Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Correction: Multi-Level Interactions between the Nuclear Receptor TRα1 and the WNT Effectors β-Catenin/Tcf4 in the Intestinal Epithelium

  • The PLOS ONE Staff

In sub-table S1A of Table S1, the nucleotide sequence of Tcf7l2 (Tcf4) should read: “F: CACAGCTCAAAGCATCAGGA R: CTGCATGTGAAGCTGTCGTT.” The length of the amplicon should be indicated as: “242bp.”

Reference

  1. 1. Sirakov M, Skah S, Lone IN, Nadjar J, Angelov D, et al. (2012) Multi-Level Interactions between the Nuclear Receptor TRα1 and the WNT Effectors β-Catenin/Tcf4 in the Intestinal Epithelium. PLoS ONE 7(4): e34162