines; investigated the inhibitory effect of miR-101 on ESCC cell proliferation, migration and invasion in vitro; further examined the anti-tumor activity of miR-101 in vivo in a xenograft nude mouse model of ESCC; and verified that miR-101 inhibited ESCC via inhibiting COX-2 expression. To the best of our knowledge, this is the first study to examine the miR-101 / COX-2 pathway in ESCC.

Materials and Methods

Ethics Statement

The Clinical Research Ethics Committee of Beijing Friendship Hospital, Capital Medical University approved the project and protocol for the investigations involving humans and animals. This study was performed in accordance with the ethical standards of the Declaration of Helsinki. All participants provided their written informed consent to participate in this study, and the ethics committee approved this consent procedure.

Collection of ESCC clinical samples and culture of ESCC cell lines

Thirty pairs of primary ESCC tissues and the corresponding adjacent normal esophageal tissues were obtained from untreated patients in Beijing Friendship Hospital (Capital Medical University) from 2009 to 2011 with informed consent and agreement. All tissue samples were snap frozen in liquid nitrogen and stored at –80°C until the extraction of RNA.

The human ESCC cell lines KYSE30, KYSE70, KYSE150, KYSE410, KYSE450, KYSE510, EC9706, and EC109 were kindly provided by the Cancer Institute and Hospital, Chinese Academy of Medical Science. The ESCC cell lines TE-1, TE-9, and TE-11 were gifts from Hebei Cancer Hospital of China. All of the ESCC cell lines used in this study was from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences, Shanghai Institute of Cell Biology and has been described previously [27–31]. Het-1A, a human esophageal immortalized cell line, was purchased from the American Type Culture Collection. Five-week-old male BALB/c nu/nu mice were purchased from the Institute of Laboratory Animal Sciences, Chinese Academy of Medical Sciences. All cell lines, except for Het-1A, were cultured in RPMI-1640 medium (Hyclone, USA) containing 10% fetal bovine serum (Gibco, USA) and 10 units / mL penicillin and streptomycin (Hyclone, USA). Cells were maintained at 37°C, 95% humidity, and 5% CO2. Het-1A cells were cultured in bronchial epithelial basal medium with growth supplements (Clonetics, USA).

Real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR)

To measure the expression levels of mature miR-101, real-time quantitative RT-PCR was performed as described previously [32]. The miRNAs were extracted from cultured cells or frozen tissues with a mirVana miRNA Isolation Kit (Applied Biosystems, USA). Using an Applied Biosystems 7500 Fast System and standard TaqMan PCR reagents, ten nanograms of the extracted miRNAs were reverse-transcribed to cDNA using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, USA). The reaction mixture was used for real-time RT-PCR of miR-101. U6 was used as an internal control. Fold changes for the expression levels of miR-101 were calculated using the comparative cycle threshold method (2-ΔΔCT). All miRNA samples were assayed in triplicate.

Construction of expression plasmids and stable over-expression clones

The specific primers for establishing expression plasmids of miR-101 were as follows: miR-101 sense: 5 ‘-CG G / GATCC (BamHI) TTCAGCCTCACCACTTGCTG-3 ‘; anti-sense: 5 ‘- CAACATGGCTGCACCAACAAC A / AGCTT (HindIII) GGG– 3 ‘ (the restriction sites are underlined in each primer). Precursors of miR-101 (440 bp) were cloned into the pSilencer 4.1-CMV vector (Ambion, Geneworks), in accordance with the manufacturer’s instructions. In this study, we selected EC9706 and EC109 cell lines as our model, since high COX-2 levels in those cells have been found and miR-101 has been reported to be down-regulated in EC109 cells [26]. Introduction of the expression plasmids carrying miR-101 into EC9706 and EC109 cells was performed using Lipofectamine 2000 (Invitrogen) in accordance with the manufacturer’s instructions. Stably expressed cell lines were selected with G418 (Sigma, USA) at a dose of 600 mg / mL and maintained at 300 mg / mL. The expression levels of miR-101 in stable clones were verified via real-time RT-PCR.

Colony formation assay

Cells were plated in 6-well plates at 1×103 cells / well and grown for 2 weeks. After 2 weeks, the cells were washed twice with phosphate-buffered saline, fixed with methanol, and stained with Giemsa. The number of colonies was counted under the micro-scope.

Cell proliferation assay

Cell proliferation was measured with a Cell Counting Kit-8 (CCK-8, Dojindo, Japan). A colorimetric assay was used to create growth curves using the mean results from three independent experiments. Briefly, cells were seeded at a density of 5 × 103 cells / well in a 96-well plate. Cell viability was assessed using the CCK8 at 24, 48, 72, 96, and 120 h after transfection. The absorbance at 450 nm was measured with a plate reader.

Cell cycle analysis and detection of apoptosis

Dissociated cells were fixed and permeabilized with cold 70% ethanol, overnight at 4°C. The next day, the cells were stained with 10 μL of 1 mg / mL propidium iodide and 10 μL of 500 μg / mL RNase (37°C for 30 min) for flow cytometry. In addition, cells stained with Annexin V-FITC and propidium iodide were used to determine the rate of apoptosis by flow cytometry, in accordance with the protocol of the FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen, USA).

Tumor formation in nude mice

Stably transfected cells (1.5 × 106 in 0.2 mL) were injected subcutaneously into the right (EC9706 / EC109-miR-101) and left (EC9706 / EC109-vector) dorsal flank of severe combined immunodeficiency mice (SCID; Institute of Laboratory Animal Sciences, Chinese Academy of Medical Sciences), five mice per group. At 4 weeks after inoculation of the tumor cells, the tumor size was determined by the formula volume = 0.5 × length × width2.

Cell migration and invasion assays

Cell migration and invasion were analyzed in cells incubated for 24 h using non-Matrigel-coated (BD Falcon cell culture inserts, BD Biosciences, USA) or Matrigel-coated transwell cell culture chambers (BD Matrigel Invasion Chamber, BD Biosciences, USA), of 8 μm pore size, in accordance with the manufacturer’s instruction.

Metastasis assay in nude mice

Stably transfected cells were injected intravenously (3 × 105 cells / mouse) into 5-week-old SCID mice through the tail vein. There were two groups (EC9706 / EC109-vector and EC9706 / EC109-miR-101) in the animal study and each group had five mice. The number of tumor nodules formed on the surface of the liver, lungs, kidney and spleen was counted at 12 weeks after tumor injection.

Western blot

Western blot analysis was performed as described previously [33]. The primary antibodies and secondary antibody used in this study were rabbit anti-COX-2 antibody (1:1000, Cell Signaling, USA), rabbit anti-β-actin antibody (1:1000, Sigma, USA), and sheep anti-rabbit antibody conjugated to horseradish peroxidase (1:6000, Santa Cruz, USA).

Enzyme immunoassay for prostaglandin E2 (PGE2)

PGE2 in the culture supernatant was measured by an enzyme-linked immunosorbent assay (ELISA), in accordance with the kit manufacturer’s protocol. The concentration of PGE2 was expressed as picograms per milliliter.

Dual-luciferase reporter assay

Luciferase reporters of COX-2 were made through RT-PCR using the following primers: wild type (WT)-binding sites of miR-101 (490 bp), upstream primer with a SacI site (5 ‘- GCCACAGAGCT / C AGCTATCTGTAACCAAGATGGATGC-3 ‘) and downstream primer with a HindIII site (3 ‘- GTCCTTAGGATAGGCCTATGTGCTA A / A GCTTCCGCAT- 5 ‘); Luciferase reporters of COX-2 with mutant type (MT)-binding sites (underlined and italicized) of miR-101 were made using fragments with 5 ‘ SacI and 3 ‘ HindIII sites (underlined) and protective bases, shown below: GCCACA GAGCT / C AATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATTTAATG ATAATATATATTACTTAATTTATTGAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATA / AGCTTCCGCAT. PCR products or synthetic DNA fragments were digested and cloned into SacI and HindIII sites on a pMIR-REPORT miRNA Expression Reporter Vector (Ambion, USA), which was confirmed by DNA sequencing.

To perform the luciferase reporter assay, EC9706-miR-101 cells (4 × 104) were seeded in a 48-well plate and then co-transfected with 800 ng of either the WT (pMIR-miR-101 WT) or MT(pMIR-miR-101 MT) report or 40 ng of pMIR-vector and 4 ng of pRL-TK vector (Promega, USA), an internal control using Lipofectamine 2000 (Invitrogen). Forty-eight hours after transfection, cells were collected for analysis using a Dual-Luciferase Reporter Assay Kit (Promega, USA), in accordance with the manufacturer’s instructions. The results were measured with a GloMax-Multi Detection System (Promega, USA). Transfection was done in duplicates and experiments were repeated three times.

Statistical analysis

SPSS 15.0 software (Chicago, IL, USA) was used for statistical analysis in this study. Data were presented as means ± standard deviation (SD), which were collected from at least three independent experiments. The two-tailed Student’s t-test was used for comparisons of two independent groups. P < 0.05 was considered statistically significant.

Results

1. MiR-101 is down-regulated in ESCC. The expressions levels of miR-101 in clinical specimens of ESCC and the corresponding adjacent normal tissues obtained from 30 patients with ESCC, as well as in 11 ESCC cell lines and a human immortalized esophageal epithelia cell line (Het-1A) were determined. Compared to the adjacent normal tissues and Het-1A cell, the expressions levels of miR-101 were significantly downregulated in tumor tissues (Fig 1A) and 11 ESCC cell lines (Fig 1B).

thumbnail
Download:
Fig 1. Downregulation of miR-101 in tumor tissue specimens and cell lines of human ESCC.

The expressions of miR-101 in 30 pairs of ESCC tumor tissues and corresponding normal tissues (A) and cell lines (B) were determined by quantitative real time RT-PCR as described in Materials and Methods. Results were calculated by 2-ΔΔCT method and shown as the mean value of three independent experiments. U6 was used as an internal control for data normalization of RT-PCR. Columns and error bars represent standard deviations from three independent measurements. ** P < 0.01; *** P < 0.001.

https://doi.org/10.1371/journal.pone.0140642.g001

2. Morphology changes and miR-101 expression levels of in miR-101-transfected ESCC cell lines. To explore the potential tumor-suppressive role of miR-101 in ESCC, the miR-101 precursor was cloned and stably transfected into the ESCC cell lines EC9706 and EC109. First, we observed that both EC9706 and EC109 cells over-expressing ectopic miR-101 exhibited a morphological change with a decrease of volume compared to the typical morphology of parent cells and the vector-control (Fig 2A). Both EC9706 and EC109 cells over-expressing ectopic miR-101 (Fig 2B and 2C).

thumbnail
Download:
Fig 2. Effects of ectopically expressed miR-101 on the morphology and the expression level of miR-101 of EC9706 and EC109.

(A) EC9706 / EC109-miR-101 had change in volume (decreased) compared to the parent cells and cells expressing the vector-control under inverted microscope (40×). Relative expression of miR-101was detected by quantitative PCR in stably transfected EC9706-miR-101 (B) and EC109-miR-101 (C) relative to the parent cells and vectors-control cells. Expression was normalized against an endogenous control U6 (average of two individual experiments with triplicated Samples). *** P < 0.001.

https://doi.org/10.1371/journal.pone.0140642.g002

3. MiR-101 suppresses tumor proliferation in vitro and in vivo. The colony formation of EC9706-miR-101 and EC109-miR-101 cells was significantly suppressed (Fig 3A). The CCK8 assay results showed that the proliferation rates of the EC9706-miR-101 and EC109-miR-101 cells were significantly less than those of the parent and vector-control cells (Fig 3A and 3B). To investigate the biological function of miR-101 in ESCC, we examined the proliferation of ESCC cells. The CCK8 assay data showed that the proliferation of the EC9706 and EC109 cell lines stably transfected with miR-101 was significantly inhibited (Fig 3B). Flow cytometry revealed that overexpression of miR-101 in the ESCC cell lines significantly induced both apoptosis and cell cycle arrest at the G0 / G1 phase (Fig 3C–3E). In addition, overexpression of miR-101 in the ESCC cell lines significantly inhibited the growth of xenograft tumors in nude mice, as compared with mice inoculated with vector EC9706 and EC109 cells (Fig 3F).

thumbnail
Download:
Fig 3. Overexpression of miR-101 inhibited the proliferation of ESCC cell lines in vitro and in vivo.

(A) Representative results of colony formation of parent (column 1), vector (column 2), and miR-101–transfected (column 3) EC9706 and EC109. (B) Cell growth curves of EC9706 and EC109 stably transfected with miR-101 were determined by CCK-8 assay. Growth curve was generated by reading the absorbance value at different time points (upper for EC9706 and lower for EC109 cells). (C and D) After 24 hrs culture, medium was replaced by fresh serum-free medium for additional 12 hrs culture. At endpoint, cells were collected and stained with Annexin V-FITC and propidium iodide for flow cytometric assay of apoptosis (left for EC9706; right for EC109). (E) Representative cell cycle analysis of parent, vector and miR-101-transfected EC9706 and EC109 (left for EC9706; right for EC109). (F) 1.5 × 106 cells stably transfected with vector or miR-101 were implanted subcutaneously in the left and right dorsal flank areas of nude mice, respectively, (5 mice per group). Tumor volume was measured once a week over a period of 4 weeks. The results were expressed as mean ± SD of the results of three independent experiments, each with triplicates. ** P < 0.01; *** P < 0.001.

https://doi.org/10.1371/journal.pone.0140642.g003

4. MiR-101 suppressed tumor metastasis in vitro and in vivo. The transwell chamber assay showed that the migration and invasion ability of ESCC cells stably transfected with miR-101 was significantly suppressed, compared with the parent cells or vector-control cells (Fig 4A and 4B). In addition, the number of metastatic nodules on the surfaces of the liver was significantly less in mice inoculated with miR-101-transfected ESCC cells compared to the negative control mice (vector groups) (Fig 4C, P < 0.001). No visible metastatic nodules on the lung, kidney, or spleen were found in either the vector group or the miR-101 group.

thumbnail
Download:
Fig 4. Ectopic expression of miR-101 inhibited the metastasis of ESCC.

(A and B) The migration and invasion ability (24 hrs) of tumor cells was determined by transwell chamber assay as described in Materials and Methods (left for migration; right for invasion). (C) 3 × 106 cells were inoculated into nude mice by tail vein injection. Twelve weeks after inoculation, mice were killed and metastatic nodules on the surface of liver were counted. Hematoxylineosin staining showed the nodules on the liver were metastasis. The results are expressed as mean ± standard deviation of data from three independent experiments, each with three repetitions, ***, P < 0.001.

https://doi.org/10.1371/journal.pone.0140642.g004

5. COX-2 is a direct target of miR-101 in ESCC. To verify the regulatory effect of miR-101 on COX-2 expression in ESCC cells, we performed the following experiments. First, the predicted binding sites of hsa-miR-101 in the 3 ‘-UTR of COX2 mRNA were determined according to computational prediction (TargetScan and microRNA databases). Based on this information, luciferase reporters containing mutant binding sites were constructed (Fig 5A), in order to verify whether COX-2 is a direct target of miR-101 in human ESCC. Second, we investigated the correlation of miR-101 with COX-2 expression in EC9706, in which miR-101 was over-expressed in our previous study (data not shown). Western blot analysis showed that overexpression of miR-101 in EC9706 cells significantly reduced COX-2 expression at the protein level (Fig 5B). Furthermore, the level of PGE2, a primary product of COX-2, in stably transfected cells was significantly less than that of parent and vector-transfected cells (Fig 5C; P < 0.001). In addition, the proliferation, migration and invasion abilities of miR-101-transfected cells increased with PGE2 supplementation in the culture medium (Fig 5D and 5E; P < 0.001). Moreover, the luciferase reporter activity of WT or MT pMIR-COX-2 plasmid in EC9706 cells that overexpressed miR-101 showed that the reporter activity of WT pMIR-COX-2 was significantly decreased in cells that over-expressed miR-101, as compared to the control cells (P < 0.01; Fig 5F). The results were expressed as mean ± SD of three independent experiments, each performed in triplicate. ** P < 0.01; *** P < 0.001.

thumbnail
Download:
Fig 5. MiR-101 inhibits ESCC via COX-2.

(A) The predicted binding sites of hsa-miR-101 in the 3’-UTR of COX-2 mRNA and their mutant counterparts. (B) COX-2 expression in stably transfected cell lines was detected by western blot analysis as described in Materials and Methods. Beta-actin was used as an internal control for COX-2 expression normalization. (C) Culture medium was collected for measurement of PGE2 levels by using ELISA assay as described in Materials and Methods. (D) Similar to protocol used in Figs 3B and 4A, but cells were cultured in serum-free medium supplemented with 40 μg / mL PGE2 for 24-h. The abilities of tumor cell proliferation, invasion and migration in the presence of PGE2 increased significantly. (E) Growth curve of the EC9706- miR-101 cell line that was cultured in the medium supplemented with 40 μg / mL PGE2. (F) After 48h transfection of pMIR-COX-2-WT or pMIR-COX-2-MT, luciferase assay was measured. Renilla luciferase was used for normalization. The data are an average of triplicate samples from three independent experiments. ** P < 0.01; *** P < 0.001.

https://doi.org/10.1371/journal.pone.0140642.g005

Discussion

ESCC is a complex and heterogeneous disease with multiple underlying pathogenic mechanisms caused by various risk factors. Therefore, it is of great significance to identify novel and effective molecular markers for ESCC diagnosis and treatment assessment. In the present study, we investigated the effect and possible mechanism of miR-101 on human ESCC. First, we examined the expression levels of miR-101 in ESCC. A comparison between 30 pairs of ESCC tumor and adjacent normal tissues showed that the expression levels of miR-101 were significantly less in ESCC tumor (P < 0.001). Similar results were also found in 11 ESCC cell lines, suggesting that miR-101 is downregulated in human ESCC. Second, we showed that miR-101 can reduce cell proliferation by inducing apoptosis and cell cycle arrest at the G0 / G1 phase, as well as decrease the migration and invasion abilities of ESCC cells. Moreover, we confirmed the inhibitory effect of miR-101 on ESCC using an in vivo study. Taken together, all of the data from the in vitro and in vivo studies indicated that miR-101 inhibited the proliferation and metastasis of ESCC. Thirdly, using the human ESCC cell line EC9706 stably transfected with miR-101, we further validated that COX-2 and PGE2 were downregulated at the protein level by the proposed target miR-101. This finding was also confirmed by a luciferase reporter assay, suggesting that miR-101 directly targets COX-2 in ESCC.

The miRNA profile can reveal prospective features in cancer. In ESCC, dozens of miRNAs have been reported to be involved in tumorigenesis and tumor progression [26, 27, 32, 34–44]. However, the functions and real targets of miRNAs were largely unknown. In the present study, we focused on miR-101, a tumor suppressive miRNA, for three reasons. First, miR-101 is located in the genomic loci with a high frequency of allelic losses in several types of cancers, and the down-regulation of miR-101 has been found in a variety of human malignancies including ESCC [26, 45–61] Second, in our previous study, we found that COX-2 has an important effect on the proliferation and metastasis of ESCC [20–23, 33, 62–63]; in our preliminary experiment, among four putative miRNAs (miR-101, miR-143, miR-26a and miR-144) that could bind to the 3 ‘-UTR of COX-2 predicted by at least five databases (as shown above), only miR-101 could inhibit both the proliferation and metastasis of ESCC. Finally, there are no reports regarding miR-101 targeting COX-2 in ESCC, although the regulation of COX-2 expression by miRNAs has been extensively studied in a variety of human tumors [5, 60, 64–70] and the miR-101 / COX-2 pathway has been reported in colon cancer [70], cervical cancer [57], gastric cancer [60] and prostate cancer [69]. In this study, we found the proliferation, migration, and invasion abilities of EC9706 cells stably transfected with miR-101 increased significantly after the addition of PGE2 (a primary product of COX-2). Moreover, the expression levels of miR-101 and, COX-2 as well as PGE2 were negatively correlated according to the western blot of luciferase reporter assay results, indicating that miR-101 inhibit ESCC through COX-2 and that the miR-101 / COX-2 pathway may be very important in ESCC.

The COX-2 gene is located on chromosome 1q25.2-q25.3, with a length of 8.3 kb, consisting of 10 exons and 9 introns, and encoding 604 amino acid residues. It is now accepted that COX-2 can promote cell proliferation, inhibit apoptosis, promote angiogenesis, and suppress immune function as well as other mechanisms involved in tumor development and progression. Recent progress in suppressor miRNA delivery technology offers the possibility of promising new approaches to block COX-2. Among miRNA-based approaches using an in vivo delivery system with DNA plasmids or viral vectors, miRNA replacement therapy with double-stranded RNAs mimicking miRNAs may be one of the most promising methods. As miR-101 has low-to-null toxicity, it may represent a novel class of COX-2-targeting molecules to be exploited for preventive and therapeutic purposes.

In summary, this study provides new insights into the role of miR-101 in human ESCC. It shows that miR-101 is down-regulated in ESCC tumor tissues and cell lines, and that it is able to inhibit cell proliferation, migration and invasion of ESCC cells in vitro as well as reduce xenograft tumor growth and the number of metastatic nodules on the surface of the liver in vivo by targeting COX-2. These results suggest that miR-101 is a tumor suppressor in ESCC, and that it might serve as a therapeutic target in ESCC.

Acknowledgments

We are grateful to Bang-wei Cao for his assistance during our submission.

Author Contributions

Conceived and designed the experiments: YS S. Zhang. Performed the experiments: YS PL JPY XJJ DM LW ZH S. Zhu. Analyzed the data: YS YJW YDW YZ S. Zhu S. Zhang. Contributed reagents/materials/analysis tools: YS S. Zhu. Wrote the paper: YS S. Zhang.

References

  1. 1. Lozano R, Naghavi M, Foreman K, Lim S, Shibuya K, Aboyans V, et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet. 2012; 380 (9859): 2095–2128. pmid:23245604
  2. 2. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010; 127 (12): 2893–2917. pmid:21351269
  3. 3. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin. 2010; 60 (5): 277–300. pmid:20610543
  4. 4. Fosslien E. Molecular pathology of cyclooxygenase-2 in neoplasia. Ann Clin Lab Sci. 2000; 30 (1): 3–21. pmid:10678579
  5. 5. Lin C, Crawford DR, Lin S, Hwang J, Sebuyira A, Meng R, et al. Inducible COX-2-dependent apoptosis in human ovarian cancer cells. Carcinogenesis. 2011; 32 (1): 19–26. pmid:21187340
  6. 6. Kim BM, Maeng K, Lee KH, Hong SH. Combined treatment with the Cox-2 inhibitor niflumic acid and PPARgamma ligand ciglitazone induces ER stress/caspase-8-mediated apoptosis in human lung cancer cells. Cancer Lett. 2011; 300 (2): 134–144. pmid:21067863
  7. 7. Kim HS, Kim MJ, Kim EJ, Yang Y, Lee MS, Lim JS. Berberine-induced AMPK activation inhibits the metastatic potential of melanoma cells via reduction of ERK activity and COX-2 protein expression. Biochem Pharmacol. 2012; 83 (3): 385–394. pmid:22120676
  8. 8. Kim JI, Lakshmikanthan V, Frilot N, Daaka Y. Prostaglandin E2 promotes lung cancer cell migration via EP4-betaArrestin1-c-Src signalsome. Mol Cancer Res. 2010; 8 (4): 569–577. pmid:20353998
  9. 9. Adhim Z, Matsuoka T, Bito T, Shigemura K, Lee KM, Kawabata M, et al. In vitro and in vivo inhibitory effect of three Cox-2 inhibitors and epithelial-to-mesenchymal transition in human bladder cancer cell lines. Br J Cancer. 2011; 105 (3): 393–402. pmid:21750550
  10. 10. Elmets CA, Ledet JJ, Athar M. Cyclooxygenases: mediators of UV-induced skin cancer and potential targets for prevention. J Invest Dermatol. 2014; 134 (10): 2497–2502. pmid:24804836
  11. 11. Shamma A, Yamamoto H, Doki Y, Okami J, Kondo M, Fujiwara Y, et al. Up-regulation of cyclooxygenase-2 in squamous carcinogenesis of the esophagus. Clin Cancer Res. 2000; 6 (4): 1229–1238. pmid:10778945
  12. 12. Zhi H, Zhang J, Hu G, Lu J, Wang X, Zhou C, et al. The deregulation of arachidonic acid metabolism-related genes in human esophageal squamous cell carcinoma. Int J Cancer. 2003; 106 (3): 327–333. pmid:12845669
  13. 13. Yu HP, Xu SQ, Liu L, Shi LY, Cai XK, Lu WH, et al. Cyclooxygenase-2 expression in squamous dysplasia and squamous cell carcinoma of the esophagus. Cancer Lett. 2003; 198 (2): 193–201. pmid:12957358
  14. 14. Kase S, Osaki M, Honjo S, Hashimoto K, Adachi H, Tsujitani S, et al. Expression of cyclooxygenase-1 and cyclooxygenase-2 in human esophageal mucosa, dysplasia and carcinoma. Pathobiology. 2004; 71 (2): 84–92. pmid:14707443
  15. 15. Zhang W, Wang L, Chang A, Jin Y, Rao J. Immunohistochemical analysis of cyclooxygenase-2 expression in premalignant and malignant esophageal glandular and squamous lesions in Cixian, China. Cancer Detect Prev. 2003; 27 (4): 243–249. pmid:12893070
  16. 16. Kumagai Y, Sobajima J, Higashi M, Ishiguro T, Fukuchi M, Ishibashi K, et al. Coexpression of COX-2 and iNOS in Angiogenesis of Superficial Esophageal Squamous Cell Carcinoma. Int Surg. 2015; 100 (4): 733–743. pmid:25875558
  17. 17. Funkhouser EM, Sharp GB. Aspirin and reduced risk of esophageal carcinoma. Cancer. 1995; 76 (7): 1116–1119. pmid:8630885
  18. 18. Corley DA, Kerlikowske K, Verma R, Buffler P. Protective association of aspirin/NSAIDs and esophageal cancer: a systematic review and meta-analysis. Gastroenterology. 2003; 124 (1): 47–56. pmid:12512029
  19. 19. Liu JF, Jamieson GG, Wu TC, Zhu GJ, Drew PA. A preliminary study on the postoperative survival of patients given aspirin after resection for squamous cell carcinoma of the esophagus or adenocarcinoma of the cardia. Ann Surg Oncol. 2009; 16 (5): 1397–1402. pmid:19241108
  20. 20. Li P, Zhang ST, Yu ZL, Wu YD, Liu X, Xu CM, et al. Effects of cyclooxygenase-2 non-selective and selective inhibitors on proliferation inhibition and apoptosis induction of esophageal squamous carcinoma cells. Dis Esophagus. 2009; 22 (1): 21–31. pmid:18564172
  21. 21. Zhang L, Tu J, Yu ZL, Wu YD, Xu CM, Zhang ST. Effects of the inhibition of cyclooxygenase-2 on human esophageal cancer cells: inhibition of cell proliferation and induction of apoptosis. Pathol Oncol Res. 2010; 16 (1): 39–45. pmid:19633925
  22. 22. Shi HY, Lv FJ, Zhu ST, Wang QG, Zhang ST. Dual inhibition of 5-LOX and COX-2 suppresses esophageal squamous cell carcinoma. Cancer Lett. 2011; 309 (1): 19–26. pmid:21652147
  23. 23. Zong Y, Zhang ST, Zhu ST. Nicotine enhances migration and invasion of human esophageal squamous carcinoma cells which is inhibited by nimesulide. World J Gastroenterol. 2009; 15 (20): 2500–2505. pmid:19469000
  24. 24. Bertagnolli MM. Chemoprevention of colorectal cancer with cyclooxygenase-2 inhibitors: two steps forward, one step back. Lancet Oncol. 2007; 8 (5): 439–443. pmid:17466901
  25. 25. Psaty BM, Potter JD. Risks and benefits of celecoxib to prevent recurrent adenomas. N Engl J Med. 2006; 355 (9): 950–952. pmid:16943408
  26. 26. Lin C, Huang F, Li QZ, Zhang YJ. miR-101 suppresses tumor proliferation and migration, and induces apoptosis by targeting EZH2 in esophageal cancer cells. Int J Clin Exp Pathol. 2014; 7 (10): 6543–6550. pmid:25400732
  27. 27. Ding DP, Chen ZL, Zhao XH, Wang JW, Sun J, Wang Z, et al. miR-29c induces cell cycle arrest in esophageal squamous cell carcinoma by modulating cyclin E expression. Carcinogenesis. 2011; 32 (7): 1025–1032. pmid:21551130
  28. 28. Ji J, Wu K, Wu M, Zhan Q. p53 functional activation is independent of its genotype in five esophageal squamous cell carcinoma cell lines. Front Med China. 2010; 4 (4): 412–418. pmid:21191746
  29. 29. Barnas C, Martel-Planche G, Furukawa Y, Hollstein M, Montesano R, Hainaut P. Inactivation of the p53 protein in cell lines derived from human esophageal cancers. Int J Cancer. 1997; 28; 71 (1): 79–87.
  30. 30. Zang W, Wang T, Wang Y, Li M, Xuan X, Ma Y, et al. Myricetin exerts anti-proliferative, anti-invasive, and pro-apoptotic effects on esophageal carcinoma EC9706 andKYSE30 cells via RSK2. Tumour Biol. 2014; 35 (12): 12583–12592. pmid:25192723
  31. 31. Li W, Zheng J, Deng J, You Y, Wu H, Li N, et al. Increased levels of the long intergenic non-protein coding RNA POU3F3 promote DNA methylation in esophageal squamous cell carcinoma cells. Gastroenterology. 2014; 146 (7): 1714–1726. pmid:24631494
  32. 32. Kurashige J, Watanabe M, Iwatsuki M, Kinoshita K, Saito S, Hiyoshi Y, et al. Overexpression of microRNA-223 regulates the ubiquitin ligase FBXW7 in oesophageal squamous cell carcinoma. Br J Cancer. 2012; 106 (1): 182–188. pmid:22108521
  33. 33. Zhang L, Wu YD, Li P, Tu J, Niu YL, Xu CM, et al. Effects of cyclooxygenase-2 on human esophageal squamous cell carcinoma. World J Gastroenterol. 2011; 17 (41): 4572–4580. pmid:22147962
  34. 34. Tanaka Y, Kamohara H, Kinoshita K, Kurashige J, Ishimoto T, Iwatsuki M, et al. Clinical impact of serum exosomal microRNA-21 as a clinical biomarker in human esophageal squamous cell carcinoma. Cancer. 2013; 119 (6): 1159–1167. pmid:23224754
  35. 35. Yang C, Ning S, Li Z, Qin X, Xu W. miR-22 is down-regulated in esophageal squamous cell carcinoma and inhibits cell migration and invasion. Cancer Cell Int. 2014; 14 (1): 138. pmid:25516722
  36. 36. Gong H, Song L, Lin C, Liu A, Lin X, Wu J, et al. Downregulation of miR-138 sustains NF-kappaB activation and promotes lipid raft formation in esophageal squamous cell carcinoma. Clin Cancer Res. 2013; 19 (5): 1083–1093. pmid:23319823
  37. 37. Song Y, Li J, Zhu Y, Dai Y, Zeng T, Liu L, et al. MicroRNA-9 promotes tumor metastasis via repressing E-cadherin in esophageal squamous cell carcinoma. Oncotarget. 2014; 5 (22): 11669–11680. pmid:25375090
  38. 38. Kong KL, Kwong DL, Chan TH, Law SY, Chen L, Li Y, et al. MicroRNA-375 inhibits tumour growth and metastasis in oesophageal squamous cell carcinoma through repressing insulin-like growth factor 1 receptor. Gut. 2012; 61 (1): 33–42. pmid:21813472
  39. 39. Fu MG, Li S, Yu TT, Qian LJ, Cao RS, Zhu H, et al. Differential expression of miR-195 in esophageal squamous cell carcinoma and miR-195 expression inhibits tumor cell proliferation and invasion by targeting of Cdc42. FEBS Lett. 2013; 587 (21): 3471–3479. pmid:24025765
  40. 40. Wang Z, Qiao Q, Chen M, Li X, Wang Z, Liu C, et al. miR-625 down-regulation promotes proliferation and invasion in esophageal cancer by targeting Sox2. FEBS Lett. 2014; 588 (6): 915–921. pmid:24508466
  41. 41. Zhang F, Yang Z, Cao M, Xu Y, Li J, Chen X, et al. MiR-203 suppresses tumor growth and invasion and down-regulates MiR-21 expression through repressing Ran in esophageal cancer. Cancer Lett. 2014; 342 (1): 121–129. pmid:24001611
  42. 42. Akanuma N, Hoshino I, Akutsu Y, Murakami K, Isozaki Y, Maruyama T, et al. MicroRNA-133a regulates the mRNAs of two invadopodia-related proteins, FSCN1 and MMP14, in esophageal cancer. Br J Cancer. 2014; 110 (1): 189–198. pmid:24196787
  43. 43. Jiang Y, Duan Y, Zhou H. MicroRNA-27a directly targets to inhibit cell proliferation in esophageal squamous cell carcinoma. Oncol Lett. 2015; 9 (1): 471–477. pmid:25436011
  44. 44. Zhang HF, Zhang K, Liao LD, Li LY, Du ZP, Wu BL, et al. miR-200b suppresses invasiveness and modulates the cytoskeletal and adhesive machinery in esophageal squamous cell carcinoma cells via targeting Kindlin-2. Carcinogenesis. 2014; 35 (2): 292–301. pmid:24064224
  45. 45. Zhou X, Xia Y, Li L, Zhang G. MiR-101 inhibits cell growth and tumorigenesis of Helicobacter pylori related gastric cancer by repression of SOCS2. Cancer Biol Ther. 2015; 16 (1): 160–169. pmid:25561270
  46. 46. Jiang W, Gu W, Qiu R, Shen C, YaohaoWu EY, Zhang J, et al. miRNA-101 suppresses epithelial-to-mesenchymal transition by targeting HMGA2 in pancreatic cancer cells. Anticancer Agents Med Chem. 2015.
  47. 47. Chen MB, Yang L, Lu PH, Fu XL, Zhang Y, Zhu YQ, et al. MicroRNA-101 down-regulates sphingosine kinase 1 in colorectal cancer cells. Biochem Biophys Res Commun. 2015.
  48. 48. Liu L, Guo J, Yu L, Cai J, Gui T, Tang H, et al. miR-101 regulates expression of EZH2 and contributes to progression of and cisplatin resistance in epithelial ovarian cancer. Tumour Biol. 2014; 35 (12): 12619–12626. pmid:25260883
  49. 49. Yao YL, Ma J, Wang P, Xue YX, Li Z, Zhao LN, et al. miR-101 acts as a tumor suppressor by targeting Kruppel-like factor 6 in glioblastoma stem cells. CNS Neurosci Ther. 2015; 21 (1): 40–51. pmid:25230316
  50. 50. Wang C, Lu S, Jiang J, Jia X, Dong X, Bu P. Hsa-microRNA-101 suppresses migration and invasion by targeting Rac1 in thyroid cancer cells. Oncol Lett. 2014; 8 (4): 1815–1821. pmid:25202416
  51. 51. Zhang K, Zhang Y, Ren K, Zhao G, Yan K, Ma B. MicroRNA-101 inhibits the metastasis of osteosarcoma cells by downregulation of EZH2 expression. Oncol Rep. 2014; 32 (5): 2143–2149. pmid:25190211
  52. 52. Konno Y, Dong P, Xiong Y, Suzuki F, Lu J, Cai M, et al. MicroRNA-101 targets EZH2, MCL-1 and FOS to suppress proliferation, invasion and stem cell-like phenotype of aggressive endometrial cancer cells. Oncotarget. 2014; 5 (15): 6049–6062. pmid:25153722
  53. 53. Wang L, Li L, Guo R, Li X, Lu Y, Guan X, et al. miR-101 promotes breast cancer cell apoptosis by targeting Janus kinase 2. Cell Physiol Biochem. 2014; 34 (2): 413–422. pmid:25059472
  54. 54. Konno Y, Dong P, Xiong Y, Suzuki F, Lu J, Cai M, et al. MicroRNA-101 targets EZH2, MCL-1 and FOS to suppress proliferation, invasion and stem cell-like phenotype of aggressive endometrial cancer cells. Oncotarget. 2014.
  55. 55. Liang X, Liu Y, Zeng L, Yu C, Hu Z, Zhou Q, et al. miR-101 inhibits the G1-to-S phase transition of cervical cancer cells by targeting Fos. Int J Gynecol Cancer. 2014; 24 (7): 1165–1172. pmid:24987920
  56. 56. Lei Q, Shen F, Wu J, Zhang W, Wang J, Zhang L. MiR-101, downregulated in retinoblastoma, functions as a tumor suppressor in human retinoblastoma cells by targeting EZH2. Oncol Rep. 2014; 32 (1): 261–269. pmid:24807198
  57. 57. Lin C, Huang F, Zhang YJ, Tuokan T, Kuerban G. Roles of MiR-101 and its target gene Cox-2 in early diagnosis of cervical cancer in Uygur women. Asian Pac J Cancer Prev. 2014; 15 (1): 45–48. pmid:24528073
  58. 58. Zhang J, Han C, Zhu H, Song K, Wu T. miR-101 inhibits cholangiocarcinoma angiogenesis through targeting vascular endothelial growth factor (VEGF). Am J Pathol. 2013; 182 (5): 1629–1639. pmid:23608225
  59. 59. Wang R, Wang HB, Hao CJ, Cui Y, Han XC, Hu Y, et al. MiR-101 is involved in human breast carcinogenesis by targeting Stathmin1. PLoS One. 2012; 7 (10): e46173. pmid:23071542
  60. 60. He XP, Shao Y, Li XL, Xu W, Chen GS, Sun HH, et al. Downregulation of miR-101 in gastric cancer correlates with cyclooxygenase-2 overexpression and tumor growth. Febs j. 2012; 279 (22): 4201–4212. pmid:23013439
  61. 61. Shen Q, Bae HJ, Eun JW, Kim HS, Park SJ, Shin WC, et al. MiR-101 functions as a tumor suppressor by directly targeting nemo-like kinase in liver cancer. Cancer Lett. 2014; 344 (2): 204–211. pmid:24189458
  62. 62. Meng XY, Zhu ST, Zhou QZ, Li P, Wang YJ, Zhang ST. Promoter methylation regulates cigarette smoke-stimulated cyclooxygenase-2 expression in esophageal squamous cell carcinoma. J Dig Dis. 2012; 13 (4): 208–213. pmid:22435505
  63. 63. Meng XY, Zhu ST, Zong Y, Wang YJ, Li P, Zhang ST. Promoter hypermethylation of cyclooxygenase-2 gene in esophageal squamous cell carcinoma. Dis Esophagus. 2011; 24 (6): 444–449. pmid:21166741
  64. 64. Akhtar N, Haqqi TM. MicroRNA-199a* regulates the expression of cyclooxygenase-2 in human chondrocytes. Ann Rheum Dis. 2012; 71 (6): 1073–1080. pmid:22294637
  65. 65. Park SJ, Cheon EJ, Kim HA. MicroRNA-558 regulates the expression of cyclooxygenase-2 and IL-1beta-induced catabolic effects in human articular chondrocytes. Osteoarthritis Cartilage. 2013; 21 (7): 981–989. pmid:23611898
  66. 66. Song T, Zhang X, Wang C, Wu Y, Dong J, Gao J, et al. Expression of miR-143 reduces growth and migration of human bladder carcinoma cells by targeting cyclooxygenase-2. Asian Pac J Cancer Prev. 2011; 12 (4): 929–933. pmid:21790228
  67. 67. Ji Y, He Y, Liu L, Chong X. MiRNA-26b regulates the expression of cyclooxygenase-2 in desferrioxamine-treated CNE cells. FEBS Lett. 2010; 584 (5): 961–967. pmid:20100477
  68. 68. Chen L, Wang X, Wang H, Li Y, Yan W, Han L, et al. miR-137 is frequently down-regulated in glioblastoma and is a negative regulator of Cox-2. Eur J Cancer. 2012; 48 (16): 3104–3111. pmid:22406049
  69. 69. Hao Y, Gu X, Zhao Y, Greene S, Sha W, Smoot DT, et al. Enforced expression of miR-101 inhibits prostate cancer cell growth by modulating the COX-2 pathway in vivo. Cancer Prev Res (Phila). 2011; 4 (7): 1073–1083.
  70. 70. Strillacci A, Griffoni C, Sansone P, Paterini P, Piazzi G, Lazzarini G, et al. MiR-101 downregulation is involved in cyclooxygenase-2 overexpression in human colon cancer cells. Exp Cell Res. 2009; 315 (8): 1439–1447. pmid:19133256