Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Strong Phylogeographic Structure in a Sedentary Seabird, the Stewart Island Shag (Leucocarbo chalconotus)

Abstract

New Zealand's endemic Stewart Island Shag (Leucocarbo chalconotus) comprises two regional groups (Otago and Foveaux Strait) that show consistent differentiation in relative frequencies of pied versus dark-bronze morphotypes, the extent of facial carunculation, body size and breeding time. We used modern and ancient DNA (mitochondrial DNA control region one), and morphometric approaches to investigate the phylogeography and taxonomy of L. chalconotus and its closely related sister species, the endemic Chatham Island Shag (L. onslowi). Our analysis shows Leucocarbo shags in southern New Zealand comprise two well-supported clades, each containing both pied and dark-bronze morphs. However, the combined monophyly of these populations is not supported, with the L. chalconotus Otago lineage sister to L. onslowi. Morphometric analysis indicates that Leucocarbo shags from Otago are larger on average than those from Foveaux Strait. Principal co-ordinate analysis of morphometric data showed substantial morphological differentiation between the Otago and Foveaux Strait clades, and L. onslowi. The phylogeographic partitioning detected within L. chalconotus is marked, and such strong structure is rare for phalacrocoracid species. Our phylogenetic results, together with consistent differences in relative proportions of plumage morphs and facial carunculation, and concordant differentiation in body size and breeding time, suggest several alternative evolutionary hypotheses that require further investigation to determine the level of taxonomic distinctiveness that best represents the L. chalconotus Otago and Foveaux Strait clades.

Introduction

The blue-eyed shags (Leucocarbo spp.) are a species-rich seabird clade exhibiting a circumpolar Southern-Hemisphere distribution. Numerous locally endemic taxa are associated with particular islands or island groups [1]. Within the New Zealand region there are six species currently recognised: New Zealand King Shag (L. carunculatus), Stewart Island Shag (L. chalconotus), Chatham Island Shag (L. onslowi), Auckland Island Shag (L. colensoi), Campbell Island Shag (L. campbelli), and Bounty Island Shag (L. ranfurlyi) [2].

The Stewart Island Shag L. chalconotus is endemic to southern New Zealand, with its current range extending from the Stewart Island region (Foveaux Strait) north to the Otago coast (Fig. 1). This species is unique within its genus in that it shows substantial intraspecific variation in plumage colouration, with distinct pied and dark-bronze morphotypes (Fig. 1). Both colour morphs are widespread throughout the species' range, with no evidence for assortative mating associated with plumage phenotype [3]. Nevertheless, morphological and behavioural analyses by Lalas [4], and Lalas and Perriman [5], have detected consistent regional differentiation between Otago and Foveaux Strait populations of L. chalconotus (Fig. 1), primarily associated with relative frequencies of pied versus dark-bronze morphotypes, the extent of facial carunculation, body size and breeding time. They found that, (1) the Otago group comprises 20–30% pied morphs versus 50–60% in the Foveaux Strait group (Fig. 1); (2) Otago birds have approximately equal frequencies of small facial caruncles versus scattered papillae, whereas Foveaux Strait birds always have scattered papillae (Fig. 1); (3) morphometric analyses of museum specimens revealed birds from Otago were 7–14% larger than those from Foveaux Strait; and (4) breeding was initiated sooner in Otago (May-September versus September onwards in Foveaux Strait) [4]–[5].

thumbnail
Figure 1. Distributional and morphological data for Chatham Island (Leucocarbo onslowi) and Stewart Island (L. chalconotus) shags.

A: Map of New Zealand showing the location of the Chatham Islands and Otago/Foveaux Strait study sites; B: Distribution of L. onslowi (green) breeding colonies and roosting sites. Unfilled circles represent existing but un-sampled colonies and roosting sites. Filled green stars represent Holocene fossil bones at sites without colonies or roosts nearby. Leucocarbo onslowi exhibits pied plumage only (white pie graph) with pronounced bright orange caruncles in breeding plumage (orange pie graph). C: Distribution of L. chalconotus from Otago (blue) and Foveaux Strait (red) breeding colonies and roosting sites. Filled circles represent samples from colonies and roosting sites, while the stars represent beach wrecks found at sites without colonies or roosts nearby. Unfilled circles represent existing but un-sampled colonies and roosting sites. Shags from the Otago populations have 20–30% pied morphs (pie graphs; black: dark-bronze; white: pied) and 50%:50% small bright orange caruncles: dark to dull orange scattered papillae in breeding plumage (pie graph; yellow: small bright orange caruncles; grey: dark to dull orange scattered papillae) compared to 50–60% pied and dark to dull orange scattered papillae in breeding plumage in shags from the Foveaux Strait populations [4]–[5], [13]. In C, multiple breeding colonies and roosting sites are represented at the following locations (from north to south): Warrington and Karitane; Otago Peninsula including Long Beach, Aramoana, Otago Harbour, Taiaroa Head, Boulder Beach, Papanui Beach, Allans Beach, Wharekakahu Island and Gull Rocks; Seal Rocks and Ruapuke Island; Easy Harbour and Shag Rock.

https://doi.org/10.1371/journal.pone.0090769.g001

The current Otago breeding populations of L. chalconotus range from Maukiekie Island south to Kinakina Island, whereas the southern breeding populations are restricted to islands in Foveaux Strait (Fig. 1). The current non-breeding range for the Otago group extends from Lake Wainono south to The Sisters in the Catlins (Fig. 1) [5], with rare vagrants observed as far north as Lake Ellesmere [6]. Historically, the Otago populations were centered near Otago Peninsula [7]–[9]. During the 1980s, Otago breeding colonies were located at Maukiekie Island and several sites around Otago Peninsula with a roost site at Nugget Point [4] (Fig. 1). Recent decades, however, have seen substantial northward (e.g. roost site at Oamaru) and southward (e.g. breeding site at Kinakina Island, roost site at the The Sisters in the Catlins) expansions of this regional population [5]–[6] (Fig. 1). This expansion results from an overall population increase and is apparently driven by L. chalconotus' ability to readily abandon and establish new breeding colonies, and large numbers at some breeding colonies creating overflow into adjacent regions [5].

There is no obvious contemporary physical barrier between the two regional groupings of L. chalconotus populations, and it has been suggested that the species may have been more widespread in the past. Indeed, bones attributable to Leucocarbo have been found in Holocene fossil sand dune deposits and early Maori archaeological sites (ca. 1280–1450 AD) throughout the current range of L. chalconotus and further north along the eastern South Island, suggesting a former widespread distribution prior to Polynesian settlement of New Zealand ca. 1280 AD [10]–[12].

The taxonomic history of L. chalconotus has been complicated because many of its external morphological character states are shared with other blue-eyed shag taxa. In breeding plumage the combination of caruncle size and colour is diagnostic with L. carunculatus having a large yellow caruncle and L. onslowi having a pronounced bright orange caruncle [4], [13]. In L. chalconotus from Otago the small caruncles are usually bright orange, whereas when there are only scattered papillae, these are dark to dull orange. Likewise, the scattered papillae in L. chalconotus from Foveaux Strait are dark to dull orange [4], [13]. Caruncle size decreases and its colour fades in non-breeding plumage, so there is currently no reliable method for discriminating between L. carunculatus, L. onslowi, and the pied morphs of L. chalconotus in the wild [14]. L. chalconotus and L. onslowi have previously been regarded as either subspecies of L. carunculatus [4], [15]–[16] or as full species [1]–[2], [17]–[19]. Siegel-Causey [18] proposed osteological character state changes that united his New Zealand blue-eyed shags, but was unable to distinguish between L. chalconotus and L. onslowi, due to small sample size and a lack of comparative material (cf. Worthy [20] who found 14 osteological character state differences between these two taxa). Siegel-Causey [18] tentatively retained L. chalconotus as a distinct species, sister to a group containing L. onslowi, L. ranfurlyi and L. colensoi. Worthy [10] criticised Siegel-Causey's [18] argument for maintaining separate species status for L. chalconotus when L. carunculatus was not included in the study.

Based on the regional differentiation detected by Lalas [4] and the absence of apparent differentiation between the bones of L. chalconotus and L. carunculatus, Worthy [10] suggested that these taxa should be treated as synonyms, with regional morphological variation interpreted as clinal. Worthy [10] showed that the size range of L. carunculatus overlapped with L. chalconotus from Otago. Worthy [10] further stated that the only difference between the two taxa was the dimorphic plumage in populations of L. chalconotus, with the pied morph very similar to L. carunculatus, although, he did not consider differences in facial colour. On the basis of these findings and initial genetic conclusions, Schuckard [21] considered it unlikely that L. chalconotus, L. carunculatus and L. onslowi would maintain their specific rank in future taxonomic revisions. However, subsequent genetic analyses of the Phalacrocoracidae by Kennedy and Spencer (unpublished data) indicate strongly that L. carunculatus represents a distinct species that is not closely related to either L. chalconotus or L. onslowi.

In light of distributional, morphological and behavioural data, a detailed molecular reappraisal of L. chalconotus systematics seemed overdue. We use both morphological and genetic data to reassess the systematic status of Leucocarbo shags from southern New Zealand.

Materials and Methods

Ethics statement

Animal ethics permits from the University of Otago's Animal Ethics Committee were not required as samples were only taken from deceased birds. Specimens were not collected from conservation gazetted or private land, and were provided to NJR and MK under Department of Conservation (DoC) conservation management auspices. Specimens are held at the University of Otago's Department of Zoology under a permit to hold material from protected wildlife for genetic analysis (DoC OT-25557-DOA). Permission to sample museum specimens was obtained by NJR and MK from individual institutions (see Table S1 for location and accession details of specimens utilised in this study).

Source of specimens

Dead, beach-wrecked L. chalconotus specimens and additional dead birds (including historical skins) retrieved from breeding colonies or roosting sites across the geographic range of L. chalconotus (n = 43, comprising 14 dark-bronze, 18 pied and 11 unrecorded morphotype) were obtained from a variety of sources including DoC and museum collections (Fig. 1; Table S1). L. onslowi samples, comprising tissue and Holocene fossil bones (n = 10), were also included to help clarify the status of L. onslowi (Fig. 1; Table S1). Samples from sub-Antarctic taxa L. colensoi (n = 1) and L. campbelli (n = 1) were included as out-groups (Table S1) (see [22]).

Modern DNA extraction, PCR amplification and DNA sequencing

Whole genomic DNA was extracted from 2 mm2 tissue samples following a modified Chelex protocol with 5% Chelex solution, 2 µL Proteinase K (20 mg/mL) and overnight incubation at 56°C [23]. For recent bone samples, DNA was extracted from up to 200 mg of bone powder using the Qiagen DNeasy Tissue Kit following the manufactures instructions with an overnight incubation at 56°C. DNA from recent bone samples was amplified following the methodology for ancient DNA below.

PCR primers were designed to amplify control region one (CR1) of the Phalacrocoracidae mitochondrial DNA (mtDNA) genome. In phalacrocoracids and core pelecaniforms there is a duplication of the 3′ end of cytochrome b (cyt b) to the 3′ end of the control region (CR) [24]–[25]. In L. chalconotus there is very low (<20%) sequence similarity between CR1 and CR2 compared with other core pelecaniforms (see [25]). CR1 was amplified using one of several alternate primer pairs: AV16531FND6 (5′ ACCACCARCATHCCCCCYAAATA 3′; Gillian Gibb pers. comm.)/NewCytB R1 (5′ ACAGTTTGATGAAATACCTAGTGGG 3′; this study) (∼1200 bp including primers); AV16531FND6/NewCytB R2 (5′ GATTTTGTCACAGTTTGATGAAATACC 3′; this study) (∼1200 bp including primers); and AV16758FtGlu (5′ TRTGGCYTGAAAARCCRTCGTTG 3′; Gillian Gibb pers. comm.)/NewCytB R2 (∼1000 bp including primers). For one sample (Museum of New Zealand Te Papa Tongarewa (NMNZ) OR.17326) only a partial CR1 fragment could be amplified using the primer pair AV16531FND6/H10 (5′ GTGAGGTGGACGATCAATAAAT 3′; [26]). Each PCR reaction (10 µL) consisted of: 5 µL of MyFi DNA Polymerase mix (Bioline), 0.5 µL each primer (10 µM), and 1 µL DNA. PCR thermocycling conditions consisted of 94°C 3 min, 40 cycles 94°C 30 s, 50°C 45 s, 72°C 2 min 30 s, followed by a final extension of 72°C 4 min. PCR products were run on a 1% 1× TAE agarose gel. All extractions and PCRs included negative controls. PCR products were purified using an Omega Ultra-Sep PCR clean-up kit, then sequenced bi-directionally using Big Dye Terminator technology and an ABI 3730×l.

Ancient DNA analysis

All ancient DNA (aDNA) extractions and PCR set up was carried out at the University of Otago in purpose built aDNA (Holocene fossil samples) and historical DNA (historical specimens) laboratories physically isolated from other molecular laboratories [27]. Strict aDNA procedures were followed to minimise contamination of samples with exogenous DNA [28] including the use of negative extraction and PCR controls.

DNA was extracted from up to 250 mg of bone powder sampled from Holocene fossil L. onslowi bones following [29]. DNA was extracted from L. chalconotus toe pads using the Qiagen DNeasy Blood and Tissue Kit following the manufactures instructions with an overnight incubation at 56°C. Two overlapping fragments of the mtDNA CR1 were amplified using the primers BESCR1 F1 (5′-GCCACATGATACATTACATG-3′)/R1 (5′-CRCTTATACATAAACTCCTAG -3′) (197 bp including primers) and BESCR1 F2 (5′-CATGTACARACCCATYCCTCCC-3′)/R2 (5′-GTATCCGGTTTCTGAAGTACCAG-3′) (210 bp including primers). Each PCR reaction (20 µL) consisted of: 1 M Betaine (Sigma), 4 mM MgCl2 (Life Technologies), 1× Gold Buffer II (Life Technologies), 2.5 mM dNTPs (Bioline), 250 nM each primer, 1.25 U of AmpliTaq Gold DNA Polymerase (Life Technologies), and 2 µL DNA. Unsuccessful PCR's were repeated with 2 U AmpliTaq Gold DNA Polymerase and 4 µL DNA or 2 µL 1∶10 DNA. PCR thermocycling conditions consisted of 94°C 9 min, 60 cycles 94°C 30 s, 50°C 45 s, 72°C 1 min, followed by a final extension of 72°C 10 min. PCR amplification and all downstream procedures were carried out in a modern genetics laboratory.

PCR products were run on a 2% 1× TAE agarose gel. PCR products were purified (using ExoSap (1.5 U ExoI, I U SAP; GE Healthcare) by incubation at 37°C for 30 min and 80°C for 15 min), and sequenced as above, except that bi-directional sequencing was conducted from independent PCR products. When an inconsistency between sequences from an individual was observed due to DNA damage (C-T and G-A transitions), additional PCRs and bi-directional sequencing were conducted, and a majority rule consensus was applied to the independent replicates [30].

Phylogenetic analysis

Contiguous sequences were constructed using Sequencher (Gencodes) and aligned in MEGA 4.0 [31]. The alignment was trimmed to include 1040 bp of CR1 sequence data (i.e. excluding the ND6 and tRNA Glu sequence and a short region at the 3′ end of CR1). ModelTest was used to determine the most appropriate model of nucleotide substitution under the Akaike Information Criterion. Two datasets were used for phylogenetic analysis: (1) 1040 bp CR1 (modern samples) and (2) 248 bp CR1 (modern, recent, historic and ancient) common to all samples (for both of these datasets ModelTest determined the most appropriate model of nucleotide substitution was HKY + I). Bayesian analysis was performed using BEAST v1.7.4 [32] and the Yule birth-death coalescent tree prior. Three independent runs were conducted, consisting of 30 million MCMC generations, sampling tree parameters every 1000 generations, with a burn in of 25%. Phylogenetic convergence was assessed in Tracer, and results analysed in FigTree. DNA sequences are accessioned in GenBank (KJ189963-KJ190017). As well as the Bayesian posterior probabilities (PP), the level of support for the tree topology was evaluated with 1000 bootstrap replicates. Maximum likelihood bootstrap analysis was performed using PhyML [33]. Maximum parsimony (with equal weights and 10 random addition sequence replicates) and neighbour-joining bootstrap analyses were performed using PAUP [34].

Morphometric analysis

Total length measurements (defined by [35]), of coracoids, humeri, ulnae, carpometacarpi, femora, tibiotarsi and tarsometatarsi were performed using vernier callipers, to the nearest 0.1 mm. The species measured included: L. colensoi (n = 15) and L. chalconotus from the Otago (n = 32) and Foveaux Strait (n = 8) populations. These bones were sourced from recent and Holocene fossil skeletons housed in New Zealand museum collections (Table S2). Box plots of element length for each species/geographic region were constructed using the program R [36]. Differences in physical size between L. chalconotus from Otago and Foveaux Strait, and L. chalconotus and L. onslowi, were assessed for each measured element individually, using the Mann-Whitney U (MWU) test, implemented in R using the wilcox.test function (Table 1). The MWU test is a non-parametric t-test that compares median values of element length distributions to determine if birds from one population are larger than those from another population. Morphological differentiation was assessed using Principal Component Analysis (PCA) on pooled element lengths (from specimens with no missing data) for L. chalconotus from Otago and Foveaux Strait, and L. onslowi, using the prcomp function in R.

thumbnail
Table 1. Mann-Whitney U test statistics (U) and p values (P) for assessing size differentiation between Leucocarbo chalconotus from Otago and Foveaux Strait, and L. chalconotus and L. onslowi.

https://doi.org/10.1371/journal.pone.0090769.t001

Results

DNA sequence alignments for the modern specimens (15 in-group individuals) yielded up to 1040 bp of mtDNA CR1. Of the 1040 bp alignment 999 bp were constant, and of the 41 variable sites 27 were parsimony informative. For the 248 bp mtDNA CR1 fragment (53 in-group individuals) 218 bp were constant, and of the 30 variable sites 25 were parsimony informative. Our phylogenetic analyses of these two datasets strongly supported there being two clades of Leucocarbo shag in southern New Zealand (Figs. 2, 3, S1). The first clade comprises dark-bronze and pied morphotypes from Foveaux Strait along with a single dark-bronze-morph beach-wrecked specimen collected from the western shore of Boulder Beach, Otago Peninsula (collected on 22 June 2011 by G. Loh; currently held at the University of Otago's Department of Zoology and will be deposited in the NMNZ collections). The second clade, which in most of the analyses is sister to the Chatham Islands endemic L. onslowi, comprises dark-bronze and pied morphotypes sampled from Otago populations. With the exception of maximum likelihood and neighbour joining for the 248 bp dataset, our phylogenetic analyses produced support for the sister group relationship between the L. chalconotus Otago lineage and L. onslowi. In contrast, maximum likelihood and neighbour joining bootstrapping of the 248 bp dataset produced weak bootstrap support (54% and 58% respectively) for the sister group relationship between the Otago and Foveaux Strait clades (while still supporting the monophyly of each of these groups) (Fig. S2).

thumbnail
Figure 2. Phylogeny of Leucocarbo chalconotus and L. onslowi shags based on 1040 bp mtDNA CR1.

Branch lengths are proportional to the number of substitutions. The maximum clade credibility tree was generated in BEAST v1.7.4 using the HKY + I model of nucleotide substitution. The phylogeny was rooted using the Auckland Island Shag (L. colensoi) and Campbell Island Shag (L. campbelli). For clarity, only posterior probability (PP) and bootstrap support (bold: maximum likelihood; italics: maximum parsimony; Roman: neighbour joining) values for major clades are shown (>0.60 PP). Nodes with less than 0.60 PP have been collapsed. Dark-bronze (black circle) or pied (white circle) plumage morphotype, if known, has been indicated on the phylogeny.

https://doi.org/10.1371/journal.pone.0090769.g002

thumbnail
Figure 3. Phylogeny of Leucocarbo chalconotus and L. onslowi shags based on 248 bp mtDNA CR1.

Branch lengths are proportional to the number of substitutions. The maximum clade credibility tree was generated in BEAST v1.7.4 using the HKY + I model of nucleotide substitution. The phylogeny was rooted using the Auckland Island Shag (L. colensoi) and Campbell Island Shag (L. campbelli). For clarity, only posterior probability (PP) and bootstrap support (bold: maximum likelihood; italics: maximum parsimony; Roman: neighbour joining) values for major clades are shown (>0.60 PP). Nodes with less than 0.60 PP have been collapsed. Weakly supported alternative branching patterns are not shown. Dark-bronze (black circle) or pied (white circle) plumage morphotype, if known, has been indicated on the phylogeny. 1: 0.88, 55, 53; 2: 1.00, 75, 78, 82; 3: 0.88, 62, 55, 65; 4: 0.98, 68, 59, 73.

https://doi.org/10.1371/journal.pone.0090769.g003

For the 248 bp mtDNA CR1 fragment, the mean percentage divergence between the L. chalconotus Foveaux Strait and Otago lineages is 2.6%, whereas the Otago lineage is only 1.8% divergent from L. onslowi (compared to 3.5% for the contrast between the Foveaux Strait lineage and L. onslowi). The percentage divergence decreases when the longer 1040 bp of mtDNA CR1 is considered (L. chalconotus Foveaux Strait versus Otago 1.2%, Foveaux Strait versus L. onslowi 1.8%, Otago versus L. onslowi 1.0%). This decrease in mean percentage divergence is because a greater proportion of variable nucleotide positions are contained within the 248 bp CR1 fragment (∼12% compared with ∼4% in the 1040 bp CR fragment).

Morphometric analysis shows that L. chalconotus shags from Otago are larger on average than those from the corresponding Foveaux Strait populations for all elements measured (MWU P<0.01; Fig. 4, Table 1). The analysis also showed that, again for all elements, L. onslowi is smaller on average than L. chalconotus (MWU P<0.01; Fig. 4, Table 1). A PCA analysis of pooled element lengths (from specimens with no missing data) revealed substantial morphological differentiation between the three regional population groupings, with just a few immature Otago and Foveaux Strait birds showing morphological overlap with specimens from the Chatham Islands (Fig. 5). Even with these immature birds included, the morphometric differences observed between L. chalconotus from Otago and Foveaux Strait, and L. chalconotus and L. onslowi, are highly significant.

thumbnail
Figure 4. Box plots showing the distribution of Leucocarbo chalconotus and L. onslowi element lengths (mm).

From the median (thick black line) outwards, are the 75th and 25th percentiles (box), the 98th and 2nd percentile (whiskers) and outliers (hollow dots). L. chalconotus from Otago are larger on average than Foveaux Strait birds (P<0.01; Table 1), and L. chalconotus are larger than L. onslowi (Table 1).

https://doi.org/10.1371/journal.pone.0090769.g004

thumbnail
Figure 5. PCA cluster analysis of Leucocarbo chalconotus from southern New Zealand, and L. onslowi.

The analysis was conducted on pooled element lengths (femur, tibiotarsus, tarsometatarsus, coracoid, humerus, ulna, and carpometacarpus). Immature birds are indicated with an ‘I’ on the figure.

https://doi.org/10.1371/journal.pone.0090769.g005

Discussion

Our phylogenetic analyses show that Leucocarbo shags in southern New Zealand comprise two well-supported clades (Otago and Foveaux Strait), each containing both pied and dark-bronze morphs. Surprisingly, however, the combined monophyly of these L. chalconotus populations is not well supported, with the Otago lineage typically found to be sister to the Chatham Island endemic, L. onslowi, albeit with weak statistical support (a small subset of our analyses do weakly support the monophyly of the two L. chalconotus populations). Morphometric analysis indicates that Leucocarbo shags from Otago are larger on average than those from Foveaux Strait, corroborating Lalas' [4] observations of substantial size differences between individuals from these regions.

We interpret the specimens from the Southland coast (Oreti Beach and Invercargill) as beach-wrecked individuals from the Foveaux Strait population (Figs. 1–3, S1). Given the prevailing southerly winds in the region, it is entirely plausible that dead individuals from Foveaux Strait will regularly wash up on southern South Island beaches. We also interpret the beach-wrecked specimen from Boulder Beach, Otago Peninsula, as likely of southern origin. This hypothesis is supported by the specimen having scattered papillae, consistent with the Foveaux Strait morphotype [4] (Fig. 1). Juvenile and adult Leucocarbo shags are known to travel long distances [6], [13], which, in combination with the direction of the Southland Current, suggests that finding a beach-wreck from the Foveaux Strait population on the southern side of Otago Peninsula is not altogether unexpected. Although we did not sample specimens from every location that the species occur, from external morphology we would also expect extant individuals from Nugget Point, Kinakina Island and The Sisters in the Catlins (plumage proportions reported by [5] are 20–30% pied for these colonies) to represent the Otago lineage (Fig. 1). The specimen from Cooks Head, Milton, just north of Nugget Point, falls within the Otago clade, which is consistent with this suggestion.

Our phylogenetic results, together with consistent differences in relative proportions of plumage morphs and facial carunculation, and concordant differentiation in body size and breeding time [4]–[5], suggest three taxonomic alternatives requiring further investigation that are all consistent with the observed phylogeographic pattern of (Foveaux (Otago, Chatham Islands)) (Figs. 2, 3, S1). Resulting taxonomic classifications depend on differing interpretations of taxonomic philosophy. The first hypothesis is that the Otago and Foveaux Strait lineages of L. chalconotus represent phylogenetically and diagnosably distinct taxa (at the species level), rather than the prevailing view that there is a single variable taxon [1]–[2], [10]. This hypothesis also recognises the separate specific status of the rare Chatham Island endemic, L. onslowi. L. onslowi individuals are morphologically distinct as they are only of the pied morph and smaller on average than L. chalconotus (Figs. 4, 5), and their ranges do not overlap [1], [14]. Worthy [20] found 14 osteological character state differences between L. chalconotus and L. onslowi. L. onslowi individuals also differ substantially in facial colouring from L. chalconotus. Breeding L. onslowi individuals consistently have pronounced bright orange caruncles compared to small bright orange caruncles (Otago) and scattered dark to dull orange papillae (Foveaux Strait and Otago) in L. chalconotus [13]. Though more variable, but following a similar pattern to the carunculations, the gular throat patch is bright red in breeding L. onslowi individuals, while it ranges from dull to bright orange-red in L. chalconotus [13]. Determining whether the Otago and Foveaux Strait lineages of L. chalconotus represent diagnosably distinct taxa will require (1) osteological analyses of recent skeletons (identified to morph, age and sex) and Holocene fossil bones to test for the presence of discrete morphological characters; (2) additional morphological analysis of the extent of carunculation to determine whether this can be used as a discrete morphological character; (3) genetic analysis of specimens from un-sampled areas (e.g. Kinakina Island, The Sisters in the Catlins); and (4) ancient DNA analyses of type specimens, Holocene fossil and archaeological material.

The second plausible hypothesis is that L. chalconotus may represent a paraphyletic species with strong phylogeographic structure, a consequence of the regional philopatry that is well-documented in this group of birds. Such a finding would not be unexpected, as Joseph and Omland [37], for instance, showed that 44% of Australo-Papuan terrestrial avian taxa that are good biological species are paraphyletic for mtDNA markers. Applying a biological or phylogenetic species concept to taxa with allopatric populations can be problematic, especially when they exhibit site-specific or regional philopatry. Future research will focus on population-genetic analysis of the Otago and Foveaux Strait clades to determine the level of gene flow, population divergence and dynamics between each region [38]–[39]. There are only two single nucleotide polymorphisms (out of over 5000 bp of nuclear DNA) that separate L. onslowi and the L. chalconotus Otago lineage (Kennedy and Spencer unpublished data). As a consequence, genetic discrimination of the Otago and Foveaux lineages based on nuclear sequences is unlikely.

As a consequence of this second hypothesis, a third hypothesis could be advocated that L. chalconotus and L. onslowi represent a single, monophyletic taxon with marked phylogeographic structure and possible sub-specific status for the Foveaux, Otago and Chatham Island clades. Nevertheless, this hypothesis is unlikely as L. onslowi is morphologically (Figs. 1, 4 and 5) [1], [14], [20] and genetically (Figs. 2, 3, S1) distinct from L. chalconotus.

The species-rich radiation of New Zealand blue eyed shags (including L. ranfurlyi, L. campbelli, L. colensoi, L. onslowi and L. carunculatus), and especially the diversity within L. chalconotus, contrasts strongly with the situation for South American/Antarctic blue eyed shags which show less evidence for evolutionary diversification [1]. The phylogeographic partitioning detected within L. chalconotus in particular is marked, and such strong structure is rare for Phalacrocoracidae species. Within Leucocarbo, Calderon et al. [39] found strong phylogeographic structure and limited gene flow in the Patagonian Rock Shag (Leucocarbo magellanicus) using mtDNA ATPase 6–8 and microsatellites. The Rock Shag contained three mtDNA phylogeographic groups comprising colonies from the Atlantic, Pacific and Fuegian regions of Patagonia. In contrast, there was weaker phylogeographic structure and higher levels of gene flow in the sympatric Imperial Shag (Leucocarbo atriceps) [39]. Calderon et al. [39] concluded that Pleistocene glacial cycles, and differences in foraging ecology and non-breeding distribution between the Rock and Imperial Shag contributed to the differing levels of phylogeographic structure. Winney et al. [26] and Marion and Gentil [40] found only moderate phylogeographic structure in the Great Cormorant (Phalacrocorax carbo) from Europe using mtDNA CR1 data, while Barlow et al. [41], using a combination of mtDNA ND2 and microsatellite data from the European Shag (Phalacrocorax aristotelis), found only weak population-genetic structure, despite high levels of philopatry, rare dispersal events and recognised subspecies. Waits et al. [42], using mtDNA 12S rRNA, 16S rRNA, COIII-ND3, cyt b and CR, found no phylogeographic structure or restricted gene flow among populations or between subspecies of the Double-crested Cormorant (Phalacrocorax auritus) in eastern North America. However, Mercer et al. [43] used CR data and found there was phylogeographic structure between the Alaskan Double-crested Cormorant and those from eastern North America. In another coastal bird taxon, the Dusky Seaside Sparrow (Ammodramus maritimus), Avise and Nelson [44] detected substantial phylogeographic structuring of populations from eastern and southern North America, delineated by the Florida peninsula. It should be noted that the genetic data used in our study are from rapidly evolving mtDNA CR1, rather than the more slowly evolving ‘barcoding’ COI marker often used in bird systematics (e.g. [45] cf. [46]). However, there are several diagnosably distinct avian taxa than cannot be distinguished using slowly evolving mtDNA markers but can be identified using the faster evolving CR (e.g. cyt b versus CR in Cyanoramphus parakeets [47]–[48]).

Conclusions

In this study we have shown that the Stewart Island Shag (L. chalconotus) groups into two geographically separate (Otago and Foveaux Strait) reciprocally monophyletic clades. In the majority of our analyses the Otago clade groups with the Chatham Island Shag (L. onslowi), although there is some support for the Otago and Foveaux Strait clades grouping together. Further data are required to resolve, with greater certainty, the relationship between the Otago, Foveaux Strait, and Chatham Island groups. Irrespective of the relationships between these groups inferred from our phylogenies, arguments could be made for different taxonomic arrangements of these clades, namely (1) splitting L. chalconotus into two units (with L. onslowi as a third); (2) leaving L. chalconotus as a single unit (with L. onslowi as a second); and (3) subsuming L. onslowi within L. chalconotus. We do not support this last option, however, given the osteological and morphological uniqueness of L. onslowi [13], [19]. Further studies are required to evaluate which of these options best represents the level of taxonomic distinctiveness of these clades.

Supporting Information

Figure S1.

Neighbour joining phylogeny of Leucocarbo chalconotus and L. onslowi shags based on 1040 bp mtDNA CR1.

https://doi.org/10.1371/journal.pone.0090769.s001

(PDF)

Figure S2.

Neighbour joining phylogeny of Leucocarbo chalconotus and L. onslowi shags based on 248 bp mtDNA CR1.

https://doi.org/10.1371/journal.pone.0090769.s002

(PDF)

Table S1.

Leucocarbo shag specimens used for genetic analysis.

https://doi.org/10.1371/journal.pone.0090769.s003

(PDF)

Table S2.

Element maximum length measurements (to the nearest 0.1 mm) of Chatham Island Shag (Leucocarbo onslowi) and Stewart Island Shag (L. chalconotus) from Otago and Foveaux Strait populations.

https://doi.org/10.1371/journal.pone.0090769.s004

(PDF)

Acknowledgments

We thank the following people and institutions for assistance sourcing and supplying samples for genetic analysis: Derek Onley, Greg Kerr, Lloyd Esler, Lyndsay Chadderton, Mike Bell, Nathalie Patenaude, Peter Moore, Simon Childerhouse, Auckland Museum, Department of Conservation, Museum of New Zealand Te Papa Tongarewa, Canterbury Museum, Otago Museum and the University of Otago's Department of Anthropology and Archaeology. We thank Gillian Gibb (and David Penny's group's primer database) at Massey University for primer suggestions. We thank Auckland Museum (Brian Gill, Jason Froggot), Museum of New Zealand Te Papa Tongarewa, Canterbury Museum, Otago Museum (Cody Fraser, Emma Burns) and the University of Otago's Department of Anthropology and Archaeology (Ian Smith, Phil Latham) for permission to measure specimens for morphometric analysis. Finally, we thank two anonymous reviewers of this manuscript.

Author Contributions

Conceived and designed the experiments: NJR RPS AJDT JMW HGS MK. Performed the experiments: NJR CET RPS AJDT CJC CL GL EMS MK. Analyzed the data: NJR CET RPS CL MK. Wrote the paper: NJR CET RPS AJDT CJC CL GL EMS JMW HGS MK.

References

  1. 1. Marchant S, Higgins PJ (1990) Handbook of Australian, New Zealand and Antarctic birds (Volume 1, Part B Pelican to Ducks). Melbourne: Oxford University Press. 1400 p.
  2. 2. Gill BJ, Bell BD, Chambers GK, Medway DG, Palma RL, et al.. (2010) Checklist of the birds in New Zealand, Norfolk and Macquarie Islands, and the Ross Dependency Antarctica (4th edition). Wellington: Te Papa Press in association with the Ornithological Society of New Zealand. 512 p.
  3. 3. Blackburn A (1968) The birdlife of Codfish Island. Notornis 15: 51–65.
  4. 4. Lalas C (1983) Comparative feeding ecology of New Zealand marine shags (Phalacrocoracidae). PhD thesis, University of Otago, Zoology Department. 291 p.
  5. 5. Lalas C, Perriman L (2009) Nest counts of Stewart Island shags/mapua (Leucocarbo chalconotus) in Otago. DoC Research and Development Series 314: 1–30.
  6. 6. Crossland AC (2012) A review of the current range of Stewart Island Shag (Leucocarbo chalconotus) and two records from Lake Ellesmere, Canterbury. Notornis 59: 71–73.
  7. 7. Buller WL (1888) A history of the birds of New Zealand (2nd edition, Volume II). London: The author.
  8. 8. Watt JPC (1973) Notes on Whero Island and other roosting and breeding stations of the Stewart Island shag (Leucocarbo carunculatus chalconotus). Notornis 22: 265–272.
  9. 9. Falla RA, Sibson RB, Turbott EG (1978) The new guide to the birds of New Zealand and outlying islands. Auckland: Collins. 247 p.
  10. 10. Worthy TH (1996) Holocene populations of shags Leucocarbo spp. in the far north, New Zealand. N. Z. J. Zool. 23: 89–95.
  11. 11. Worthy TH (1998) A remarkable fossil and archaeological avifauna from Marfells Beach, Lake Grassmere, South Island, New Zealand. Rec. Cant. Mus. 12: 79–176.
  12. 12. Wilmshurst JM, Anderson AJ, Higham TFG, Worthy TH (2008) Dating the late prehistoric dispersal of Polynesians to New Zealand using the commensal Pacific rat. Proc. Natl. Acad. Sci. U. S. A. 105: 7676–7680.
  13. 13. Heather BD, Robertson HA (2005) The fieldguide to the birds of New Zealand. Auckland: Viking. 440 p.
  14. 14. Scofield RP, Stephenson B (2013) A photographic guide to the birds of New Zealand. Auckland: Auckland University Press. 552 p.
  15. 15. Peters JL (1931) Check-list of birds of the world (Volume 1). Cambridge: Harvard University Press.
  16. 16. Kinsky FC (1970) Annotated checklist of the birds of New Zealand (2nd edition). Wellington: Ornithological Society of New Zealand Incorporated. 96 p.
  17. 17. Falla RA (1932) New Zealand cormorants in the collection of the Auckland Museum, with notes on field observations. Rec. Auck. Inst. Mus. 1: 139–154.
  18. 18. Siegel-Causey D (1988) Phylogeny of the Phalacrocoracidae. Condor 90: 885–905.
  19. 19. Turbott EG (1990) Checklist of the birds of New Zealand and the Ross Dependency, Antarctica. Auckland: Ornithological Society of New Zealand Random Century New Zealand. 247 p.
  20. 20. Worthy TH (2011) Descriptions and phylogenetic relationships of a new genus and two species of Oligo-Miocene cormorants (Aves: Phalacrocoracidae) from Australia. Zool. J. Linn. Soc. 163: 277–314.
  21. 21. Schuckard R (2006) Population status of the New Zealand king shag (Leucocarbo carunculatus). Notornis 53: 297–307.
  22. 22. Holland BR, Spencer HG, Worthy TH, Kennedy M (2010) Identifying cliques of convergent characters: Concerted evolution in the cormorants and shags. Syst. Biol. 59: 433–445.
  23. 23. Walsh PS, Metzger DA, Higuchi R (2013) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 54: 134–139.
  24. 24. Morris-Pocock JA, Taylor SA, Brit TP, Friesen VL (2010) Concerted evolution of duplicated control regions in three related seabird species. BMC Evol. Biol. 10: 14.
  25. 25. Gibb GC, Kennedy M, Penny D (2013) Beyond phylogeny: Pelecaniform and ciconiiform birds, and long-term niche stability. Mol. Phylogenet. Evol. 68: 229–238.
  26. 26. Winney BJ, Litton CD, Parkin DT, Feare CJ (2001) The subspecific origin of the inland breeding colonies of the cormorant Phalacrocorax carbo in Britain. Heredity 86: 45–53.
  27. 27. Knapp M, Clarke AC, Horsburgh KA, Matisoo-Smith EA (2012) Setting the stage – building and working in an ancient DNA laboratory. Ann. Anat. 194: 3–6.
  28. 28. Cooper A, Poinar HN (2000) Ancient DNA: Do it right or not at all. Science 289: 1139.
  29. 29. Rohland N, Siedel H, Hofreiter M (2010) A rapid column-based ancient DNA extraction method for increased sample throughput. Mol. Ecol. Resour. 10: 677–683.
  30. 30. Brotherton P, Endicott P, Sanchez JJ, Beaumont M, Barnett R, et al. (2007) Novel high-resolution characterization of ancient DNA reveals C > U-type base modification events as the sole cause of post mortem miscoding lesions. Nucleic Acids Res. 35: 5717–5728.
  31. 31. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinformatics 5: 150–163.
  32. 32. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7: 214.
  33. 33. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, et al. (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 59: 307–321.
  34. 34. Swofford DL (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Sunderland: Sinauer Associates.
  35. 35. Driesch A (1976) A guide to the measurements of animal bones from archaeological sites. Peabody Museum Bulletin 1.
  36. 36. R Development Core Team (2008) R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing.
  37. 37. Joseph L, Omland KE (2009) Phylogeography: Its development and impact in Australo-Papuan ornithology with special reference to paraphylly in Australian birds. Emu 109: 1–23.
  38. 38. Peterson BK, Weber JN, Kay EH, Fisher HS, Hoekstra HE (2012) Double digest RADseq: An inexpensive method for de novo SNP discovery and genotyping in model and non-model species. PLoS One 7: e37135.
  39. 39. Calderon L, Quintana F, Cabanne GS, Lougheed SC, Tubaro PL (2014) Phylogeography and genetic structure of two Patagonian shag species (Aves: Phalacrocoracidae). Mol. Phylogenet. Evol. 72: 42–53.
  40. 40. Marion L, Gentil J (2006) Ecological segregation and population structuring of the Cormorant Phalacrocorax carbo in Europe, in relation to the recent introgression of continental and marine subspecies. Evol. Ecol. 20: 193–216.
  41. 41. Barlow EJ, Daunt F, Wanless S, Alvarez D, Reid JM, et al. (2011) Weak large-scale population genetic structure in a philopatric seabird, the European Shag Phalacrocorax aristotelis. Ibis 153: 768–778.
  42. 42. Waits JL, Avery ML, Tobin ME, Leberg PL (2003) Low mitochondrial DNA variation in Double-crested Cormorants in eastern North America. Waterbirds 26: 196–200.
  43. 43. Mercer DM, Haig SM, Roby DD (2013) Phylogeography and population genetic structure of double-crested cormorants (Phalacrocorax auritus). Conserv. Genet. 14: 823–836.
  44. 44. Avise JC, Nelson WS (1988) Molecular genetic relationships of the extinct Dusky Seaside Sparrow. Science 243: 646–648.
  45. 45. Lambert DM, Baker A, Huynen L, Haddrath O, Hebert PDN, et al. (2005) Is a large-scale DNA-based inventory of ancient life possible? J. Hered. 96: 279–284.
  46. 46. Bunce M, Worthy TH, Phillips MJ, Holdaway RN, Willerslev E, et al. (2009) The evolutionary history of the extinct ratite moa and New Zealand Neogene palaeogeography. Proc. Natl. Acad. Sci. U. S. A. 106: 20646–20651.
  47. 47. Boon WM, Kearvell JC, Daugherty CH, Chambers GK (2000) Molecular systematics of New Zealand Cyanoramphus parakeets: conservation of orange-fronted and Forbes' parakeets. Bird Conserv. Int. 10: 211–239.
  48. 48. Boon WM, Robinet O, Rawlence N, Bretagnolle V, Norman JA, et al. (2008) Morphological, behavioural and genetic differentiation within the Horned Parakeet (Eunymphicus cornutus) and its affinities to Cyanoramphus and Prosopeia. Emu 108: 251–260.