Distinct Regulation of Transmitter Release at the Drosophila NMJ by Different Isoforms of nemy

David Knight; Konstantin G. Iliadi; Natalia Iliadi; Ronit Wilk; Jack Hu; Henry M. Krause; Paul Taylor; Michael F. Moran; Gabrielle L. Boulianne

doi:10.1371/journal.pone.0132548

Abstract

Synaptic transmission is highly plastic and subject to regulation by a wide variety of neuromodulators and neuropeptides. In the present study, we have examined the role of isoforms of the cytochrome b561 homologue called no extended memory (nemy) in regulation of synaptic strength and plasticity at the neuromuscular junction (NMJ) of third instar larvae in Drosophila. Specifically, we generated two independent excisions of nemy that differentially affect the expression of nemy isoforms. We show that the nemy⁴⁵ excision, which specifically reduces the expression of the longest splice form of nemy, leads to an increase in stimulus evoked transmitter release and altered synaptic plasticity at the NMJ. Conversely, the nemy^26.2 excision, which appears to reduce the expression of all splice forms except the longest splice isoform, shows a reduction in stimulus evoked transmitter release, and enhanced synaptic plasticity. We further show that nemy⁴⁵ mutants have reduced levels of amidated peptides similar to that observed in peptidyl-glycine hydryoxylating mono-oxygenase (PHM) mutants. In contrast, nemy^26.2 mutants show no defects in peptide amidation but rather display a decrease in Tyramine β hydroxylase activity (TβH). Taken together, these results show non-redundant roles for the different nemy isoforms and shed light on the complex regulation of neuromodulators.

Citation: Knight D, Iliadi KG, Iliadi N, Wilk R, Hu J, Krause HM, et al. (2015) Distinct Regulation of Transmitter Release at the Drosophila NMJ by Different Isoforms of nemy. PLoS ONE 10(8): e0132548. https://doi.org/10.1371/journal.pone.0132548

Editor: Christian Wegener, University of Würzburg, GERMANY

Received: February 4, 2015; Accepted: June 17, 2015; Published: August 3, 2015

Copyright: © 2015 Knight et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: This work was supported by grants to GLB from the Natural Sciences and Engineering Council of Canada and the Canadian Institutes of Health Research (FRN#14143). GLB is the recipient of a Tier I Canada Research Chair in Molecular and Developmental Neurobiology. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The strength of transmitter release is highly plastic and can be modulated both acutely and chronically. The modulation of synaptic strength in response to specific inputs facilitates learned behaviours and allows synapses to synchronize their outputs to specific environmental cues. Synaptic strength may be modulated by the action of various neuromodulators including neuropeptides and biogenic amines such as dopamine, octopamine and serotonin, which exert varied effects on synapses through their respective receptors [1–7]. The modulation of synaptic strength by such neuromodulators facilitates the integration and co-ordination of multiple inputs. In this manner, neuromodulators play an essential role in regulating synaptic plasticity, which is essential for the survival of an organism in an ever-changing environment. It is therefore not surprising that there has been considerable interest in understanding the mechanisms by which neuromodulators regulate synaptic plasticity and behaviour.

We have previously shown that nemy, a cytochrome b561 homologue in Drosophila is required for aversive olfactory memory [8]. nemy is expressed in the larval and adult CNS. In the adult CNS, nemy shows strong expression in the antennal lobe and mushroom bodies, structures known to be involved in olfactory learning and memory [8]. In the larval CNS, nemy is expressed in several cells in the midline of the ventral nerve cord. Cytochrome b561 homologues maintain a pool of reduced intra-vesicular ascorbic acid by the transfer electrons generated by the oxidation of ascorbic acid in the cytoplasm across secretory vesicle membranes to reduce intra-vesicular semi-dehydroascorbate, producing ascorbic acid (Reviewed in [9]. Ascorbic acid is a necessary co-factor for mono-oxygenases such as Peptidyl-glycine hydroxylating mono-oxygenase (PHM) and Tyramine β hydroxylase TβH [10]. Both PHM and TβH affect a wide variety of behaviours and biological processes in flies.

PHM catalyzes the first step in a two-step reaction that converts a glycine residue at the C-terminal end of neuropeptide precursors into an α-amide [11,12], thus producing an active amidated neuropeptide. It is estimated that as many as 90% of all neuropeptides in Drosophila require C-terminal amidation to be biologically active [13]. PHM activity has been directly linked to the regulation of several behaviours and biological processes including developmental transitions during embryonic and larval development [13] and circadian locomotor rhythms [14]. In addition, specific neuropeptide precursor genes such as amnesiac, and dFMRF have been shown to affect behaviours including sleep maintenance [15], learning and memory [16–18], synaptic function and plasticity [19–21]. TβH is a homologue of dopamine β-hydroxylase (DβH) in mammals, which converts dopamine into nor-epinephrine [22]. In flies, TβH converts tyramine to octopamine, which acts as both a neuromodulator and neurohormone, similar to nor-epinenphrine in mammals [22,23]. Octopamine has been shown to affect a wide array of behaviours including egg laying [22], social behaviours [24,25] learning and memory [26] and synaptic function and plasticity [27,28].

Several studies have shown that larval NMJ function is regulated by both neuropeptides and neuromodulators such as octopamine [21,28–30]. It is possible therefore, that mutations in nemy may lead to changes in NMJ function. Furthermore, it is possible that nemy may exert multiple effects on NMJ function through effects on both neuropeptide amidation and octopamine synthesis. In the present study, we have addressed this question by examining synaptic strength and plasticity in third instar larval NMJs and compared the effects of mutations in nemy mutants to those observed in PHM and TβH mutants. We show that the nemy gene gives rise to multiple isoforms. We generated independent deletions within the nemy gene that differentially affect the expression of different nemy isoforms. We show that loss of the longest splice form of nemy leads to a significant increase in stimulus evoked transmitter release while loss of the shorter splice forms leads to a decrease in stimulus evoked transmitter release. We also observed significantly different effects on synaptic plasticity in the two nemy mutants. We show that the differences in synaptic function observed in the nemy mutants may be explained by differences in the effects of these mutations on PHM and TβH activity, suggesting unique roles for the different nemy isoforms with regard to PHM and TβH function.

Materials and Methods

Fly Stocks

All stocks were raised on standard fly food, with a 12/12 hr light/dark cycle, at 23 ± 1°C and 45%- 50% relative humidity. w¹¹¹⁸ flies that had previously been outcrossed for 10 generations with Canton S were used as the wild-type strain in this study. The nemy⁴⁵ excision was previously described [8]. The nemy^26.2 excision was generated via imprecise excision of P{EP}¹⁶⁰³⁷ obtained from the GenExel Inc Stock centre. Both the nemy⁴⁵ and nemy^26.2 excisions were outcrossed to the cantonized w¹¹¹⁸ strain for at least 5 generations prior to the start of experiments. The tyramine β-hydroxlase precise (M6) and imprecise (M18) excision mutants were generated by M. Monastirioti (Institute for Molecular Biology and Biotechnology, Heraklion Greece) [22]. Both M6 and M18 lines were outcrossed to Canton S by Sarah Certel (Center for Structural and Functional Neuroscience, University of Montana). The M18 TβH mutants were maintained over a y, FM7 balancer chromosome. Experiments were performed on M18 males with a non y bristle phenotype. To eliminate any possible gender based variability, male M6 larvae were used as controls. The PHM ⁰⁷⁶²³ mutant line in was a gift from P. Taghert (Department of Anatomy and Neurobiology, Washington University, St Louis). PHM⁰⁷⁶²³ flies were balanced over a 2^nd chromosome balancer with a ubiquitous GFP dominant marker to facilitate genotyping in embryonic and larval stages. To avoid genetic background issues arising from the presence of a balancer chromosome, balanced mutants were crossed to wild-type CS flies, and the non-GFP larvae were selected for experiments.

Electrophysiology

Larvae were dissected [31] in a haemolymph like solution HL3.1 [32] containing 0.2 mM calcium and pinned to the base of a Sylgard (Dow Corning) coated perfusion bath. The segmental nerves exiting the ventral ganglion were cut and drawn into a glass-stimulating pipette and stimulated with square wave pulses (0.15 ms, 5–15V) to generate action potentials in the motor neurons. Unless otherwise stated, intracellular recordings were obtained from muscle 6 of abdominal segments 3 and 4 with sharp intracellular microelectrodes filled with a 50/50 mix of 3 M potassium chloride and 3 M potassium acetate (20–50 MW). Stimulus evoked excitatory junction potentials (EJPs) and spontaneous miniature EJPs (mEJPs) were recorded using an Axoclamp 2B amplifier and 0.1 LU head stage from Axon Instruments. Analog signals were low-pass filtered at 5 kHz, digitized at 20 kHz by a Powerlab/4SP A/D converter and saved on a computer for later analysis using Mini Analysis software (Synaptosoft). Quantal content was calculated independently for each NMJ by dividing the EJP amplitude by the mean mEJP amplitude.

RT-PCR

Total RNA was extracted from adult flies and purified using Mini RNA isolation columns from Invitrogen. Isolated RNAs were DNase treated using amplification grade DNase I (Invitrogen). DNase treated RNA was reverse transcribed using a SuperScript II reverse transcriptase kit from Invitrogen and 200–250 ng random hexamers per reaction. cDNA was amplified by PCR using the a single reverse primer that recognizes all nemy isoforms (TTCTCACAGCACAGCATTAC) and the following isoform specific forward primers: nemy^RA, (CATTGAAAGGGTTTTTGAC), nemy^RF, (GATTAGCAGCACATTCAACC), nemy^{RB, RC,RE, RG} (TTCTCACAGCACAGCATTAC). Note that due to the sequence similarity between nemy transcripts RB, RC, RE, and RG, these transcripts were all amplified in a single PCR reaction. The ribomal protein L32 (RP49) was used as a loading control and was amplified using the following primers (fwd: TTGAAGCTGGAAGGACACAA, rev: AATTCGGATCGATTCCTGTG). PCR reactions were run on a 1% agarose gel, and stained with Red-Safe nucleic acid stain.

Mass Spectrometry of amidated neuropeptides

The CNS of 50 third instar larvae were dissected and crushed in 40 ul of an ice-cold solution of methanol/water/formic acid (90:9:1) solution, filtered through Millipore spin-down filters (0.22mm, 6000 rpm for 10 min) dried and stored at -20°C. The pellets were resuspended in 5% acetonitrile and 0.1% formic acid. The peptides were separated by LCMS on a reverse phase column (Magic C18, Michrome Biosciences) using a split-free nano chromatography system (EASY-nLC, Proxeon, Odense Denmark). Samples were loaded via a C18 pre-column and analysis was carried out in duplicate. Elution was performed across a gradient from 5% to 30% acetonitrile in 0.1% Trifluoroacetic acid over 50 min. Peptide detection was carried out using a linear ion trap/FTMS hybrid mass spectrometer (LTQ-Orbitrap, Thermo-Fisher, Bremen Germany) operated in a data dependent mode. Peptide MS data was collected at a resolution of 60,000 full-width half maximum. Tandem mass spectra were obtained in parallel in the lineAr ion trap. The tandem mass spectra were compared to the D. melanogaster database (NCBI) using the Sequest search engine (Thermo-Fisher, San Jose CA). Potential modifications included in the search were amidated C-termini and oxidized methionine residues. The mass accuracy used in the search was 7 ppm for the parent ion and 0.5 Daltons for the fragment ions. Peptide quantitation was carried out using the Xcalibur 2.0 software (Thermo-Fisher, San Jose CA) generated extracted ion current for the monoisotopic isotopic peak of the doubly charged ion. The total area of the extracted peak for each ion was calculated for all samples. All measurements were done in triplicate biological replicates each of which contained two technical repetitions.

NMJ morphology

To examine the synaptic morphology, we transferred 25 male and 25 female flies to fresh bottles and allowed them 24 hrs to lay eggs. The control and nemy mutant third instar larvae from these bottles were dissected to expose the musculature of the body wall in phosphate buffered saline (PBS) then fixed at room temperature in 4% formaldehyde in PBS. Neuromuscular junctions were labeled with FITC-conjugated anti-horse radish peroxidase (1: 400, ICN Biomedicals, CA). Images were captured as a Z-stack using a Leica SP8 confocal microscope. Z-stacks were compressed into a single image and the total number of boutons on muscles 6 and 7 were counted.

Fluorescent in situ hybridization

Fluorescent in situ hybridization (FISH) experiments were performed on Oregon R embryos essentially as described in Wilk et. al [33]. Two RNA probes were used to distinguish the localization of the nemy^RA isoform from other nemy isoforms. The first probe was chosen to specifically anneal to nemy^RA transcripts, while the second probe was designed to hybridize to all nemy transcripts. Probes were DIG-labelled for detection with tyramide signal amplification-FISH as described in Wilk et al [33].

The sequence of the primers used to generate the probes were as follows (T7 promoter underlined):

nemy^RA Fwd:5’ TTCGTTCGCAGCATTCGTGG 3’

nemy^RA Rev: 5’TAATACGACTCACTATAGGGAGTTCGTGTGGCGTG 3’

All transcripts Fwd: 5’ ACTACATCACCAGTGCCATC 3’

All transcripts Rev:

5’ GTAATACGACTCACTATAGGGAGACCACCTTGGTCTTCTGCTCATCTG 3’

Statistical analysis

Data were analysed statistically using an ANOVA and t-test. All statistics were performed using Excel and Sigmaplot software.

Results

nemy was originally generated in a forward genetic screen for mutants affecting courtship memory [34]. A more thorough characterization showed that in addition to defects in courtship memory, nemy mutants also have a defect in middle-term olfactory memory [8]. The mutant used in both of these studies was a P{LacW}¹⁵³ insertion in the 1^st exon of nemy which specifically affects the expression of the longest splice form of the gene. However, Northern Blot analysis showed at least 4 distinct splice forms [8] and several shorter splice forms of nemy are also predicted in flybase (www.flybase.org). To determine whether the different splice forms of nemy have distinct functions we have generated two novel mutations within the nemy locus, named nemy⁴⁵ and nemy^26.2 by excision of two independent transposable elements, P{LacW}¹⁵³ and P{EP}^GE16057 respectively (Fig 1). Both excisions are homozygous viable and breakpoints were confirmed by PCR and subsequent sequencing analysis. Interestingly, the nemy⁴⁵ and nemy^26.2 excisions exert different effects on the expression of nemy isoforms. Using primers specific for each transcript (see Materials and Methods), we examined the expression of the different nemy transcripts by RT-PCR. As shown in Fig 1, expression of the nemy^RA transcript is significantly reduced in nemy⁴⁵ mutants, but is not affected in nemy^26.2 mutants. Conversely, expression of the remaining nemy transcripts is significantly reduced in nemy^26.2 mutants, but not affected in nemy⁴⁵ mutants.

Download:

Fig 1. Excision mutants have different effects on nemy expression.

A. Schematic of the genomic organization of nemy. The P{LacW}¹⁵³ P element used to generate the nemy⁴⁵ excision is represented by an open triangle, while the P{EP}¹⁶⁰³⁷ P-element used to generate the nemy^26.2 excision is shaded in black. The nemy⁴⁵ and nemy^26.2 excisions are indicated by shaded boxes. Scale bar indicates 1 Kb. B-E. RT-PCR of nemy isoforms in control (w), nemy⁴⁵ and nemy^26.2 excisions. B. The nemy^RA isoform is absent in nemy⁴⁵ mutants, but not affected in nemy^26.2 mutants. C. Conversely, isoforms B, E and G are present at control levels in nemy⁴⁵ mutants, but absent in nemy^26.2 mutants. Note, we were unable to detect a band that corresponded to nemy isoform C. D. The nemy isoform F is expressed at control levels in nemy⁴⁵ mutants, but significantly reduced in nemy^26.2 mutants. E. The house keeping gene RP49 was expressed at comparable levels in all genotypes and no signal was detected in ‘no transcript controls’ (NTC).

https://doi.org/10.1371/journal.pone.0132548.g001

Basal transmitter release and synaptic plasticity are impaired in nemy mutants

Both the nemy⁴⁵ and nemy^26.2 mutants were outcrossed to cantonized w¹¹¹⁸ flies for five generations prior to the commencement of experiments to avoid differences in the genetic background of the mutants. To assess whether either the nemy⁴⁵ or nemy^26.2 mutations affect synaptic transmission, we examined stimulus evoked and spontaneous transmitter release at the neuromuscular junctions of third instar larvae. We first examined the effect of the nemy⁴⁵ and nemy^26.2 excisions on spontaneously occurring miniature excitatory junction potentials (mEJPs) in muscle 6 of abdominal segments 3 and 4. Interestingly, we observed different effects of the nemy⁴⁵ and nemy^26.2 excisions on both the amplitude and frequency of spontaneous transmitter release compared to the w¹¹¹⁸ control (Fig 2). nemy^26.2 mutants showed a small but significant increase in mEJP amplitude compared to control without any significant change in the frequency of mEJPs. In contrast, nemy⁴⁵ mutants showed no significant change in mEJP amplitude, but did show a significant increase in the frequency of mEJPs. (Table 1, Fig 2B and 2C). Differences in mEJP amplitude are often equated with a change in the density of postsynaptic receptors, while changes in the frequency of mEJPs are exclusively regulated by the presynaptic neuron [35,36]. These observations of changes in mEJP amplitude and frequency may therefore indicate unique roles for the different isoforms of nemy in both the presynaptic and postsynaptic cells of the NMJ.

Download:

Table 1. Basal transmitter release and synaptic plasticity in control (w¹¹¹⁸) and nemy mutant flies.

https://doi.org/10.1371/journal.pone.0132548.t001

Download:

Fig 2. Basal transmitter release is altered in nemy mutants.

A. Example stimulus evoked EJPs and spontaneous mEJPs. B-C. The amplitude (B) and frequency (C) of miniature EJPs in control (w) and nemy mutants. D. Stimulus evoked EJP amplitude in control (w) and nemy mutants. E. Quantal content in control (w) and nemy mutants. F. Example NMJs from control (w) and nemy mutant third instar larvae. Synaptic boutons are stained with a FITC-conjugated antibody raised against horse-radish peroxidise. G. Quantification of the number of synaptic boutons in control and nemy mutant NMJs. * indicates a significant differences of P < 0.05, ** indicates P < 0.01 and *** indicates P < 0.001. Statistical differences were calculated by ANOVA followed by multiple comparisons using the Student-Newman-Keuls method.

https://doi.org/10.1371/journal.pone.0132548.g002

We next examined the effect of nemy mutations on stimulus evoked transmitter release. Single pulses were delivered to cut motor neurons at a frequency of 0.2 Hz and the stimulus evoked EJPs were recorded from muscle 6 in abdominal segments 3 and 4. Compared to the control (w¹¹¹⁸), we observed a small decrease in stimulus evoked EJP amplitude in nemy^26.2 mutants (Table 1, Fig 2D). Combined with the increased amplitude of mEJPs in these mutants, this amounted to a significant decrease in quantal content of transmitter release from nemy^26.2 mutant NMJs (Table 1, Fig 2E). By contrast, both stimulus evoked EJP amplitude and Quantal content were significantly increased in nemy⁴⁵ mutants compared to control (Table 1, Fig 2D and 2E).

Changes in transmitter release from the NMJ are often coupled with morphological changes including altered axon branching and changes in the number of synaptic boutons. To determine whether the observed changes in transmitter release observed in our nemy mutants also affected NMJ morphology, NMJs of third instar larvae were stained with FITC conjugated anti-horse radish peroxidise (FITC-HRP) that labels all post-mitotic neurons in Drosophila [37]. We observed a small but significant decrease in the number of synaptic boutons in nemy^26.2 mutants, but no significant change in bouton number in nemy⁴⁵ mutants (Table 1, Fig 2F and 2G). Taken together, these results indicate that nemy is required for proper function at the larval NMJ. Furthermore, these data suggest that different isoforms of nemy have distinct effects on NMJ function and morphology.

Given the observed defects in basal transmitter release, we next asked whether nemy mutants show impaired synaptic plasticity. We first looked at paired pulse plasticity by delivering pairs of stimuli with varying inter-stimulus intervals and comparing the amplitude of the second (test) EJP relative to the amplitude of the first (conditioning) EJP across genotypes (Fig 3B). At short inter-stimulus intervals, the test pulse showed moderate facilitation in control preparations under the conditions used (0.2 mM extracellular calcium). nemy^26.2 mutant NMJs showed a greater facilitation at short inter-stimulus intervals than control NMJs (Table 1, Fig 3C). By contrast nemy⁴⁵ mutant NMJs showed a decrease in paired pulse facilitation, and even showed paired pulse depression at the shorter inter-stimulus intervals (less than 50 ms). Paired-pulse plasticity is correlated with transmitter release probability [38]. The increased paired-pulse facilitation observed in nemy^26.2 mutants suggests a decrease in the underlying probability of transmitter release, while the reduced facilitation and depression observed in nemy⁴⁵ mutants suggests an increase in transmitter release probability. These results are therefore consistent with the observations of decreased and increased Quantal content observed in nemy^26.2 and nemy⁴⁵ mutants, respectively.

Download:

Fig 3. Synaptic plasticity is altered in nemy mutants.

A. Example traces showing spontaneous mEJPs and stimulus evoked EJPS in control (w) and nemy mutants. Stimulus evoked EJPs were delivered in pairs and the paired pulse ratio is calculated as the ratio of the test pulse (red) relative to the conditioning pulse (conditioning). B. Paired pulse ratio across multiple interstimulus intervals (ISI). Control (w, black) larvae showed mild paired pulse potentiation at short ISI. This paired pulse potentiation was enhanced in nemy^26.2 mutants (red) while nemy⁴⁵ mutants (green) show paired pulse depression at short ISI.

https://doi.org/10.1371/journal.pone.0132548.g003

We also examined a different form of synaptic plasticity known as paired pulse potentiation. Previous work has shown that the amplitude of EJPs are temporarily facilitated after a short (30s) tetanus (10 Hz stimulation) is applied [39,40]. We observed an approximately 50% increase in the amplitude of EJPs in control preparations following 30s of 10 Hz stimulation. The post-tetanic-potentiation ratio (calculated as the amplitude of the post-tetanic stimulus evoked EJPs relative to the amplitude of pre-tetanic stimulus evoked EJPs) was significantly higher in nemy^26.2 mutant NMJs, but was not significantly different in nemy⁴⁵ mutant NMJs (Table 1). Differences in post-tetanic potentiation may reflect a difference in the size of the reserve pool of vesicles or in the ability to mobilize the reserve pools of vesicles, [41–43] suggesting that the reserve pool of vesicles in nemy^26.2 mutants may be larger and/or more mobile, despite the decrease in transmitter release probability observed during basal transmitter release.

nemy mutants differentially affect PHM and TβH activity

The physiology data suggests that different nemy transcripts have antagonistic effects on NMJ function. The primary role of nemy as a cytochrome b561 homologue is to maintain a pool of reduced ascorbic acid in the lumen of secretory vesicles [9]. This pool of reduced ascorbic acid then serves as a co-factor for mono-oxygenase enzymes such as peptidyl-glycine hydroxylating mono-oxygenase (PHM) and tyramine β-hydroxylase (TβH) [10]. PHM performs the rate-limiting step in the C-terminal amidation of neuropeptide precursors while TβH catalyses the conversion of tyramine into octopamine. Octopamine and many neuropeptides act as neuromodulators and have been shown to affect a wide range of behaviours in flies. Previous work has shown that loss of TβH function leads to decreased transmitter release and a reduction in the number of synaptic boutons [27]. Interestingly, these larval NMJ phenotypes are strikingly similar to those observed in the present study in nemy^26.2 mutants. However, the effect of PHM mutations on NMJ function has not been characterized possibly due to the early larval lethality of homozygous PHM mutants [13]. In mice, PHM function is encoded by the bi-functional gene peptidylglycine a-mono-oxygenase (PAM) [11]. Similar to PHM mutants in flies, homozygous PAM mutants die during development [44]. However, heterozygous animals are viable but still show significant abnormalities related to reduced peptide amidation including impaired synaptic transmission [44].

To determine whether the defects in transmitter release observed in nemy mutants may reflect changes in either PHM or TβH activity, we first examined transmitter release and synaptic plasticity in TβH mutants and PHM^P07623 hypomorphic mutants. Male TβH M18 mutants [22] were compared to male M6 precise excision controls (see Materials and Methods for details). Due to the early lethality of homozygous PHM⁰⁷⁶²³ hypomorphic mutants, we compared transmitter release in heterozygous PHM mutants to CantonS controls (see Materials and Methods for details). Consistent with previously published results, we observed a decrease in stimulus evoked transmitter release from the NMJs of TβH M18 mutants relative to the M6 control (Table 2, Fig 4C). In our hands, we also observed an increase in the amplitude of spontaneous mEJPs in TβH M18 mutants relative to M6 control (Table 2, Fig 4B). By contrast, PHM heterozygous mutants showed a marked increase in stimulus evoked transmitter release relative to control (Table 2, Fig 4C), but did not show any significant difference in the amplitude of the spontaneous mEJPs. These defects in NMJ function observed in TβH and PHM mutants are strikingly similar to those observed in nemy^26.2 mutants and nemy⁴⁵ mutants respectively. To further compare the similarities between TβH or PHM mutants and our nemy mutants, we next examined the effect of mutations in TβH and PHM on paired pulse plasticity. We observed a significant decrease in paired pulse plasticity in heterozygous PHM mutants relative to the control (Table 2, Fig 4E), but did not see any significant differences in paired pulse plasticity in TβH mutants (Table 2, Fig 4D). The observation of a decrease in paired pulse plasticity in PHM mutants is consistent with our observations in nemy⁴⁵ mutants, and supports the hypothesis that nemy⁴⁵ mutants exert an effect on NMJ function via reduced PHM activity. The lack of any difference in paired pulse plasticity in the TβH mutants however was not consistent with nemy^26.2 mutants, suggesting that the defects in NMJ function observed in nemy^26.2 mutants may be only partially due to changes in TβH function.

Download:

Table 2. Basal transmitter release and synaptic plasticity in TβH and PHM mutants.

https://doi.org/10.1371/journal.pone.0132548.t002

Download:

Fig 4. TβH and PHM mutants show similar NMJ phenotypes to nemy^26.2 and nemy⁴⁵ mutants.

A. Example traces showing stimulus evoked EJPs and spontaneous mEJPs. B-C. mEJP amplitude (B) and Quantal Content (C) in TβH and PHM mutants and their respective controls. TβH M18 imprecise excision mutants were compared to TβH M6 precise excision controls. PHM^P07623/+ heterozygous mutants (PHM/+) were compared to CS wildtype flies. TβH mutants showed an increase in mEJP amplitude and decrease in Quantal content, while PHM/+ mutants showed an increase in Quantal content, but no change in mEJP amplitude. D-E. Paired pulse plasticity in TβH (D) and PHM (E) mutants and the appropriate controls. Paired pulse plasticity in TβH M18 mutants was not significantly different to that in TβH M6 controls. Paired pulse plasticity in PHM/+ mutants was reduced compared to CS controls. F. Quantal content in control (w) and nemy mutants maintained on regular food (Black bars), or on food supplemented with 10 mg/ml Octopamine (grey bars). On regular food, nemy^26.2 mutants showed a decrease in Quantal content while nemy⁴⁵ mutants showed an increase in Quantal content. Transferring larvae to octopamine supplemented food had no effect on the Quantal content of either control or nemy⁴⁵ animals, but significantly increased the Quantal content of nemy^26.2 mutants. G. Paired pulse plasticity in control and nemy mutants maintained on regular food (no drug) or food supplemented with 10 mg/ml octopamine (octopamine). The paired pulse ratio was not affected in either control (Black symbols) or nemy⁴⁵ mutants (red symbols) on an octopamine supplemented diet (compare open symbols to closed symbols). However, the paired pulse ratio was reduced to control levels in nemy^26.2 mutants (blue symbols) on an octopamine supplemented diet (compare solid inverted triangles in nemy^26.2 mutants on regular food with open triangles of nemy^26.2 mutants on octopamine supplemented food). * indicates P < 0.05 relative to the genetic control. ** indicates P < 0.01 relative to the genetic control. *** indicates P < 0.001 relative to the genetic control. # indicates P < 0.05 relative to the pharmacological control (regular food). Statistical differences were determined by ANOVA followed by multiple comparisons using the Student-Newman-Keuls method.

https://doi.org/10.1371/journal.pone.0132548.g004

Studies of TβH mutants have shown that defects in egg laying and locomotion can be rescued by feeding octopamine to the animals [22,45,46]. We hypothesized that if the defects observed in nemy^26.2 mutants are due, at least in part, to a reduction in TβH activity, we should be able to rescue this by feeding octopamine to larvae. Furthermore, the increased transmitter release observed in nemy⁴⁵ mutants may be partially masked by a concomitant reduction in TβH activity in these mutants. To test these possibilities, control and mutant larvae were transferred to food containing 10 mg/ml octopamine 24–36 hours prior to experiments. We then compared NMJ function in these animals to larvae that were maintained on regular food.

Consistent with our earlier results, nemy^26.2 mutant larvae maintained on regular food showed reduced stimulus evoked transmitter release and increased altered paired pulse plasticity while nemy⁴⁵ mutants maintained on regular food showed increased stimulus evoked transmitter release and altered paired pulse plasticity (Table 3, Fig 4F and 4G). Control larvae that were fed octopamine showed no significant differences in stimulus evoked transmitter release or paired pulse plasticity relative to larvae maintained on regular food (Table 3, Fig 4F and 4G). Similarly, nemy⁴⁵ mutants did not show any change in stimulus evoked transmitter release or synaptic plasticity following octopamine feeding. These results suggest that dietary derived octopamine is not able to exert a lasting effect in control and nemy⁴⁵ mutant larvae. However, nemy^26.2 mutants fed octopamine showed a significant increase in stimulus evoked transmitter release and a concomitant decrease in paired pulse plasticity compared to larvae maintained on regular food (Table 3, Fig 4F and 4G). Interestingly, stimulus evoked transmitter release and synaptic plasticity in octopamine fed nemy^26.2 mutant larvae was not significantly different to that observed in control larvae maintained on regular food, suggesting that supplying a source of octopamine to nemy^26.2 mutant larvae is sufficient to rescue the defects in NMJ function. Furthermore, since the effect of dietary octopamine was specific to nemy^26.2 mutants, these results suggest that the rescue of synaptic function in octopamine fed nemy^26.2 mutants must result from regulated release of octopamine from secretory vesicles.

Download:

Table 3. Effect of octopamine diet on basal transmitter release and paired pulse plasticity.

https://doi.org/10.1371/journal.pone.0132548.t003

Finally, to confirm an effect of the nemy mutations on PHM activity, we measured the level of amidated neuropeptides in control and nemy mutants. Previous work showed that peptide amidation levels were reduced in nemy⁴⁵ mutants [8], however peptide amidation in nemy^26.2 mutants was not examined. As in the previous study, we used the amidation of the FMRF family of neuropeptides derived from the dFMRF precursor [8] as a measure of peptide amidation. The ANOVA analysis did not reveal any differences (F_2,12 = 3.44, p = .066) between genotypes in the level of a nonamidated peptide (WFGDVNQKPI) that served as an internal control. Thus the intensity of amidated neuropeptides was normalized against the intensity of non-amidated peptides in the same sample. We observed significant differences in neuropeptide amidation in nemy⁴⁵ and nemy^26.2 mutants (Fig 5). Consistent with our previous work, we saw reduced amidation of the FMRFamide neuropeptides in nemy⁴⁵ mutants. We observed a significant reduction in the levels of both TPAEDFMRFamide (P < 0.05) and PDNFMRFamide (P < 0.005) in nemy⁴⁵ mutants. We also compared the level of amidation between nemy mutants and another wild-type Canton S control line (Fig 1 in S1 File). Although this line is less appropriate as a genetic background control than cantonised w¹¹¹⁸, it is nonetheless relevant since all our lines were converted to a Canton S background. Moreover, the cantonised w¹¹¹⁸ control line does not differ from Canton S in the levels of amidation for all four FMRFa-like peptides (S1 File). The ANOVA did not find any differences between Canton S, nemy^26.2 and nemy⁴⁵ mutant lines in the level of non-amidated peptides (F_2,12 = 1.32, p = .304) (Fig 1A in S1 File). Similarly, comparisons between genotypes for FMRFa-like peptides revealed that nemy^26.2 mutants do not differ from Canton S whereas nemy⁴⁵ mutants show significant decreases in the amidation for all four FMRFa-like peptides (Fig 1B in S1 File). These results suggest that PHM activity is differentially affected by different nemy isoforms.

Download:

Fig 5. Peptide amidation in control and nemy mutants.

Mass Spectrometry analysis of peptide amidation in control and nemy mutants. The intensity of amidated neuropeptides was normalized against the intensity of non-amidated peptides in the same sample. We observed an increase in the amidation of neuropeptides in nemy^26.2 mutants, and a decrease in the amidation of neuropeptides in nemy⁴⁵ mutants. The levels of amidated neuropeptides were consistently higher in nemy^26.2 mutants relative to nemy⁴⁵ mutants. * indicates a significant difference (P < 0.05) compared with w¹¹¹⁸ and # indicates a significant difference (P < 0.05) compared with nemy^26.2 mutants.

https://doi.org/10.1371/journal.pone.0132548.g005

nemy isoforms show distinct localization

The above results suggest the different nemy isoforms differentially affect PHM and TβH activity. We hypothesized that this likely arises from differences in the cellular or sub-cellular localization of the different nemy isoforms. Using an antibody that detects all isoforms of Nemy, we have previously shown that Nemy is expressed in both the larval and adult brain and can be detected both pre-and post-synaptically at NMJs of third instar larvae (Figs 1–3 in S1 File). Lacking an antibody capable of distinguishing between individual isoforms of Nemy, we utilized fluorescent in situ hybridization (FISH) using two probes against nemy, one that specifically detects the longest splice form and a second probe that recognizes all nemy isoforms. Since nemy expression is highest during embryonic and pupal stages [47], we focussed on the expression of nemy transctipts in embryos. As seen in Fig 6, using a probe that recognizes all nemy transcripts, we detected nemy expression in the embryonic CNS and ventral nerve cord, we also observed fluorescence in processes exiting the ventral nerve cord that may be peripheral axons. In contrast, we were unable to detect expression of the nemy^A transcript in the ventral nerve cord indicating that the different transcripts of nemy are differentially localized.

Download:

Fig 6. Fluorescent in situ hybridization of nemy transcripts.

A and A’. Lateral/ventral view of a stage 15 embryo showing in situ hybridization to the salivary gland (sg) and ventral nerve chord (vnc) of a probe that recognizes all nemy transcripts. A’ shows a higher magnification of A, arrowhead points to an axon. B and B’. Lateral/ventral view of a stage 15 embryo showing in situ hybridization to the salivary gland (sg) and ventral nerve cord (vnc) of a probe that specifically recognizes the nemy^RA transcript. B’ shows a higher magnification of B.

https://doi.org/10.1371/journal.pone.0132548.g006

Discussion

The modulation of synaptic strength and plasticity by neuromodulators facilitates learned behaviours and allows synapses to synchronize their outputs to specific environmental cues. The Drosophila NMJ has served as a useful model for examining genetic and pharmacological factors that regulate synaptic strength and plasticity for over 30 years. In the present study, we have examined the role of the cytochrome b561 homologue nemy on synaptic function and plasticity. We found that nemy isoforms differentially affect PHM and TβH function and may therefore indirectly influence some, or all, of the synapses that are modulated by amidated neuropeptides or octopamine.

Since the nemy⁴⁵ excision specifically affects the expression of a single splice form (nemy^A) while the nemy^26.2 excisions affects the expression of several splice forms (nemy^B, nemy^E and nemy^G), we considered the possibility that differences in synaptic function of these observed mutants may reflect differences in the total level of nemy expression. However, if nemy transcripts were functionally redundant, and the phenotype was a reflection of the number of transcripts being expressed, we would expect both mutants to show similar defects in synaptic function, distinguished only by the relative severity of the defect. However, the two nemy excisions were not merely quantitatively different to each other, they exhibited unique phenotypes. Transmitter release probability was reduced and synaptic plasticity was enhanced in nemy^26.2 mutants, while the opposite was true for nemy⁴⁵ mutants. PHM function and thus neuropeptide amidation was impaired in nemy⁴⁵ mutants, but not affected in nemy^26.2 mutants, and finally, defects in nemy^26.2 mutants could be rescued by feeding octopamine to larvae, while the same feeding protocol had no effect on nemy⁴⁵ mutants. These results suggest that different isoforms of nemy have unique functions.

nemy and TβH function

Octopamine signalling is the invertebrate equivalent of adrenergic signalling in vertebrates. Octopamine receptors are structurally and functionally similar to adrenergic receptors [48,49] and the action of octopamine on these receptors affects a wide array of behaviours [22,24–26]. Even the biosynthesis of octopamine in invertebrates shares similarities with nor-adrenaline biosynthesis in vertebrates. TβH shares 39% identity and 55% similarity with vertebrate Dopamine β hydroxylase [DβH, 22] and converts tyramine to octopamine in the presence of ascorbic acid [10]. Octopamine has been shown to enhance transmitter release and muscle contraction in invertebrates including at the Drosophila NMJ [27,50] and has also been shown to affect synaptic outgrowth during starvation [27,28]. The results of the present study suggest that the shorter splice forms of nemy may indirectly regulate TβH function.

Previous analysis of nemy expression has shown strong localisation of nemy in several cells along the midline of the ventral nerve cord [8]. This staining pattern is consistent with reports of TβH expression [22]. In the present study, we showed reductions in transmitter release in nemy^26.2 mutants similar to those observed in TβH mutants [27]. Furthermore, we were able to rescue the defects in synaptic function by feeding larvae on a diet containing 10 mg/ml octopamine for 24–36 hr prior to experiments. These results suggest that the defects in synaptic function observed in nemy^26.2 mutants are due to a decrease in TβH function. Interestingly, we did not see any change in transmitter release in nemy⁴⁵ mutants following octopamine feeding suggesting that TβH function, and thus octopamine levels, may not be significantly altered in the nemy⁴⁵ mutants [27,28].

It is worth noting that rescue of synaptic function in nemy^26.2 mutants on an octopamine supplemented diet cannot be attributed to an acute action of octopamine on its receptors. Muscles 6 and 7 are not directly innervated by octopaminergic neurons [27,51,52], such that octopaminergic modulation of these synapses must occur by paracrine or endocrine release of octopamine from neighbouring muscles or the CNS. Given the relatively large volume of a physiology chamber (1–2 ml), such distant sources of octopamine are unlikely to be effective in an in situ assay of synaptic function. As such the rescue of nemy^26.2 mutants on octopamine supplemented food is indicative of a lasting effect of octopamine released into the haemolymph while the larvae are still intact and may indicate a persistent requirement for octopamine to maintain normal synaptic function.

Another interesting observation of the present study is the role of octopamine in short-term synaptic plasticity. We observed an enhancement of paired pulse plasticity in nemy^26.2 mutants that was rescued by addition of octopamine to the diet suggesting a role for octopamine in the regulation of paired pulse plasticity. Interestingly however, paired pulse plasticity did not show any significant impairment in TβH mutants, which lack octopamine. One possible explanation for these results may be the presence of multiple octopamine receptors at the NMJ. Recent work examining the role of octopamine in starvation induced synaptic growth has shown that octopamine induces synaptic outgrowth by activation of Octβ2R receptors [27], but also impairs synaptic outgrowth via an action on Octβ1R receptors [28]. It is possible that octopamine may exert similarly antagonistic effects on synaptic function through these receptors. In the absence of any octopaminergic signalling, as seen in TβH mutants, the net effect results in no significant change in paired pulse plasticity. In nemy^26.2 mutants however, TβH function may be impaired but not entirely absent, since nemy^26.2 mutants do not show defects in egg laying such as those seen in TβH mutants [22]. In these mutants, the loss or reduction of octopamine from selected sources leads to an enhancement of paired pulse plasticity that can be rescued by feeding octopamine to the larvae.

nemy and PHM function

Neuropeptides regulate a diverse array of biological processes through their actions as neuromodulators and endocrine hormones. All neuropeptides are synthesized as part of a larger, inactive neuropeptide precursor protein, which is post-translationally modified to generate one or more active neuropeptides [7]. The most common form of post-translational modification of neuropeptide precursors in Drosophila is C-terminal amidation of glycine-extended peptides by the combined actions of PHM and PAL (peptidyl-glycine α-lyase) [12]. It has been suggested that as many as 90% of all neuropeptides in Drosophila undergo C-terminal amidation [13]. PHM catalyzes the first and rate-limiting step of this C-terminal amidation, and is thought to be a key regulatory point in the processing of neuropeptides [11]. PHM activity has been directly linked to the regulation of several behaviours and biological processes including developmental transitions during embryonic and larval development [13] and circadian locomotor rhythms [14]. In addition, specific amidated neuropeptides such as the pituitary adenylate cyclise peptide (PACAP) and the FMRF family of neuropeptides have also been shown to affect behaviours including sleep maintenance [15], learning and memory [16–18] and synaptic function and plasticity [19–21].

The results of the present study confirm our previous observation of reduced neuropeptide amidation in nemy⁴⁵ mutants [8]. This decrease in peptide amidation is likely due to a decrease in PHM function. It should be noted however that nemy⁴⁵ mutants do not completely abolish PHM function. Homozygous PHM mutants die as late embryos or early larvae [13] while nemy⁴⁵ mutants are completely viable. It is possible that the remaining nemy isoforms also affect PHM function. While we did not observe a difference in the amidation of FMRF peptides in nemy^26.2 mutants, we cannot rule out a role for shorter nemy isoforms in the amidation of other neuropeptides. We have previously compared the expression of nemy and PHM in the larval CNS, and while there is considerable overlap in the expression patterns, not all PHM expressing cells showed expression of nemy [8]. Recent work identified a second cytochrome b561 homologue in Drosophila that is regulated by the transcription factor DIMMED [53]. DIMMED has been shown to be the primary transcriptional regulator of peptidergic cell fate in Drosophila [54]. Interestingly, while the other cytochrome b561 homologue (current designation CG1275) was upregulated by DIMMED expression along with PHM, the study did not find any increase in nemy expression [53]. Combined with the results of the present study, these results suggest that the cytochrome b 561 homologues in Drosophila play unique roles in regulating the function of PHM and possibly other mono-oxygenases. It should be noted however that our results may indicate the presence of a feedback loop between the expression/function of the cytochrome b561 homologues. The increased amidation of TPAEDFMRF neuropeptides observed in nemy^26.2 mutants may be the result of a compensatory increase in the expression of CG1275. While nemy is not the only cytochrome 561 homologue associated with peptidergic cells in Drosophila, the results of the present study suggest that the longest splice form of nemy affects PHM function and is required for the normal amidation of at least a subset of neuropeptides.

An interesting observation from the present study is that both nemy⁴⁵ and heterozygous PHM mutants result in elevated neurotransmitter release and decreased plasticity at the NMJ. However, the molecular identity of the neuropeptide(s) responsible for this change in NMJ function remains to be determined. Despite a wealth of knowledge surrounding the roles of specific neuropeptides in specific functions [7], relatively little information exists as to the effects of these peptides on NMJ function. One family of neuropeptides that has been well characterized at the NMJ are FMRFamides. This family of neuropeptides are characterized by the signature C-terminal tetra-peptide sequence Phe-Met-Arg-Phe-NH₂ [55] and have been shown to synaptic function in both vertebrates and invertebrates [20,21,56,57].

In the present study, we showed a decrease in the levels of amidated FMRF neuropeptides, including the most abundant species (DPKQDFMRFa) in nemy⁴⁵ mutants. Given that acute application of FMRFamide peptides enhances presynaptic calcium influx and transmitter release [21], the reduction of FMRFamide peptides might be expected to reduce transmitter release. However, we observed a significant increase in transmitter release in the nemy⁴⁵ mutants. While we did observe a decrease in transmitter release in the nemy^26.2 mutants, this is unlikely to be due to changes in the level of FMRFamides. First, MS data showed no significant changes in the levels of amidated neuropeptides in the nemy^26.2 mutants, and second, the reduction in transmitter release observed in the nemy^26.2 mutants was completely rescued by feeding octopamine to the larvae, suggesting that this reduction was due to an effect of TβH function and octopamine synthesis. Interestingly, the increase in transmitter release observed in nemy⁴⁵ mutants was strikingly similar to that observed in heterozygous PHM mutants, strengthening the suggestion that these defects are due to a decrease in PHM function. While the identity of the neuropeptide(s) affected in nemy⁴⁵ and PHM heterozygous mutants remains to be determined, the results suggest that a predominant regulatory feature of NMJ function includes an as yet unidentified inhibitory neuropeptide. Further work will be required to uncover the identity of this peptide.

Conclusion

The results of the present study show isoform specific roles for nemy in regulating NMJ function. Taken together, these results suggest that the longest nemy splice form, which is reduced in nemy⁴⁵ mutants, affects NMJ function predominantly by a reduction in PHM function. Alternatively, the shorter splice forms of nemy, which are reduced in the nemy^26.2 mutant, appear to affect NMJ function predominantly by a reduction in TβH function. In situ localization data suggests that the specific roles for the nemy isoforms may arise from different cellular localizations of the transcripts. While these effects of nemy on synaptic function are indirect, the different phenotypes observed in independent nemy mutants suggest cytochrome b561 may be an important regulator of neuromodulation. Regulation at this level may be particularly important for the integration and/or synchronization of different neuromodulatory signals. While neuropeptide release normally depends on extracellular calcium entry through voltage-gated channels, a recent study showed that octopamine could stimulate neuropeptide release independently of extracellular calcium at the NMJ [58]. Other recent studies have also observed interesting and novel interactions between the neuromodulatory effects of different biogenic amines [5,59]. While neuromodulation of synaptic strength has been viewed as an important factor in the regulation of behavioural plasticity for some time, these studies, combined with the present study suggest that neuromodulation of behavioural plasticity may be more complex than previously understood.

Supporting Information

S1 File. Materials and Methods.

Third instar larvae were dissected in PBS and fixed in 4% paraformaldehyde for 25 min at room temperature, then washed in PBST three times (each 10 min), blocked in blocking solution (PBST with 5% normal goat serum, 1% BSA) for 60 min. Primary antibodies were: guinea-pig anti-Nemy 1:20, rabbit anti-Nemy 1:20, mouse anti-Dlg 1:20 (DSHB), FITC-labeled goat anti-HRP1:250 (The Jackson Laboratory), rabbit anti-GFP 1:200 (Life Technologies). Secondary antibodies were: goat anti-guinea-pig Alexa-Fluor 488 1:300 (Life Technologies), goat anti-rabbit Alexa-Fluor 555 1:300 (Molecular Probes) or goat anti-rabbit Alexa-Flour 488 1:300 (Life Technologies), goat anti-mouse Alexa-Fluor 555 1:300 (Molecular Probes). All antibodies were incubated for 2 h at room temperature or overnight at 4°C. All images were obtained using a Leica DMRA2 fluorescent microscope (Leica, Deerfield, IL). S1 Fig A. Peptide amidation levels. (A1) Peptide amidation in control cantonised w¹¹¹⁸ and Canton S lines. NS indicates non-significant difference. (A2) Peptide amidation in control Canton S and nemy mutant lines. * indicates a significant difference (P < 0.05) compared with w¹¹¹⁸ and # indicates a significant difference (P < 0.05) compared with nemy^26.2 mutants. B. Third instar larval NMJs. Muscles 6/7 were immunostained with guinea-pig #1 (B1)and guinea-pig #2 (B2) anti-Nemy. The arrows point to the center of synaptic boutons that express Nemy. C. Nemy is expressed at NMJs. Images of third instar NMJs formed on muscles 6 and 7 stained with rabbit anti-Nemy (C1), FITC conjugated goat anti-horse radish peroxidase (C2) and its co-localization (C3). The arrows point to the center of synaptic boutons that express Nemy. D. Nemy expression at NMJs can be detected using Nemy-GAL4. (D1) Double staining for nemy³³⁵GAL4:10XUAS-mCD8-GFP at the larvae NMJ, muscles 6/7. GFP fluorescence pattern, anti-DLG immunereactivity (D2) and merged red and green channels (D3).

https://doi.org/10.1371/journal.pone.0132548.s001

(DOCX)

Acknowledgments

This work was supported by grants to GLB from the Natural Sciences and Engineering Council of Canada and the Canadian Institutes of Health Research. GLB is the recipient of a Tier I Canada Research Chair in Molecular and Developmental Neurobiology.

Author Contributions

Conceived and designed the experiments: DK KGI PT MM GLB. Performed the experiments: DK KGI NI RW JH PT. Analyzed the data: DK KGI NI RW JH HK PT MM GLB. Contributed reagents/materials/analysis tools: DK KGI NI RW JH HK PT MM GLB. Wrote the paper: DK KGI GLB.

References

1. Van Swinderen B, Andretic R (2011) Dopamine in Drosophila: setting arousal thresholds in a miniature brain. Proc Biol Sci 278: 906–913. pmid:21208962
- View Article
- PubMed/NCBI
- Google Scholar
2. Waddell S (2010) Dopamine reveals neural circuit mechanisms of fly memory. Trends Neurosci 33: 457–464. pmid:20701984
- View Article
- PubMed/NCBI
- Google Scholar
3. Wu WH, Cooper RL (2012) Serotonin and synaptic transmission at invertebrate neuromuscular junctions. Exp Neurobiol 21: 101–112. pmid:23055788
- View Article
- PubMed/NCBI
- Google Scholar
4. Curran KP, Chalasani SH (2012) Serotonin circuits and anxiety: what can invertebrates teach us? Invert Neurosci 12: 81–92. pmid:22918570
- View Article
- PubMed/NCBI
- Google Scholar
5. Burke CJ, Huetteroth W, Owald D, Perisse E, Krashes MJ, Das G, et al. (2012) Layered reward signalling through octopamine and dopamine in Drosophila. Nature 492: 433–437. pmid:23103875
- View Article
- PubMed/NCBI
- Google Scholar
6. Erion R, DiAngelo JR, Crocker A, Sehgal A (2012) Interaction between sleep and metabolism in Drosophila with altered octopamine signaling. J Biol Chem 287: 32406–32414. pmid:22829591
- View Article
- PubMed/NCBI
- Google Scholar
7. Taghert PH, Nitabach MN (2012) Peptide neuromodulation in invertebrate model systems. Neuron 76: 82–97. pmid:23040808
- View Article
- PubMed/NCBI
- Google Scholar
8. Iliadi KG, Avivi A, Iliadi NN, Knight D, Korol AB, Nevo E, et al. (2008) nemy encodes a cytochrome b561 that is required for Drosophila learning and memory. Proc Natl Acad Sci U S A 105: 19986–19991. pmid:19064935
- View Article
- PubMed/NCBI
- Google Scholar
9. Fleming PJ, Kent UM (1991) Cytochrome b561, ascorbic acid, and transmembrane electron transfer. Am J Clin Nutr 54: 1173S–1178S. pmid:1962566
- View Article
- PubMed/NCBI
- Google Scholar
10. Hess CR, McGuirl MM, Klinman JP (2008) Mechanism of the insect enzyme, tyramine beta-monooxygenase, reveals differences from the mammalian enzyme, dopamine beta-monooxygenase. J Biol Chem 283: 3042–3049. pmid:18032384
- View Article
- PubMed/NCBI
- Google Scholar
11. Eipper BA, Stoffers DA, Mains RE (1992) The biosynthesis of neuropeptides: peptide alpha-amidation. Annu Rev Neurosci 15: 57–85. pmid:1575450
- View Article
- PubMed/NCBI
- Google Scholar
12. Kolhekar AS, Roberts MS, Jiang N, Johnson RC, Mains RE, Eipper BA, et al. (1997) Neuropeptide amidation in Drosophila: separate genes encode the two enzymes catalyzing amidation. J Neurosci 17: 1363–1376. pmid:9006979
- View Article
- PubMed/NCBI
- Google Scholar
13. Jiang N, Kolhekar AS, Jacobs PS, Mains RE, Eipper BA, Taghert PH (2000) PHM is required for normal developmental transitions and for biosynthesis of secretory peptides in Drosophila. Dev Biol 226: 118–136. pmid:10993678
- View Article
- PubMed/NCBI
- Google Scholar
14. Taghert PH, Hewes RS, Park JH, O'Brien MA, Han M, Peck ME (2001) Multiple amidated neuropeptides are required for normal circadian locomotor rhythms in Drosophila. J Neurosci 21: 6673–6686. pmid:11517257
- View Article
- PubMed/NCBI
- Google Scholar
15. Liu W, Guo F, Lu B, Guo A (2008) amnesiac regulates sleep onset and maintenance in Drosophila melanogaster. Biochem Biophys Res Commun 372: 798–803. pmid:18514063
- View Article
- PubMed/NCBI
- Google Scholar
16. DeZazzo J, Xia S, Christensen J, Velinzon K, Tully T (1999) Developmental expression of an amn(+) transgene rescues the mutant memory defect of amnesiac adults. J Neurosci 19: 8740–8746. pmid:10516293
- View Article
- PubMed/NCBI
- Google Scholar
17. Feany MB, Quinn WG (1995) A neuropeptide gene defined by the Drosophila memory mutant amnesiac. Science 268: 869–873. pmid:7754370
- View Article
- PubMed/NCBI
- Google Scholar
18. Quinn WG, Sziber PP, Booker R (1979) The Drosophila memory mutant amnesiac. Nature 277: 212–214. pmid:121760
- View Article
- PubMed/NCBI
- Google Scholar
19. Dunn TW, Mercier AJ (2005) Synaptic modulation by a Drosophila neuropeptide is motor neuron-specific and requires CaMKII activity. Peptides 26: 269–276. pmid:15629538
- View Article
- PubMed/NCBI
- Google Scholar
20. Hewes RS, Snowdeal EC 3rd, Saitoe M, Taghert PH (1998) Functional redundancy of FMRFamide-related peptides at the Drosophila larval neuromuscular junction. J Neurosci 18: 7138–7151. pmid:9736637
- View Article
- PubMed/NCBI
- Google Scholar
21. Klose MK, Dason JS, Atwood HL, Boulianne GL, Mercier AJ (2010) Peptide-induced modulation of synaptic transmission and escape response in Drosophila requires two G-protein-coupled receptors. J Neurosci 30: 14724–14734. pmid:21048131
- View Article
- PubMed/NCBI
- Google Scholar
22. Monastirioti M, Linn CE Jr., White K (1996) Characterization of Drosophila tyramine beta-hydroxylase gene and isolation of mutant flies lacking octopamine. J Neurosci 16: 3900–3911. pmid:8656284
- View Article
- PubMed/NCBI
- Google Scholar
23. Verlinden H, Vleugels R, Marchal E, Badisco L, Pfluger HJ, Blenau W, et al. (2010) The role of octopamine in locusts and other arthropods. J Insect Physiol 56: 854–867. pmid:20621695
- View Article
- PubMed/NCBI
- Google Scholar
24. Hoyer SC, Eckart A, Herrel A, Zars T, Fischer SA, Hardie SL, et al. (2008) Octopamine in male aggression of Drosophila. Curr Biol 18: 159–167. pmid:18249112
- View Article
- PubMed/NCBI
- Google Scholar
25. Zhou C, Rao Y (2008) A subset of octopaminergic neurons are important for Drosophila aggression. Nat Neurosci 11: 1059–1067. pmid:19160504
- View Article
- PubMed/NCBI
- Google Scholar
26. Wu CL, Shih MF, Lee PT, Chiang AS. (2013) An octopamine-mushroom body circuit modulates the formation of anesthesia-resistant memory in Drosophila. Curr Biol. 23: 2346–2354. pmid:24239122
- View Article
- PubMed/NCBI
- Google Scholar
27. Koon AC, Ashley J, Barria R, DasGupta S, Brain R, Waddell S, et al. (2011) Autoregulatory and paracrine control of synaptic and behavioral plasticity by octopaminergic signaling. Nat Neurosci 14: 190–199. pmid:21186359
- View Article
- PubMed/NCBI
- Google Scholar
28. Koon AC, Budnik V (2012) Inhibitory control of synaptic and behavioral plasticity by octopaminergic signaling. J Neurosci 32: 6312–6322. pmid:22553037
- View Article
- PubMed/NCBI
- Google Scholar
29. Nishikawa K, Kidokoro Y (1999) Octopamine inhibits synaptic transmission at the larval neuromuscular junction in Drosophila melanogaster. Brain Res 837: 67–74. pmid:10433989
- View Article
- PubMed/NCBI
- Google Scholar
30. Chen X, Ganetzky B (2012) A neuropeptide signaling pathway regulates synaptic growth in Drosophila. J Cell Biol 196: 529–543. pmid:22331845
- View Article
- PubMed/NCBI
- Google Scholar
31. Jan LY, Jan YN (1976) L-glutamate as an excitatory transmitter at the Drosophila larval neuromuscular junction. J Physiol 262: 215–236. pmid:186587
- View Article
- PubMed/NCBI
- Google Scholar
32. Feng Y, Ueda A, Wu CF (2004) A modified minimal hemolymph-like solution, HL3.1, for physiological recordings at the neuromuscular junctions of normal and mutant Drosophila larvae. J Neurogenet 18: 377–402. pmid:15763995
- View Article
- PubMed/NCBI
- Google Scholar
33. Wilk R, Murthy SUM, Yan H, Krause HM (2010) In Situ Hybridization: Fruit Fly Embryos and Tissues. Current Protocols Essential Laboratory Techniques: John Wiley & Songs Inc, New York.
34. Kamyshev NG, Iliadi KG, Bragina JV, Kamysheva EA, Tokmatcheva EV, Preat T, et al. (2002) Novel memory mutants in Drosophila: behavioral characteristics of the mutant nemyP153. BMC Neurosci 3: 9. pmid:12149133
- View Article
- PubMed/NCBI
- Google Scholar
35. Karunanithi S, Marin L, Wong K, Atwood HL (2002) Quantal size and variation determined by vesicle size in normal and mutant Drosophila glutamatergic synapses. J Neurosci 22: 10267–10276. pmid:12451127
- View Article
- PubMed/NCBI
- Google Scholar
36. Vautrin J, Barker JL (2003) Presynaptic quantal plasticity: Katz's original hypothesis revisited. Synapse 47: 184–199. pmid:12494401
- View Article
- PubMed/NCBI
- Google Scholar
37. Jan LY, Jan YN (1982) Antibodies to horseradish peroxidase as specific neuronal markers in Drosophila and in grasshopper embryos. Proc Natl Acad Sci U S A 79: 2700–2704. pmid:6806816
- View Article
- PubMed/NCBI
- Google Scholar
38. Zucker RS, Regehr WG (2002) Short-term synaptic plasticity. Annu Rev Physiol 64: 355–405. pmid:11826273
- View Article
- PubMed/NCBI
- Google Scholar
39. Knight D, Harvey PJ, Iliadi KG, Klose MK, Iliadi N, Dolezelova E, et al. (2010) Equilibrative nucleoside transporter 2 regulates associative learning and synaptic function in Drosophila. J Neurosci 30: 5047–5057. pmid:20371825
- View Article
- PubMed/NCBI
- Google Scholar
40. Knight D, Iliadi K, Charlton MP, Atwood HL, Boulianne GL (2007) Presynaptic plasticity and associative learning are impaired in a Drosophila presenilin null mutant. Dev Neurobiol 67: 1598–1613. pmid:17562530
- View Article
- PubMed/NCBI
- Google Scholar
41. Kuromi H, Kidokoro Y (2000) Tetanic stimulation recruits vesicles from reserve pool via a cAMP- mediated process in Drosophila synapses. Neuron 27: 133–143. pmid:10939337
- View Article
- PubMed/NCBI
- Google Scholar
42. Kuromi H, Kidokoro Y (2002) Selective replenishment of two vesicle pools depends on the source of Ca2+ at the Drosophila synapse. Neuron 35: 333–343. pmid:12160750
- View Article
- PubMed/NCBI
- Google Scholar
43. Kuromi H, Kidokoro Y (2003) Two synaptic vesicle pools, vesicle recruitment and replenishment of pools at the Drosophila neuromuscular junction. J Neurocytol 32: 551–565. pmid:15034253
- View Article
- PubMed/NCBI
- Google Scholar
44. Bousquet-Moore D, Mains RE, Eipper BA (2010) Peptidylgycine alpha-amidating monooxygenase and copper: a gene-nutrient interaction critical to nervous system function. J Neurosci Res 88: 2535–2545. pmid:20648645
- View Article
- PubMed/NCBI
- Google Scholar
45. Saraswati S, Fox LE, Soll DR, Wu CF (2004) Tyramine and octopamine have opposite effects on the locomotion of Drosophila larvae. J Neurobiol 58: 425–441. pmid:14978721
- View Article
- PubMed/NCBI
- Google Scholar
46. Selcho M, Pauls D, El Jundi B, Stocker RF, Thum AS (2012) The Role of octopamine and tyramine in Drosophila larval locomotion. J Comp Neurol 520: 3764–3785. pmid:22627970
- View Article
- PubMed/NCBI
- Google Scholar
47. Graveley BR, Brooks AN, Carlson JW, Duff MO, Landolin JM, Yang L, et al. (2011) The developmental transcriptome of Drosophila melanogaster. Nature 471: 473–479. pmid:21179090
- View Article
- PubMed/NCBI
- Google Scholar
48. Balfanz S, Strunker T, Frings S, Baumann A (2005) A family of octopamine [corrected] receptors that specifically induce cyclic AMP production or Ca2+ release in Drosophila melanogaster. J Neurochem 93: 440–451. pmid:15816867
- View Article
- PubMed/NCBI
- Google Scholar
49. Evans PD, Maqueira B (2005) Insect octopamine receptors: a new classification scheme based on studies of cloned Drosophila G-protein coupled receptors. Invert Neurosci 5: 111–118. pmid:16211376
- View Article
- PubMed/NCBI
- Google Scholar
50. Breen CA, Atwood HL (1983) Octopamine—a neurohormone with presynaptic activity-dependent effects at crayfish neuromuscular junctions. Nature 303: 716–718. pmid:6406911
- View Article
- PubMed/NCBI
- Google Scholar
51. Hoang B, Chiba A (2001) Single-cell analysis of Drosophila larval neuromuscular synapses. Dev Biol 229: 55–70. pmid:11133154
- View Article
- PubMed/NCBI
- Google Scholar
52. Monastirioti M, Gorczyca M, Rapus J, Eckert M, White K, et al. (1995) Octopamine immunoreactivity in the fruit fly Drosophila melanogaster. J Comp Neurol 356: 275–287. pmid:7629319
- View Article
- PubMed/NCBI
- Google Scholar
53. Park D, Hadzic T, Yin P, Rusch J, Abruzzi K, et al. (2011) Molecular organization of Drosophila neuroendocrine cells by dimmed. Curr Biol 21: 1515–1524. pmid:21885285
- View Article
- PubMed/NCBI
- Google Scholar
54. Park D, Shafer OT, Shepherd SP, Suh H, Trigg JS, et al. (2008) The Drosophila basic helix-loop-helix protein DIMMED directly activates PHM, a gene encoding a neuropeptide-amidating enzyme. Mol Cell Biol 28: 410–421. pmid:17967878
- View Article
- PubMed/NCBI
- Google Scholar
55. Taghert PH (1999) FMRFamide neuropeptides and neuropeptide-associated enzymes in Drosophila. Microsc Res Tech 45: 80–95. pmid:10332726
- View Article
- PubMed/NCBI
- Google Scholar
56. Lee MG, Park JY, Park YK, Undem BJ (2011) Direct activation of guinea pig vagal afferent neurons by FMRFamide. Neuroreport 22: 609–612. pmid:21734611
- View Article
- PubMed/NCBI
- Google Scholar
57. Saito TH, Nakane R, Akazome Y, Abe H, Oka Y (2010) Electrophysiological analysis of the inhibitory effects of FMRFamide-like peptides on the pacemaker activity of gonadotropin-releasing hormone neurons. J Neurophysiol 104: 3518–3529. pmid:20962074
- View Article
- PubMed/NCBI
- Google Scholar
58. Shakiryanova D, Zettel GM, Gu T, Hewes RS, Levitan ES (2011) Synaptic neuropeptide release induced by octopamine without Ca2+ entry into the nerve terminal. Proc Natl Acad Sci U S A 108: 4477–4481. pmid:21368121
- View Article
- PubMed/NCBI
- Google Scholar
59. Chen A, Ng F, Lebestky T, Grygoruk A, Djapri C, et al. (2013) Dispensable, Redundant, Complementary, and Cooperative Roles of Dopamine, Octopamine, and Serotonin in Drosophila melanogaster. Genetics 193: 159–176. pmid:23086220
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Van Swinderen B, Andretic R (2011) Dopamine in Drosophila: setting arousal thresholds in a miniature brain. Proc Biol Sci 278: 906–913. pmid:21208962
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Waddell S (2010) Dopamine reveals neural circuit mechanisms of fly memory. Trends Neurosci 33: 457–464. pmid:20701984
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Wu WH, Cooper RL (2012) Serotonin and synaptic transmission at invertebrate neuromuscular junctions. Exp Neurobiol 21: 101–112. pmid:23055788
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Curran KP, Chalasani SH (2012) Serotonin circuits and anxiety: what can invertebrates teach us? Invert Neurosci 12: 81–92. pmid:22918570
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Burke CJ, Huetteroth W, Owald D, Perisse E, Krashes MJ, Das G, et al. (2012) Layered reward signalling through octopamine and dopamine in Drosophila. Nature 492: 433–437. pmid:23103875
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Erion R, DiAngelo JR, Crocker A, Sehgal A (2012) Interaction between sleep and metabolism in Drosophila with altered octopamine signaling. J Biol Chem 287: 32406–32414. pmid:22829591
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Taghert PH, Nitabach MN (2012) Peptide neuromodulation in invertebrate model systems. Neuron 76: 82–97. pmid:23040808
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Iliadi KG, Avivi A, Iliadi NN, Knight D, Korol AB, Nevo E, et al. (2008) nemy encodes a cytochrome b561 that is required for Drosophila learning and memory. Proc Natl Acad Sci U S A 105: 19986–19991. pmid:19064935
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Fleming PJ, Kent UM (1991) Cytochrome b561, ascorbic acid, and transmembrane electron transfer. Am J Clin Nutr 54: 1173S–1178S. pmid:1962566
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Hess CR, McGuirl MM, Klinman JP (2008) Mechanism of the insect enzyme, tyramine beta-monooxygenase, reveals differences from the mammalian enzyme, dopamine beta-monooxygenase. J Biol Chem 283: 3042–3049. pmid:18032384
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Eipper BA, Stoffers DA, Mains RE (1992) The biosynthesis of neuropeptides: peptide alpha-amidation. Annu Rev Neurosci 15: 57–85. pmid:1575450
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Kolhekar AS, Roberts MS, Jiang N, Johnson RC, Mains RE, Eipper BA, et al. (1997) Neuropeptide amidation in Drosophila: separate genes encode the two enzymes catalyzing amidation. J Neurosci 17: 1363–1376. pmid:9006979
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Jiang N, Kolhekar AS, Jacobs PS, Mains RE, Eipper BA, Taghert PH (2000) PHM is required for normal developmental transitions and for biosynthesis of secretory peptides in Drosophila. Dev Biol 226: 118–136. pmid:10993678
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Taghert PH, Hewes RS, Park JH, O'Brien MA, Han M, Peck ME (2001) Multiple amidated neuropeptides are required for normal circadian locomotor rhythms in Drosophila. J Neurosci 21: 6673–6686. pmid:11517257
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Liu W, Guo F, Lu B, Guo A (2008) amnesiac regulates sleep onset and maintenance in Drosophila melanogaster. Biochem Biophys Res Commun 372: 798–803. pmid:18514063
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. DeZazzo J, Xia S, Christensen J, Velinzon K, Tully T (1999) Developmental expression of an amn(+) transgene rescues the mutant memory defect of amnesiac adults. J Neurosci 19: 8740–8746. pmid:10516293
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Feany MB, Quinn WG (1995) A neuropeptide gene defined by the Drosophila memory mutant amnesiac. Science 268: 869–873. pmid:7754370
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Quinn WG, Sziber PP, Booker R (1979) The Drosophila memory mutant amnesiac. Nature 277: 212–214. pmid:121760
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Dunn TW, Mercier AJ (2005) Synaptic modulation by a Drosophila neuropeptide is motor neuron-specific and requires CaMKII activity. Peptides 26: 269–276. pmid:15629538
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. Hewes RS, Snowdeal EC 3rd, Saitoe M, Taghert PH (1998) Functional redundancy of FMRFamide-related peptides at the Drosophila larval neuromuscular junction. J Neurosci 18: 7138–7151. pmid:9736637
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Klose MK, Dason JS, Atwood HL, Boulianne GL, Mercier AJ (2010) Peptide-induced modulation of synaptic transmission and escape response in Drosophila requires two G-protein-coupled receptors. J Neurosci 30: 14724–14734. pmid:21048131
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref22] 22. Monastirioti M, Linn CE Jr., White K (1996) Characterization of Drosophila tyramine beta-hydroxylase gene and isolation of mutant flies lacking octopamine. J Neurosci 16: 3900–3911. pmid:8656284
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref23] 23. Verlinden H, Vleugels R, Marchal E, Badisco L, Pfluger HJ, Blenau W, et al. (2010) The role of octopamine in locusts and other arthropods. J Insect Physiol 56: 854–867. pmid:20621695
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref24] 24. Hoyer SC, Eckart A, Herrel A, Zars T, Fischer SA, Hardie SL, et al. (2008) Octopamine in male aggression of Drosophila. Curr Biol 18: 159–167. pmid:18249112
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref25] 25. Zhou C, Rao Y (2008) A subset of octopaminergic neurons are important for Drosophila aggression. Nat Neurosci 11: 1059–1067. pmid:19160504
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref26] 26. Wu CL, Shih MF, Lee PT, Chiang AS. (2013) An octopamine-mushroom body circuit modulates the formation of anesthesia-resistant memory in Drosophila. Curr Biol. 23: 2346–2354. pmid:24239122
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref27] 27. Koon AC, Ashley J, Barria R, DasGupta S, Brain R, Waddell S, et al. (2011) Autoregulatory and paracrine control of synaptic and behavioral plasticity by octopaminergic signaling. Nat Neurosci 14: 190–199. pmid:21186359
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref28] 28. Koon AC, Budnik V (2012) Inhibitory control of synaptic and behavioral plasticity by octopaminergic signaling. J Neurosci 32: 6312–6322. pmid:22553037
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref29] 29. Nishikawa K, Kidokoro Y (1999) Octopamine inhibits synaptic transmission at the larval neuromuscular junction in Drosophila melanogaster. Brain Res 837: 67–74. pmid:10433989
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref30] 30. Chen X, Ganetzky B (2012) A neuropeptide signaling pathway regulates synaptic growth in Drosophila. J Cell Biol 196: 529–543. pmid:22331845
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref31] 31. Jan LY, Jan YN (1976) L-glutamate as an excitatory transmitter at the Drosophila larval neuromuscular junction. J Physiol 262: 215–236. pmid:186587
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref32] 32. Feng Y, Ueda A, Wu CF (2004) A modified minimal hemolymph-like solution, HL3.1, for physiological recordings at the neuromuscular junctions of normal and mutant Drosophila larvae. J Neurogenet 18: 377–402. pmid:15763995
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref33] 33. Wilk R, Murthy SUM, Yan H, Krause HM (2010) In Situ Hybridization: Fruit Fly Embryos and Tissues. Current Protocols Essential Laboratory Techniques: John Wiley & Songs Inc, New York.

[ref34] 34. Kamyshev NG, Iliadi KG, Bragina JV, Kamysheva EA, Tokmatcheva EV, Preat T, et al. (2002) Novel memory mutants in Drosophila: behavioral characteristics of the mutant nemyP153. BMC Neurosci 3: 9. pmid:12149133
View Article
PubMed/NCBI
Google Scholar

[131] View Article

[132] PubMed/NCBI

[133] Google Scholar

[ref35] 35. Karunanithi S, Marin L, Wong K, Atwood HL (2002) Quantal size and variation determined by vesicle size in normal and mutant Drosophila glutamatergic synapses. J Neurosci 22: 10267–10276. pmid:12451127
View Article
PubMed/NCBI
Google Scholar

[135] View Article

[136] PubMed/NCBI

[137] Google Scholar

[ref36] 36. Vautrin J, Barker JL (2003) Presynaptic quantal plasticity: Katz's original hypothesis revisited. Synapse 47: 184–199. pmid:12494401
View Article
PubMed/NCBI
Google Scholar

[139] View Article

[140] PubMed/NCBI

[141] Google Scholar

[ref37] 37. Jan LY, Jan YN (1982) Antibodies to horseradish peroxidase as specific neuronal markers in Drosophila and in grasshopper embryos. Proc Natl Acad Sci U S A 79: 2700–2704. pmid:6806816
View Article
PubMed/NCBI
Google Scholar

[143] View Article

[144] PubMed/NCBI

[145] Google Scholar

[ref38] 38. Zucker RS, Regehr WG (2002) Short-term synaptic plasticity. Annu Rev Physiol 64: 355–405. pmid:11826273
View Article
PubMed/NCBI
Google Scholar

[147] View Article

[148] PubMed/NCBI

[149] Google Scholar

[ref39] 39. Knight D, Harvey PJ, Iliadi KG, Klose MK, Iliadi N, Dolezelova E, et al. (2010) Equilibrative nucleoside transporter 2 regulates associative learning and synaptic function in Drosophila. J Neurosci 30: 5047–5057. pmid:20371825
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref40] 40. Knight D, Iliadi K, Charlton MP, Atwood HL, Boulianne GL (2007) Presynaptic plasticity and associative learning are impaired in a Drosophila presenilin null mutant. Dev Neurobiol 67: 1598–1613. pmid:17562530
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

[ref41] 41. Kuromi H, Kidokoro Y (2000) Tetanic stimulation recruits vesicles from reserve pool via a cAMP- mediated process in Drosophila synapses. Neuron 27: 133–143. pmid:10939337
View Article
PubMed/NCBI
Google Scholar

[159] View Article

[160] PubMed/NCBI

[161] Google Scholar

[ref42] 42. Kuromi H, Kidokoro Y (2002) Selective replenishment of two vesicle pools depends on the source of Ca2+ at the Drosophila synapse. Neuron 35: 333–343. pmid:12160750
View Article
PubMed/NCBI
Google Scholar

[163] View Article

[164] PubMed/NCBI

[165] Google Scholar

[ref43] 43. Kuromi H, Kidokoro Y (2003) Two synaptic vesicle pools, vesicle recruitment and replenishment of pools at the Drosophila neuromuscular junction. J Neurocytol 32: 551–565. pmid:15034253
View Article
PubMed/NCBI
Google Scholar

[167] View Article

[168] PubMed/NCBI

[169] Google Scholar

[ref44] 44. Bousquet-Moore D, Mains RE, Eipper BA (2010) Peptidylgycine alpha-amidating monooxygenase and copper: a gene-nutrient interaction critical to nervous system function. J Neurosci Res 88: 2535–2545. pmid:20648645
View Article
PubMed/NCBI
Google Scholar

[171] View Article

[172] PubMed/NCBI

[173] Google Scholar

[ref45] 45. Saraswati S, Fox LE, Soll DR, Wu CF (2004) Tyramine and octopamine have opposite effects on the locomotion of Drosophila larvae. J Neurobiol 58: 425–441. pmid:14978721
View Article
PubMed/NCBI
Google Scholar

[175] View Article

[176] PubMed/NCBI

[177] Google Scholar

[ref46] 46. Selcho M, Pauls D, El Jundi B, Stocker RF, Thum AS (2012) The Role of octopamine and tyramine in Drosophila larval locomotion. J Comp Neurol 520: 3764–3785. pmid:22627970
View Article
PubMed/NCBI
Google Scholar

[179] View Article

[180] PubMed/NCBI

[181] Google Scholar

[ref47] 47. Graveley BR, Brooks AN, Carlson JW, Duff MO, Landolin JM, Yang L, et al. (2011) The developmental transcriptome of Drosophila melanogaster. Nature 471: 473–479. pmid:21179090
View Article
PubMed/NCBI
Google Scholar

[183] View Article

[184] PubMed/NCBI

[185] Google Scholar

[ref48] 48. Balfanz S, Strunker T, Frings S, Baumann A (2005) A family of octopamine [corrected] receptors that specifically induce cyclic AMP production or Ca2+ release in Drosophila melanogaster. J Neurochem 93: 440–451. pmid:15816867
View Article
PubMed/NCBI
Google Scholar

[187] View Article

[188] PubMed/NCBI

[189] Google Scholar

[ref49] 49. Evans PD, Maqueira B (2005) Insect octopamine receptors: a new classification scheme based on studies of cloned Drosophila G-protein coupled receptors. Invert Neurosci 5: 111–118. pmid:16211376
View Article
PubMed/NCBI
Google Scholar

[191] View Article

[192] PubMed/NCBI

[193] Google Scholar

[ref50] 50. Breen CA, Atwood HL (1983) Octopamine—a neurohormone with presynaptic activity-dependent effects at crayfish neuromuscular junctions. Nature 303: 716–718. pmid:6406911
View Article
PubMed/NCBI
Google Scholar

[195] View Article

[196] PubMed/NCBI

[197] Google Scholar

[ref51] 51. Hoang B, Chiba A (2001) Single-cell analysis of Drosophila larval neuromuscular synapses. Dev Biol 229: 55–70. pmid:11133154
View Article
PubMed/NCBI
Google Scholar

[199] View Article

[200] PubMed/NCBI

[201] Google Scholar

[ref52] 52. Monastirioti M, Gorczyca M, Rapus J, Eckert M, White K, et al. (1995) Octopamine immunoreactivity in the fruit fly Drosophila melanogaster. J Comp Neurol 356: 275–287. pmid:7629319
View Article
PubMed/NCBI
Google Scholar

[203] View Article

[204] PubMed/NCBI

[205] Google Scholar

[ref53] 53. Park D, Hadzic T, Yin P, Rusch J, Abruzzi K, et al. (2011) Molecular organization of Drosophila neuroendocrine cells by dimmed. Curr Biol 21: 1515–1524. pmid:21885285
View Article
PubMed/NCBI
Google Scholar

[207] View Article

[208] PubMed/NCBI

[209] Google Scholar

[ref54] 54. Park D, Shafer OT, Shepherd SP, Suh H, Trigg JS, et al. (2008) The Drosophila basic helix-loop-helix protein DIMMED directly activates PHM, a gene encoding a neuropeptide-amidating enzyme. Mol Cell Biol 28: 410–421. pmid:17967878
View Article
PubMed/NCBI
Google Scholar

[211] View Article

[212] PubMed/NCBI

[213] Google Scholar

[ref55] 55. Taghert PH (1999) FMRFamide neuropeptides and neuropeptide-associated enzymes in Drosophila. Microsc Res Tech 45: 80–95. pmid:10332726
View Article
PubMed/NCBI
Google Scholar

[215] View Article

[216] PubMed/NCBI

[217] Google Scholar

[ref56] 56. Lee MG, Park JY, Park YK, Undem BJ (2011) Direct activation of guinea pig vagal afferent neurons by FMRFamide. Neuroreport 22: 609–612. pmid:21734611
View Article
PubMed/NCBI
Google Scholar

[219] View Article

[220] PubMed/NCBI

[221] Google Scholar

[ref57] 57. Saito TH, Nakane R, Akazome Y, Abe H, Oka Y (2010) Electrophysiological analysis of the inhibitory effects of FMRFamide-like peptides on the pacemaker activity of gonadotropin-releasing hormone neurons. J Neurophysiol 104: 3518–3529. pmid:20962074
View Article
PubMed/NCBI
Google Scholar

[223] View Article

[224] PubMed/NCBI

[225] Google Scholar

[ref58] 58. Shakiryanova D, Zettel GM, Gu T, Hewes RS, Levitan ES (2011) Synaptic neuropeptide release induced by octopamine without Ca2+ entry into the nerve terminal. Proc Natl Acad Sci U S A 108: 4477–4481. pmid:21368121
View Article
PubMed/NCBI
Google Scholar

[227] View Article

[228] PubMed/NCBI

[229] Google Scholar

[ref59] 59. Chen A, Ng F, Lebestky T, Grygoruk A, Djapri C, et al. (2013) Dispensable, Redundant, Complementary, and Cooperative Roles of Dopamine, Octopamine, and Serotonin in Drosophila melanogaster. Genetics 193: 159–176. pmid:23086220
View Article
PubMed/NCBI
Google Scholar

[231] View Article

[232] PubMed/NCBI

[233] Google Scholar

Figures

Abstract

Introduction

Materials and Methods

Fly Stocks

Electrophysiology

RT-PCR

Mass Spectrometry of amidated neuropeptides

NMJ morphology

Fluorescent in situ hybridization

Statistical analysis

Results

Basal transmitter release and synaptic plasticity are impaired in nemy mutants

nemy mutants differentially affect PHM and TβH activity

nemy isoforms show distinct localization

Discussion

nemy and TβH function

nemy and PHM function

Conclusion

Supporting Information

S1 File. Materials and Methods.

Acknowledgments

Author Contributions

References