Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

RETRACTED: miR-150-5p Inhibits Hepatoma Cell Migration and Invasion by Targeting MMP14

  • Tao Li ,

    Contributed equally to this work with: Tao Li, Junjie Xie

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Junjie Xie ,

    Contributed equally to this work with: Tao Li, Junjie Xie

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Chuan Shen,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Dongfeng Cheng,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Yuan Shi,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Zhichong Wu,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Qian Zhan,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Xiaxing Deng,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Hao Chen,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Baiyong Shen,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Chenghong Peng,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Hongwei Li,

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

  • Zhecheng Zhu

    zhuzhecheng@126.com

    Affiliation Department of Hepato-Bilio-Pancreatic Surgery, Shanghai Institute of Digestive Surgery, Rui Jin Hospital affiliated with Shanghai Jiaotong University, Ruijin er Road, No. 197, 200025, Shanghai, People’s Republic of China

Retraction

After this article [1] was published, concerns were raised about Figs 2 and 3.

Specifically,

  • In all panels in Figs 2B and 2C:
    1. ◦ Similarities were noted between multiple regions within each panel.
    2. ◦ Several areas around groups of cells appear to be discontinuous with adjacent background areas.
  • In Fig 3C, both Actin bands of the Huh7 cell line appear to have horizontal discontinuities above and below the bands.

In light of the nature and extent of the above concerns which question the reliability and integrity of the results presented in [1], the PLOS One Editors retract this article.

All authors either did not respond directly or could not be reached.

17 Dec 2025: The PLOS One Editors (2025) Retraction: miR-150-5p inhibits hepatoma cell migration and invasion by targeting MMP14. PLOS ONE 20(12): e0338550. https://doi.org/10.1371/journal.pone.0338550 View retraction

Abstract

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related mortality worldwide. Despite progress in diagnostics and treatment of HCC, its prognosis remains poor because the molecular mechanisms underlying hepatocarcinogenesis are not well understood. In the study, we focused on identifying the role of miRNAs in HCC progression. miRNA microarray was used to analyze the differentially expressed miRNAs, and the results were validated by qPCR. We found that the miR-150-5p expression is down-regulated in HCC tissues compared with pair non-tumor tissues. miR-150-5p expression is also decreased in metastatic cancer tissues compared with pair primary tissues, indicating that miR-150-5p may be involved in HCC metastasis. Functionally, miR-150-5p inhibition significantly promotes hepatoma cell migration and invasion, whereas miR-150-5p overexpression suppresses cancer cell migration and invasion in vitro. The matrix metalloproteinase 14 (MMP14) is identified as a new target gene of miR-150-5p. miR-150-5p markedly inhibits MMP14 expression in hepatoma cells, and miR-150-5p expression is negative correlation with MMP14 expression in vivo. More important, re-expression of MMP14 in hepatoma cells partially reverses the effect of miR-150-5p in inhibiting cell invasion.

Introduction

Hepatocellular carcinoma (HCC) is the fifth most common malignancy worldwide and the incidence is increasing in the East Asia and in developed countries [1], [2]. Despite various therapeutic strategies for HCC that have improved in the last decades, such as surgical resection, radiofrequency and chemotherapy, HCC remains a highly fatal tumor because of a high rate of tumor recurrence and distant metastasis after surgery [3]. However, the molecular mechanisms underlying these processes are not well understood.

MicroRNAs (miRNAs) are a recently discovered class of small noncoding RNAs that regulate gene expression at the post-transcription level. miRNAs have been highly conserved among phylogenetically close species during evolution and have emerged recently as potent regulators of cell growth, cell differentiation and carcinogenesis [4], [5], [6]. Wang et al. showed that miR-195 expression is frequently down-regulated in HCC. miR-195 down-regulation in HCC is significantly correlated with increased angiogenesis, metastasis, and worse recurrence-free survival [7]. They further demonstrated that miR-195 markedly decreases hepatoma cell migration and invasion by directly inhibiting the expression of the pro-angiogenic factor vascular endothelial growth factor (VEGF) and the pro-metastatic factors VAV2 and CDC42 [7]. Overexpression of these targets antagonizes the effect of miR-195 in regulating cell invasion. Yang et al. identified miR-140-5p as an HCC-related miRNA [8]. The expression of miR-140-5p is significantly down-regulated in HCC tissues and its expression levels are associated with multiple nodules, vein invasion, capsular formation, and differentiation, as well as overall and disease-free survival of HCC [8]. Several other miRNAs were also identified to be associated with hepatocarcinogenesis and disease progression such as miR-214, miR-182, miR-29b, miR-7, etc. [9], [10], [11], [12].

Recent studies showed that miR-150 is abnormally expressed in different type of cancer. Ma et al. found that miR-150 expression is down-regulated in colorectal cancer compared with paired non-cancerous tissue [13]. Low expression of miR-150 predicts a shorter survival and a worse response to adjuvant chemotherapy in colorectal cancer [13]. miR-150 suppresses colorectal cancer cell migration and invasion through directly targeting MUC4 [14]. The expression of miR-150 is also lower in esophageal squamous cell carcinoma (ESCC) compared with normal esophageal mucosa [15]. Low miR-150 expression in ESCC contributes to malignant potential, such as lymph node metastasis, venous invasion and poor prognosis [15]. miR-150 suppresses cancer cell invasion by targeting ZEB1 in ESCC or epithelial ovarian cancer [15], [16]. Inversely, other studies showed that miR-150 is up-regulated and functions as pro-metastatic gene. Cao et al. showed that miR-150 is significantly up-regulated in lung cancer and its overexpression promotes the proliferation and migration of lung cancer cells by targeting SRC kinase signalling inhibitor 1 [17]. However, the role of miR-150-5p in regulating HCC progression remains unknown.

Based on these findings, we investigated whether miR-150-5p involves in HCC progression. We found that decreased expression of miR-150-5p relieves repression of MMP14, which results in an increase of cell migration and invasion.

Materials and Methods

2.1 Clinical specimens and cell lines

Tumor tissues were obtained with written informed consent from the Ruijin Hospital affiliated to Shanghai Jiaotong University. The study was approved by the Ethics Committee of Shanghai Jiaotong University. Patients with HCC (n = 53) were enrolled in our study (Table 1), and cancer tissues and pair non-tumor tissues were collected. Hepatoma cells (Huh7 and HepG2) were purchased from the American Type Culture Collection (ATCC, Manassas, VA), and cultured in DMEM (Gibco, Carlsbad, CA,) with 10% fetal bovine serum (Gibco).

thumbnail
Table 1. The characteristics of patients with HCC.

https://doi.org/10.1371/journal.pone.0115577.t001

2.2 Quantitative real-time PCR (qPCR)

Total RNA was extracted from tissues or cell lines using Trizol reagent (Invitrogen, Carlsbad, CA), and reverse transcription (RT) reactions were performed using miR-150-5p-special prime. The specific stem–loop RT primers for miR-150-5p were designed as previously described [18]. RT reactions for mRNA were carried out using the Oligo dT primer. qPCR was performed using a standard protocol from the SYBR Green PCR kit (Toyobo, Osaka, Japan) on Applied Biosystems 7300 real-time PCR system (Applied Biosystems, Foster City, CA). U6 and β-actin were used as references for miRNAs and mRNAs, respectively.

2.3 miR-150-5p transfection

Human miR-150-5p (UCUCCCAACCCUUGUACCAGUG) or 2′-O-methyl modified miR-150 inhibitor (CACUGGUACAAGGGUUGGGAGA) were transfected to hepatoma cells by using Lipofectamine 2000 (Invitrogen) according to the manufacturer.

2.4 Western blot analysis

Western blot analysis to assess MMP14 and β-actin expression was performed as previously described [19]. MMP14 and β-actin primary antibodies were purchased from Abcam and Sigma, respectively.

2.5 Wound filling assay

HCC cells (1–2×106 cells/well) were treated with indicated reagents, and wounds were made using a 1000 µl plastic pipette tip. The size of wound was measured after 48 h of wound formation and photographed.

2.6 Transwell invasion assay

Cell invasion assay was carried out using Transwell chambers with inserts of 8-µm pore size (Corning Costar) as described previously [20]. Briefly, hepatoma cell (Huh7 or HepG2) suspended in serum free medium was seeded onto Matrigel-coated Transwell filters in Biocoat Matrigel invasion chambers. The complete medium (DMEM with 10% FBS) was used as a chemoattractant in the lower chamber. The hepatoma cells were treated with indicated reagents for 72 h, and cells on the lower surface of the membrane were stained with Crystal violet. The cell numbers were determined by counting of the penetrating cells under a microscope at 200× magnification in random fields in each well.

2.7 Luciferase reporter assay

pGL3 plasmid encoding a luciferase reporter gene was purchased from Promega (Madison, WI). Recombinant plasmid of pGL3-MMP14-3′-UTR (wildtype) or pGL3-MMP14-3′-UTR-Mutation was constructed in our laboratory. HepG2 cells (1–2×105 cells/well) were plated in a 24-well plate and cotransfected with 40nM of either miR-150 or miRNA control, 20 ng of either pGL3-MMP14-3′-UTR or pGL3-MMP14-3′-UTR-Mutation, and 2 ng of pRL-TK (Promega, Madison, WI) by using Lipofectamine 2000. The pRL-TK vector was used as an internal control to correct the differences in both transfection and harvest efficiencies. HepG2 cells were collected 48 h after transfection and analyzed using the Dual-Luciferase Reporter Assay System (Promega).

2.8 In vivo experiments

The athymic BALB/C mice (4–6 weeks old) were purchased from the Chinese Academy of Sciences (Shanghai, China), and were bred in a specific pathogen-free facility. The protocol was approved by the Animal Ethics Committee of Shanghai Jiaotong University. All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering. Huh7 cells overexpressed with miR-150-5p were subcutaneously injected into the flanks of nude mice, and Huh7 cells were used as mock control. After 6 weeks, the mice were killed and lung metastases were monitored after inducing deep anesthesia.

2.9 Statistical analysis

Data are expressed as mean ± standard deviation (SD) from at least three separate experiments. The differences between groups were analyzed using Student’s t test. Differences were deemed statistically significant at p<0.05.

Results

3.1 The expression levels of miR-150-5p are down-regulated in HCC

To study the roles of miRNAs in disease progression of HCC, we searched GEO database and a miRNA microarray datasets (GSE54751) was obtained to analyze differentially expressed miRNAs between HCC tissues and pair non-tumor tissues. miRNA microarray data revealed that miR-150-5p expression is lower in HCC tissues compared with adjacent normal tissues (S1 Fig.). To confirm the results of the miRNA microarray analysis, qRT-PCR analysis of 53 surgical HCC specimens was carried out. As shown in Fig. 1A, miR-150-5p is expressed at high levels in pair non-tumor tissues, whereas miR-150-5p level is markedly down-regulated in most HCC tissues. We further assayed miR-150-5p expression in 23 metastatic and pair primary HCC tissues. Fig. 1B shows a significantly lower miR-150-5p expression in metastases than primary HCC, indicating that miR-150-5p down-regulation is associated with HCC metastasis.

thumbnail
Figure 1. miR-150-5p expression is down-regulated in HCC tissues.

(A) Quantitative RT-PCR analysis of miR-150-5p expression level in 53 HCC tissues and pair non-tumor tissues. The results were expressed as Log2 (2–ΔΔCt). (B) Quantitative RT-PCR analysis of miR-150-5p expression level in 23 metastatic and pair primary HCC tissues.

https://doi.org/10.1371/journal.pone.0115577.g001

3.2 Knockdown of miR-150-5p promotes hepatoma cell migration and invasion

The frequent down-regulation of miR-150-5p in HCC tissues implies that miR-150-5p may play important roles in HCC progression. The biological consequences of miR-150-5p knockdown in regulating cancer cell migration and invasion were then examined using cell biology assays. miR-150-5p expression is significantly decreased in Huh7 or HepG2 cells after treatment with miR-150-5p inhibitor (Fig. 2A), and miR-150-5p inhibition promotes Huh7 and HepG2 cell migration (Fig. 2B, C). Furthermore, hepatoma cell invasion was analyzed after miR-150-5p inhibition. As shown in Fig. 2D and E, knockdown of miR-150-5p in hepatoma cells significantly increases cell invasion compared with control. The effect of miR-150-5p inhibition on pulmonary metastasis was further assayed in the nude mice. At the experimental endpoint, lungs were ablated and the overt surface metastases were observed. Fig. 2F showed that miR-150-5p inhibition markedly increases the number of visible lung metastases compared with control group. These data suggest that miR-150-5p down-regulation contributes to hepatoma cell migration and invasion.

thumbnail
Figure 2. miR-150-5p knockdown promotes hepatoma cell migration and invasion.

(A) Quantitative RT-PCR analysis of miR-150-5p expression after miR-150-5p inhibitor treatment in Huh7 and SMMC 7721 cells. * p<0.05. (B and C) Cell migration assay of Huh7 cells (B) or HepG2 cell (C) after miR-150-5p knockdown for 48 h. (D and E) Cell invasion assay of Huh7 cells after miR-150-5p knockdown. Data are shown as the mean ± SD based on at least three independent experiments. *p<0.05. (F) Incidence and number of visible metastases per lung in each cohort following subcutaneous inoculation. *p<0.05.

https://doi.org/10.1371/journal.pone.0115577.g002

3.3 miR-150-5p directly targets matrix metalloproteinase 14 (MMP14) and inhibits its expression

Previous studies have shown that miR-150-5p suppresses several genes expression by targeting its 3′-UTR, such as SRC kinase signalling inhibitor 1, CCR6 and ZEB1 [16], [17], [21]. To identify new potential target genes of miR-150-5p, we searched for candidate genes using TargetScan6.2 and miRBase micoRNA databases. Bioinformatics analysis showed that miR-150-5p directly targets MMP14 gene, an important regulator involving in tumor progression (Fig. 3A). MMP14 plays an important role in tumor invasion by degrading extracellular matrix (ECM) and increasing the secretion of proMMP2 and proMMP9 [22]. We therefore constructed luciferase reporter vector containing 3′-UTR of MMP14. The reporter assay showed that miR-150-5p is able to markedly inhibit luciferase expression, whereas mutation of 4 nucleotides in 3′-UTR of MMP14 results in complete abrogation the suppressive effect (Fig. 3B). Forced expression of miR-150-5p significantly inhibits the MMP14 protein level (Fig. 3C, D), whereas miR-150-5p inhibition results in an increase of MMP14 protein level in Huh7 and HepG2 cells (Fig. 3E) A significant negative correlation was also observed between miR-150-5p and MMP14 expression in vivo (r2 = 0.15389 p = 0.0019, Fig. 3F). These data demonstrated that miR-150-5p suppresses endogenous MMP14 expression in hepatoma cell.

thumbnail
Figure 3. miR-150-5p directly targets MMP14.

(A) Schematic representation of the miR-150-5p site in MMP14 3′-UTR. (B) The 3′UTR reporter assay was carried out in HepG2 cells overexpressed with miR-150-5p. pGL3-MMP14-3′-UTR-WT or pGL3-MMP14-3′-UTR-Mutation was co-transfected with pRL-TK. Luciferase assays were performed 48 h after transfection. Firefly luciferase activity was standardized to Renilla luciferase control. *p<0.05. (C and D) Western blot analysis for endogenous MMP14 protein level after miR-150-5p overexpression in hepatoma cells. (E) Western blot analysis for endogenous MMP14 protein level after miR-150-5p inhibition in hepatoma cells. miR-150-5p-inh, miR-150-5p inhibitor. (F) A significant negative correlation between miR-150-5p and MMP14 expression in vivo (r2 = 0.15389 p = 0.0019).

https://doi.org/10.1371/journal.pone.0115577.g003

3.4 miR-150-5p inhibits hepatoma cell invasion by targeting MMP14

miR-150-5p inhibits endogenous MMP14 expression, and MMP14 regulates tumor invasion by degrading ECM and increasing the expression of MMP2 and MMP9. Therefore, we then investigated whether miR-150-5p controls cancer cell invasion by targeting MMP14. As shown in Fig. 4A and C, miR-150-5p inhibits Huh7 cell invasion, whereas re-expression of MMP14 in Huh7 cells partially reverses the effect of miR-150-5p in inhibiting cell invasion. Similarly, miR-150-5p suppresses HepG2 cell invasion by regulating MMP14 expression (Fig. 4B, C). These results confirmed that miR-150-5p inhibits hepatoma cell invasion and cancer metastasis, at least in part, by inhibiting MMP14 expression.

thumbnail
Figure 4. miR-150-5p inhibits hepatoma cell invasion by targeting MMP14.

https://doi.org/10.1371/journal.pone.0115577.g004

Discussion

miRNAs are class of small noncoding RNAs of 19–24 nucleotides in length, which negatively regulate protein-coding genes expression at the post-transcriptional level [23]. miRNAs have recently emerged as potent regulators of cell development, differentiation and proliferation. Recently, the role of miRNAs in tumorigenesis has been widely investigated and their important regulatory function in several biological processes associated with tumor has been described [24].

In the present study, we showed that miR-150-5p expression is significantly down-regulated in most HCC specimens compared with adjacent normal tissue. We also examined miR-150-5p expression in metastatic and pair primary HCC tissues and found that miR-150-5p expression is decreased in metastases compared to primary HCC, which indicate that miR-150-5p down-regulation is associated with HCC metastasis. The biological function of miR-150-5p in regulating cancer cell invasion was then examined. miR-150-5p knockdown increases Huh7 and HepG2 cell migration and invasion, whereas miR-150-5p overexpression suppresses hepatoma cell invasion. These data suggest that miR-150-5p down-regulation contributes to hepatoma cell migration and invasion.

Matrix metalloproteinases (MMPs) are zinc-dependent endopeptidases that degrade extracellular macromolecules (e.g., collagens, fibronectin, laminins, and proteoglycans) and are known to play important roles in angiogenesis, cancer cell invasion, and cancer metastasis [22], [25]. There are two types of MMPs, membrane-anchored MMPs (MMP14, MMP15, MMP16, etc.) and secreted-type MMPs (MMP2, MMP9, MMP7, MMP26, etc.) [22]. MMP14 plays an important role in cancer metastasis by degrading the ECM and increasing the secretion of proMMP2 and proMMP9 [26]. Taras et al. showed that pravastatin inhibits lung metastasis of rat hepatocellular carcinoma by decreasing the expression of MMP14 [27]. Miyoshi et al. demonstrated that transcription factor Snail promotes cancer cell invasion by up-regulating the expression of MMP14, MMP1 and MMP2 [28]. Moreover, MMP14 expression is significantly associated with portal vein invasion and intrahepatic metastasis in HCC [29].

Here we identified that MMP14 is a novel target gene of miR-150-5p. Bioinformatics analysis showed that miR-150-5p targets 3′UTR of MMP14. The reporter assay showed that miR-150-5p markedly suppresses luciferase expression, whereas mutation of 4 nucleotides in 3′-UTR of MMP14 results in complete abrogation the suppressive effect. Overexpression of miR-150-5p decreases the MMP14 protein level in Huh7 and HepG2 cells. In vivo, a significant negative correlation is also observed between miR-150-5p and MMP14 expression. Functionally, miR-150-5p inhibits hepatoma cell invasion, whereas re-expression of MMP14 partially reverses the effect of miR-150-5p in inhibiting cell invasion.

Conclusions

miR-150-5p is an important mediator of HCC metastasis, thus offering a new target for the development of therapeutic agents against HCC.

Supporting Information

S1 Fig.

miR-150-5p expression is down-regulated in HCC tissues. miR-150-5p expression analysis showed in miRNA microarray datasets (GSE54751).

https://doi.org/10.1371/journal.pone.0115577.s001

(TIF)

Author Contributions

Conceived and designed the experiments: ZCZ TL JJX. Performed the experiments: TL JJX CS DFC YS ZCW QZ XXD HC BYS CHP HWL. Analyzed the data: ZCZ TL JJX CS. Contributed reagents/materials/analysis tools: ZCW QZ. Wrote the paper: QZ ZCZ. Obtained permission for use of cell line: QZ.

References

  1. 1. El-Serag HB, Mason AC (1999) Rising incidence of hepatocellular carcinoma in the United States. N Engl J Med 340:745–750.
  2. 2. Parkin DM, Pisani P, Ferlay J (1999) Global cancer statistics. CA Cancer J Clin 49: 33–64, 31.
  3. 3. Xia L, Huang W, Tian D, Zhu H, Qi X, et al. (2013) Overexpression of forkhead box C1 promotes tumor metastasis and indicates poor prognosis in hepatocellular carcinoma. Hepatology 57:610–624.
  4. 4. Hwang HW, Mendell JT (2006) MicroRNAs in cell proliferation, cell death, and tumorigenesis. Br J Cancer 94:776–780.
  5. 5. Saito Y, Suzuki H, Tsugawa H, Nakagawa I, Matsuzaki J, et al. (2009) Chromatin remodeling at Alu repeats by epigenetic treatment activates silenced microRNA-512-5p with downregulation of Mcl-1 in human gastric cancer cells. Oncogene 28:2738–2744.
  6. 6. Bao B, Ali S, Kong D, Sarkar SH, Wang Z, et al. (2011) Anti-tumor activity of a novel compound-CDF is mediated by regulating miR-21, miR-200, and PTEN in pancreatic cancer. PLoS One 6:e17850.
  7. 7. Wang R, Zhao N, Li S, Fang JH, Chen MX, et al. (2013) MicroRNA-195 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting the expression of VEGF, VAV2, and CDC42. Hepatology 58:642–653.
  8. 8. Yang H, Fang F, Chang R, Yang L (2013) MicroRNA-140-5p suppresses tumor growth and metastasis by targeting transforming growth factor beta receptor 1 and fibroblast growth factor 9 in hepatocellular carcinoma. Hepatology 58:205–217.
  9. 9. Wang J, Li J, Wang X, Zheng C, Ma W (2013) Downregulation of microRNA-214 and overexpression of FGFR-1 contribute to hepatocellular carcinoma metastasis. Biochem Biophys Res Commun 439:47–53.
  10. 10. Wang J, Li J, Shen J, Wang C, Yang L, et al. (2012) MicroRNA-182 downregulates metastasis suppressor 1 and contributes to metastasis of hepatocellular carcinoma. BMC Cancer 12:227.
  11. 11. Fang JH, Zhou HC, Zeng C, Yang J, Liu Y, et al. (2011) MicroRNA-29b suppresses tumor angiogenesis, invasion, and metastasis by regulating matrix metalloproteinase 2 expression. Hepatology 54:1729–1740.
  12. 12. Fang Y, Xue JL, Shen Q, Chen J, Tian L (2012) MicroRNA-7 inhibits tumor growth and metastasis by targeting the phosphoinositide 3-kinase/Akt pathway in hepatocellular carcinoma. Hepatology 55:1852–1862.
  13. 13. Ma Y, Zhang P, Wang F, Zhang H, Yang J, et al. (2012) miR-150 as a potential biomarker associated with prognosis and therapeutic outcome in colorectal cancer. Gut 61:1447–1453.
  14. 14. Wang WH, Chen J, Zhao F, Zhang BR, Yu HS, et al. (2014) MiR-150-5p Suppresses Colorectal Cancer Cell Migration and Invasion through Targeting MUC4. Asian Pac J Cancer Prev 15:6269–6273.
  15. 15. Yokobori T, Suzuki S, Tanaka N, Inose T, Sohda M, et al. (2013) MiR-150 is associated with poor prognosis in esophageal squamous cell carcinoma via targeting the EMT inducer ZEB1. Cancer Sci 104:48–54.
  16. 16. Jin M, Yang Z, Ye W, Xu H, Hua X (2014) MicroRNA-150 Predicts a Favorable Prognosis in Patients with Epithelial Ovarian Cancer, and Inhibits Cell Invasion and Metastasis by Suppressing Transcriptional Repressor ZEB1. PLoS One 9:e103965.
  17. 17. Cao M, Hou D, Liang H, Gong F, Wang Y, et al. (2014) miR-150 promotes the proliferation and migration of lung cancer cells by targeting SRC kinase signalling inhibitor 1. Eur J Cancer 50:1013–1024.
  18. 18. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, et al. (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33:e179.
  19. 19. Xu N, Shen C, Luo Y, Xia L, Xue F, et al. (2012) Upregulated miR-130a increases drug resistance by regulating RUNX3 and Wnt signaling in cisplatin-treated HCC cell. Biochem Biophys Res Commun 425:468–472.
  20. 20. Connor KM, Hempel N, Nelson KK, Dabiri G, Gamarra A, et al. (2007) Manganese superoxide dismutase enhances the invasive and migratory activity of tumor cells. Cancer Res 67:10260–10267.
  21. 21. Ito M, Teshima K, Ikeda S, Kitadate A, Watanabe A, et al. (2014) MicroRNA-150 inhibits tumor invasion and metastasis by targeting the chemokine receptor CCR6, in advanced cutaneous T-cell lymphoma. Blood 123:1499–1511.
  22. 22. Akanuma N, Hoshino I, Akutsu Y, Murakami K, Isozaki Y, et al. (2014) MicroRNA-133a regulates the mRNAs of two invadopodia-related proteins, FSCN1 and MMP14, in esophageal cancer. Br J Cancer 110:189–198.
  23. 23. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116:281–297.
  24. 24. Callegari E, Gramantieri L, Domenicali M, D’Abundo L, Sabbioni S, et al.. (2014) MicroRNAs in liver cancer: a model for investigating pathogenesis and novel therapeutic approaches. Cell Death Differ.
  25. 25. Li Y, Wang Y, Yu L, Sun C, Cheng D, et al. (2013) miR-146b-5p inhibits glioma migration and invasion by targeting MMP16. Cancer Lett 339:260–269.
  26. 26. Egawa N, Koshikawa N, Tomari T, Nabeshima K, Isobe T, et al. (2006) Membrane type 1 matrix metalloproteinase (MT1-MMP/MMP-14) cleaves and releases a 22-kDa extracellular matrix metalloproteinase inducer (EMMPRIN) fragment from tumor cells. J Biol Chem 281:37576–37585.
  27. 27. Taras D, Blanc JF, Rullier A, Dugot-Senant N, Laurendeau I, et al. (2007) Pravastatin reduces lung metastasis of rat hepatocellular carcinoma via a coordinated decrease of MMP expression and activity. J Hepatol 46:69–76.
  28. 28. Miyoshi A, Kitajima Y, Sumi K, Sato K, Hagiwara A, et al. (2004) Snail and SIP1 increase cancer invasion by upregulating MMP family in hepatocellular carcinoma cells. Br J Cancer 90:1265–1273.
  29. 29. Miyoshi A, Kitajima Y, Kido S, Shimonishi T, Matsuyama S, et al. (2005) Snail accelerates cancer invasion by upregulating MMP expression and is associated with poor prognosis of hepatocellular carcinoma. Br J Cancer 92:252–258.