Ethics Statement

All animal experiments were carried out in strict accordance with European Union and German laws (Tierschutzgesetz). All experimental procedures were approved by the animal ethics committee of the TU Dresden and the Landesdirektion Sachsen (approval number: AZ 24D-9168.11-1/2008-4). This institutional review board specifically approved this study.

Zebrafish husbandry

Zebrafish were raised and maintained as described previously [23]. The wild-type line used was TL. Zebrafish embryos were obtained by natural spawning of adult fish and staged according to hours post fertilization (hpf) or standard criteria [24]

Bioinformatics analysis

Ensembl Zv9, GenBank and DFCI EST databases were used to identify zebrafish glypican sequences. Human glypican sequences were blasted against all three databases and the obtained fish sequences were confirmed for the presence of the glypican domain. Mega5.1 software was used for phylogenetic analysis. ClustalW and the Jalview software were used for generating and viewing the multiple sequence alignment, respectively. Protein sequence similarity and identities were obtained using NCBI BLASTp. Cinteny server (http://cinteny.cchmc.org/) and genomicus server were used for syntenic analysis.

Molecular Cloning

Zebrafish mRNA was isolated from 24 and 48 hpf old embryos using the Trizol/Phenol-Chloroform method. cDNA was prepared from RNA using SuperScriptIII First-Strand Synthesis system (Invitrogen). The open reading frames of glypican genes were cloned into Topo vector using the primers given in Table 1. gpc2 full length sequence was obtained by performing RACE using SMARTer RACE cDNA amplification kit (Clontech) with primer: CAGCCCTGAAACACCTTAGCAGAGA for 5’ RACE and primer: AGACGCGCGGCAGGTACCTGCCAGCAG for 3’ RACE.

RT-PCR

cDNA was prepared from different developmental stages as mentioned above and used for RT-PCR. Full length primers (Table 1) were used to amplify gpc1a, gpc1b, gpc4 and gpc5c. The primers used for gpc2, gpc3, gpc5a, gpc5b, gpc6a and gpc6b are also mentioned in Table 1. The PCR reaction was carried out using DreamTaq DNA polymerase (Fermentas) for 30-35 cycles.

In Situ Hybridization

Embryos at the desired stage were fixed in 4% PFA and in situ hybridization was carried out according to the protocol described previously [25]. Full-length antisense probes were synthesized using T7/SP6 polymerase, Digoxigenin label (Roche) and linear Topo vectors. The color was developed using BM purple and used for imaging. Flat mounts were prepared after removing yolk sac and mounted in glycerol.

Identification of Fish Glypicans

There are 6 glypican genes in the human genome (GPC1-6). These sequences were blasted against Ensembl Zv9, GenBank and DFCI zebrafish EST databases to obtain the corresponding zebrafish glypicans. A previous study also reported 6 fish glypicans [10] but we identified 10 genes and named them according to their similarity to the human orthologs. The accession numbers of all genes from the different databases are shown in Table 2. New GenBank accession numbers were obtained for most sequences. Also indicated are the corresponding human orthologs and their peptide length.

Glypican gene family members can be grouped into two sub-families, as reported previously [7]: GPC1/2/4/6 and GPC3/5 family (Figure 1). Phylogenetic comparison of fish, human and Drosophila sequences revealed that all fish genes cluster with their human orthologs. The two genes in Drosophila, dally and dally-like protein each belong to a different family. Multiple orthologs of human genes are commonly found in fish genome due to a duplication event which occurred before the radiation of teleosts [26]. Corresponding to HsGPC2 we identified one new ortholog in the fish genome (Drgpc2). Two new orthologs were identified corresponding to HsGPC1 (Drgpc1a and Drgpc1b) and HsGPC6 (Drgpc6a and Drgpc6b) each, and 3 corresponding to HsGPC5 (Drgpc5a, Drgpc5b and Drgpc5c). All glypican proteins exhibit more than 56% sequence similarity with their corresponding human orthologs (Table 3).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Phylogenetic tree of glypican genes from Danio rerio, Homo sapiens and Drosophila melanogastor.

Phylogenetic comparison was carried out for glypicans genes sequences from zebrafish (Dr in black), humans and Drosophila (Hs and Dm in grey). The evolutionary tree was constructed using Neighbor-Joining method in the MEGA5.1 software using the Poisson model and partially deleted dataset. 500 bootstrap replications were used as a test of phylogeny and the values are indicated next to the branch. Branch length corresponds to evolutionary distances which denote the number of amino acid substitutions per site. Scale bar: 0.1

https://doi.org/10.1371/journal.pone.0080824.g001

In order to identify true orthologs of HsGPC1, HsGPC5 and HsGPC6, we investigated the chromosomal syntenic relationship between fish and human glypican genes by comparing common markers flanking these genes. The gene cluster containing GPC3 and GPC4 is well conserved in Eumetazoa and is also seen in zebrafish (Figure 2B) [7]. Of the two gpc1 in fish, gpc1a shares one adjacent marker with the HsGPC1 (Figure 2A), although both Drgpc1a and Drgpc1b share an almost similar amino acid sequence identity with HsGPC1 (Table 3). This indicates that Drgpc1a is likely to be a functional ortholog of HsGPC1. Fish has two orthologs for HsGPC6, namely Drgpc6a and Drgpc6b. Both genes share some synteny with the human form, such that certain markers are common between HsGPC6 and Drgpc6a and others are common between HsGPC6 and Drgpc6b (Figure 2C and 2D). This suggests that both zebrafish genes are derived from the same ancestral locus but have undergone rearrangements resulting in the final gene arrangements. Currently, Drgpc6a is annotated on two chromosomes, Chr1 and Chr12 (Ensembl Zv9), but only the Chr12 version is syntenic with HsGPC6.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Syntenic conservation between zebrafish and humans glypicans.

The figure depicts arrangement of genes surrounding glypicans on corresponding chromosomes in humans and zebrafish. Chromosome numbers from humans (Hs) and zebrafish (Dr) are indicated on the left. Glypican genes are represented in red and conserved markers around glypicans are in green or yellow. Non-conserved genes are in grey. The diagram is not to scale.

https://doi.org/10.1371/journal.pone.0080824.g002

In the human genome, GPC5 and GPC6 are present adjacently, but this contiguity is lost in the fish genome. There are 3 copies of gpc5 in fish and Drgpc5a has the maximum amino acid sequence identity to HsGPC5 (Table 3) but none are syntenic with humans. On fish Chr22, Drgpc5b and Drgpc1a are present contiguously, an arrangement not seen in mammals. Absence of synteny implies that along with whole genome duplication, individual gene duplications for fish gpc5 might have resulted in the observed multiple paralogs.

Glypican conserved domain structure

The glypican family of proteins is characterized by a large and highly conserved N-terminal glypican domain and a C-terminal region containing the residues for heparan sulfate and Gpi-anchor attachment. Multiple sequence alignment confirmed the presence of 14 conserved cysteine residues in all zebrafish glypicans (Figure 3). All these residues are involved in disulfide linkages and are necessary to maintain the folded structure [27]. The HS attachment site is always present within 50 residues of the C-terminal placing them very close to the plasma membrane [28]. It consists of repeating Ser-Gly (SG) cluster (n≥2) flanked by acidic residues on both sides [29]. There are 4 SG repeats in Gpc1a, Gpc1b, Gpc6a and Gpc6b; 3 repeats in Gpc4; 2 repeats in Gpc2, Gpc3, Gpc5a and 1 repeat in Gpc5b. Gpc5c and also Gpc5b contain a separate SG dipeptide followed by acidic amino acids, a potential chondroitin sulfate priming motif. Since HsGpc5 is known to carry both heparan sulfate and chondroitin sulfate chains [30], this feature may be conserved even in zebrafish Gpc5.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Multiple sequence alignment of glypican protein sequences from zebrafish.

All protein sequences were aligned to compare conserved features between glypicans. Residues highlighted in blue are well conserved. Black highlights indicate the 14 conserved cysteine residues; yellow highlights are the multiple Ser-Gly repeats flanked by acidic residues for sugar attachment; in red is the potential chondroitin sulfate attachment site.

https://doi.org/10.1371/journal.pone.0080824.g003

Spatiotemporal expression of glypicans during early development

The composition of extracellular matrix differs considerably between specific tissues and stages of development. A previous study has focused on the expression of fish glypicans at 5 day post fertilization only in the developing liver [10]. We now analyze the temporal and spatial expression of all glypicans from cleavage to pharyngula stages using Reverse transcriptase PCR (RT-PCR) and in situ hybridization (ISH) (Figures 4-7). As reported before, gpc4 mRNA is present at all stages of embryonic development [2]. A constant expression (both maternal and zygotic) was also seen for gpc2, gpc3, gpc5a, gpc5b, gpc6a and gpc6b. Maternal expression was detected for gpc1b, but zygotic expression started only during segmentation.. Maternal expression was not seen for gpc1a and gpc5c. gpc1a transcripts were first detected at gastrulation stage and gradually increased during segmentation period and gpc5c was detected from late segmentation stages.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Temporal mRNA expression of glypicans genes during early embryonic development.

RT-PCR was performed for all 10 genes using cDNA from specified stages of development. β-actin was used as a control. Ep, epiboly; som, somites; hpf, hours post fertilization.

https://doi.org/10.1371/journal.pone.0080824.g004

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Spatial expression of zebrafish glypicans during cleavage to early segmentation stages.

In situ hybridization was performed to detect glypican mRNA during early developmental stages. Lateral views with anterior to the top (A, B, C) and dorsal to the right (B, C). Developmental stages and gene names are indicated. tb, tailbud; hb, hindbrain; en, endoderm; me, mesencephalon; n.d: not detected.

https://doi.org/10.1371/journal.pone.0080824.g005

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Spatial expression pattern of zebrafish glypicans during segmentation and pharyngula stages.

In situ hybridization was carried out to detect glypican mRNA at 20 somite stage: 19 hpf and pharyngula stages: 24-26 hpf. Lateral view of whole mount embryos, anterior to the left. Expression pattern of gpc1a (A, A’), gpc1b (B, B’); subfigure in B is an optical section indicating expression in yolk cells (arrowheads) and branchial arch primordium, gpc2 (C, C’), gpc3 (D, D’), gpc4 (E, E’), gpc5a (F, F’), gpc5b (G, G’), gpc5c (H, H’), gpc6a (I, I’), gpc6b (J, J’). di, diencephalon; te, telencephalon; hb, hindbrain; tg, tegmentum; nc, neural crest; pm, paraxial mesoderm; som, somites; ba, branchial arch; y, yolk; mb, midbrain; ff, fin fold; ov, otic vesicle; fp, floor plate; psom, posterior somites; ep, epiphysis; tri, trigeminal placode; cl, cloaca; pllp, posterior lateral line primordium; cg, cranial ganglion.

https://doi.org/10.1371/journal.pone.0080824.g006

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 7. Specific expression domains for gpc1a, gpc1b and gpc5b.

Transverse cross sections revealed the expression details of gpc1a, gpc1b and gpc5b. Dotted line indicates the plane of section. pllp: posterior lateral line primordium; pba: posterior branchial arch; my: myotome; fp: floor plate; nc: notochord.

https://doi.org/10.1371/journal.pone.0080824.g007

These findings were confirmed and extended by whole mount in situ hybridization. As seen by RT-PCR, maternal contribution was observed for gpc2, gpc4, gpc5a, gpc5b, gpc6a and gpc6b (Figure 5A). gpc1b was also detected by ISH at cleavage stages but not later during gastrulation. gpc3 transcripts could not be detected either during blastula or gastrula stages by ISH probably due to low levels of transcripts.

Gastrulation marks the process when cell movements result in the formation of the germ layers and embryonic axis. Gpc3 and Gpc4 influence this process in a mutually exclusive manner [20]. Along with gpc4, we also detected gpc2, gpc5a, gpc5b, gpc6a and gpc6b transcripts at 60% epiboly (Figure 5B). Further functional studies will uncover whether all glypican genes function independently or exhibit redundancy with each other during early stages.

We next examined the expression of glypicans during the segmentation period. Beginning from the 2-somite stage, the expression domains of glypicans became more tissue-restricted (Figure 5C). Whereas gpc2, gpc5b and gpc6b were seen ubiquitously on the dorsal side of the embryo, gpc1a, gpc1b and gpc5a showed restricted expression domains in the developing nervous system. gpc1a expression was seen throughout the brain primordium, gpc1b was present near the hindbrain and tailbud region and gpc6a in the mesencephalic region. gpc5a was selectively expressed in the ventral endoderm. gpc3 or gpc5c were not detected.

By the 20 somite stage, all glypicans were detected by ISH. Most genes were expressed in a variety of neural tissues. gpc1a was detected in the primordial telencephalon, diencephalon and hindbrain (Figure 6A). By the 24 hpf stage, its expression became more confined to these regions and was also detected in the posterior lateral line primordium (Figure 6A’, Figure 7A). gpc1b was initially seen in the trigeminal placode and the yolk cells during segmentation (Figure 6B) and at 24 hpf, in somites (Figure 6B’) and the branchial arch (Figure 7B).

gpc3 was expressed very specifically in the midbrain, coinciding with the time of active patterning processes in this tissue (Figure 6D, 6D’). This is in contrast to previous observation where gpc3 was suggested to be restricted to the prospective hindbrain [31]. gpc4 was expressed broadly throughout the embryo but excluded from most dorsal regions, including the telencephalon (Figure 6E. E’). gpc5a was detected in the midbrain, otic vesicle, primordial fin fold and cloaca (Figure 6F) and this pattern persisted at 24 hpf (Figure 6F’). gpc5b was restricted to the floor plate from the 20 somite stage (Figure 6G), but at 24 hpf, its expression was additionally detected throughout the nervous system (Figures 6G’, 7C)

gpc6a was initially very strongly expressed in the epiphysis and the trigeminal placode (Figure 6I) and at 24 hpf, it was also seen in the telencephalon, tegmentum, cranial ganglia and the hindbrain (Figure 6I’). gpc6b was present uniformly in the nervous system (Figure 6J, 6J’).

gpc2 had the most widespread expression domain, seen ubiquitously in the embryo (Figure 6C, 6C’). In contrast, gpc5c was expressed outside the nervous tissue, in posterior somites (Figure 6H, 6H’).