Figures
Abstract
Our goal in these analyses was to use genomic features from a test set of primary breast tumors to build an integrated transcriptome landscape model that makes relevant hypothetical predictions about the biological and/or clinical behavior of HER2-positive breast cancer. We interrogated RNA-Seq data from benign breast lesions, ER+, triple negative, and HER2-positive tumors to identify 685 differentially expressed genes, 102 alternatively spliced genes, and 303 genes that expressed single nucleotide sequence variants (eSNVs) that were associated with the HER2-positive tumors in our survey panel. These features were integrated into a transcriptome landscape model that identified 12 highly interconnected genomic modules, each of which represents a cellular processes pathway that appears to define the genomic architecture of the HER2-positive tumors in our test set. The generality of the model was confirmed by the observation that several key pathways were enriched in HER2-positive TCGA breast tumors. The ability of this model to make relevant predictions about the biology of breast cancer cells was established by the observation that integrin signaling was linked to lapatinib sensitivity in vitro and strongly associated with risk of relapse in the NCCTG N9831 adjuvant trastuzumab clinical trial dataset. Additional modules from the HER2 transcriptome model, including ubiquitin-mediated proteolysis, TGF-beta signaling, RHO-family GTPase signaling, and M-phase progression, were linked to response to lapatinib and paclitaxel in vitro and/or risk of relapse in the N9831 dataset. These data indicate that an integrated transcriptome landscape model derived from a test set of HER2-positive breast tumors has potential for predicting outcome and for identifying novel potential therapeutic strategies for this breast cancer subtype.
Citation: Kalari KR, Necela BM, Tang X, Thompson KJ, Lau M, Eckel-Passow JE, et al. (2013) An Integrated Model of the Transcriptome of HER2-Positive Breast Cancer. PLoS ONE 8(11): e79298. https://doi.org/10.1371/journal.pone.0079298
Editor: Sophia N Karagiannis, King's College London, United Kingdom
Received: January 11, 2013; Accepted: September 20, 2013; Published: November 1, 2013
Copyright: © 2013 Kalari et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: These studies were supported in part by funds from the 26.2 With Donna Foundation, the Eveleigh Family Foundation, the Carmichael Family, and the Mayo Foundation. Additional support was obtained from National Cancer Institute grants CA129949 (to EAP) and CA155129 (to EAT). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Approximately 15% of all invasive breast tumors, at presentation, overexpress the EGFR family member HER2 [1–3]. Clinically, this subset of breast tumors is defined by high level expression of HER2 on the plasma membrane of >10% of the cells within a tumor, assessed by immunohistochemistry, and/or by amplification of the ERBB2 gene, as evidenced by fluorescent in situ hybridization. High level HER2 expression is associated with decreased overall survival [3,4]. Several large clinical trials have shown that patients with such HER2-positive tumors benefit from HER2-targeted therapies. The initial targeted trials were done with the humanized HER2 monoclonal antibody trastuzumab (Herceptin®), first in the metastatic and then in the adjuvant setting [5–12]. Such targeted therapy in the adjuvant setting has resulted in a dramatic increase in survival of patients with HER2 breast cancer, as first firmly established by clinical trials such as NCCTG N9831 and NSABP B31 [13], which have helped define the standard of care for such patients. Additional trials have been carried out (or are in progress) using other HER2 monoclonal antibodies (pertuzumab, trastuzumab-emtansine) as well as small molecule receptor tyrosine kinase inhibitors (lapatinib) that target HER2 signaling activity.
Although tremendous strides have been made in management of patients with HER2-positive tumors, a number of important questions remain to be answered about this clinical subtype of breast cancer. Although there is abundant evidence that HER2-positive tumors manifest distinct patterns of gene expression, alternative splicing, and somatic mutation [14] [15] [16] [17] [18], the basic biology of this tumor subtype is not well understood. We do not fully understand the processes that are activated downstream of HER2 gene amplification and overexpression. It is likely that these HER2-associated processes affect the manner in which tumors respond to HER2-targeted therapy and/or to conventional chemotherapy in combination with HER2-targeted therapy; so identification of key processes that are critical to the establishment and maintenance of HER2-positive tumors may inform novel therapeutic strategies to overcome primary or acquired resistance to HER2-targeted therapies or lead to the development of alternative therapeutic strategies that are less expensive than trastuzumab, which is in many cases beyond the means of patients in underdeveloped countries.
We reasoned that the key to understanding the clinical behavior of HER2-positive tumors lies within networks of interacting genes that affect the activity of biological processes that are essential to establishment and maintenance of the HER2-transformed phenotype. Thus, our analyses were motivated by the central concept that the clinical/biological properties of the tumors will be defined not by individual genes but by the processes that are controlled by multiple interactive genomic features. To evaluate this hypothesis we interrogated total (polyA+) RNA sequence (RNA-Seq) data from a test set that consisted of benign breast tissue samples plus ER+, triple negative, and HER2-positive primary invasive breast tumors. We identified genes that are differentially expressed, transcripts that are alternatively spliced, and genes that express novel, non-synonymous single nucleotide polymorphisms. We integrated these genomic features to model the interactions between such HER2-associated genomic features in our test set. This model was comprised of 12 highly interconnected genomic modules, each of which corresponds to a distinct functional process. The generality of this model was tested by interrogation of gene expression data from TCGA breast cancer samples, and the ability of the model to make relevant biological predictions was evaluated using data from the Cell Line Encyclopedia as well as clinical outcomes data from an adjuvant trastuzumab trial (N9831). Our results reveal that novel functions related to integrin signaling, ubiquitin-mediated proteolysis, M-phase progression, RHO-family GTPase signaling, and TGF-beta signaling are linked to drug response and to clinical outcome in HER2-positive tumors.
Materials and Methods
Samples
Polyladenylylated RNA was isolated from epithelial cells derived from excisional biopsies of 8 breast lesions that were subsequently determined to be free of DCIS or invasive cancer. These samples will hereinafter be called “benign”. RNA was also prepared from 8 fresh-frozen tissues of ER+ (estrogen receptor positive), 8 HER2+ (HER2-enriched), and 8 triple negative (TN – estrogen receptor negative, HER2 negative, and progesterone receptor negative) tumors (all infiltrating ductal carcinoma). Clinical/pathological characteristics of these tumors are given in Table S1. RNA quality of the samples was determined using Agilent Bioanalyzer and all samples had a RIN value > 7.9. cDNA libraries were prepared and sequenced (2 X 50nt paired ends) by the Mayo Clinic Genome Facility using the Illumina Genome Analyzer II (GAIIx). The RNA sequence data used in this manuscript have been previously used to call fusion transcripts from tumor samples [19]. All patients gave full written consent for these studies. Protocols for tissue collection (MC09-001909) and sequence analysis (MC09-000035) were approved by the Mayo Clinic Institutional Review Board. Data used in this study are deposited in the Gene Expression Omnibus web site at GSE45419.
Databases and software used for analyses
FASTQ files from RNA sequencing were aligned to the human genome build NCBI 37.1 (GRCh37), which corresponds to human genome assembly hg19 in UCSC [20]. BWA [21] and TopHat [22] alignment software were used to align paired-end RNA-Seq reads. The 1000 Genomes Project (1000g 2011May) and 5400 exome sequencing data were obtained for filtering single nucleotide variants from UCSC genome browser. Germ-line single nucleotide variants were filtered using dbSNP version 135 (http://www.ncbi.nlm.nih.gov/SNP/). Functional annotation of SNVs was performed using the ANNOVAR software [23]. A variety of statistical packages from R programming language were used for computing and generating some plots, including JMP 9.0 (http://www.jmp.com/) and Partek6.6 (http://www.partek.com/). A Microsoft SQL server database was used to store and query nucleotide positions to call SNVs. PERL and R programming language was used to write subroutines for data analysis.
Alignment
Paired-end RNA-Seq reads were aligned to both genome and exon-exon boundary databases using BWA to obtain gene counts. BWA is a fast and accurate short read aligner [21]. Reads with more than two mismatches in first 32 bases in each alignment and reads that mapped to multiple genomic locations (alignment score less than 3) were discarded. In order to make confident single nucleotide variant calls from RNA-Seq data, we have used two aligners (BWA and Bowtie). Bowtie is an ultrafast and memory-efficient short read aligner that does not allow gaps. TopHat is a fast splice junction mapping software that uses Bowtie alignment to align RNA-Seq reads [22,24]. Binary Alignment/Map (BAM) format files from BWA and TopHat were obtained for each sample. Gene counts were derived from both TopHat and BWA aligners using BED tools from UCSC to count reads corresponding to a known gene. The correlation between the gene counts was high from TopHat and BWA aligners (r =0.95, range 0.94 to 0.97). Hence, we have used BWA gene counts for gene expression analysis. We used TopHat BAM files for both alternative splicing analysis and SNV analysis. Consensus SNV calls were obtained for samples if they were present from both BWA and TopHat pileup files, as described below.
Gene Expression analysis
Figure 1 summarizes the approach to identification of HER2-associated genomic features in our test set of tumor samples. Gene counts for samples were summarized and annotated using our in-house scripts developed using BamToBed utility and UCSC refFlat annotations for further analysis. The read counts for genes were obtained for downstream differential gene expression analysis. There were a total of 22,323 genes with gene count data for normalization. Individual gene count data were normalized using mode normalization method as previously described [25]. Genes that had a median read count >24 (16 reads) in at least one of the four groups were used for gene expression analysis. After removing the genes with low expression, there were 16,195 genes considered for differential gene expression analysis. The Dunnett-Tukey-Kramer (DTK) package in R programming language was used for pairwise multiple comparison tests for unequal variance and unequal sample sizes [26]. Genes for which the HER2 tumor group had a mean log (read+1) significantly different from the means of the other tumor and normal groups were obtained. A HER2-positive gene list (p<0.05) was obtained after filtering multiple comparison values from HER2+, ER+, TN, and benign groups.
High level analytical approach to build HER2-positive transcriptomic landscape from paired-end RNA-Seq data analysis of breast tumor subtypes.
Alternative splicing analysis
BAM files after alignment were loaded into Bioconductor. CASPER, implemented as an R package (https://sites.google.com/site/rosselldavid/software), was used to quantify known splicing variants. Maximum likelihood estimates of the relative abundances of known transcripts were obtained via the Expectation Maximization (EM) algorithm using CASPER as previously described [25]. Genes that were expressed (gene read count > 16) and had more than one alternatively spliced transcript were used to determine the ratios of transcript expression values in each sample. Group comparisons of transcripts were performed using the Dunnett-Tukey-Kramer package, as described above for gene expression analysis. Transcripts for which the HER2-positive tumor group had a mean ratio significantly different from ER+, TN, and benign cohorts were identified.
Expressed single nucleotide variant (eSNV) analysis
RNA-Seq data were used to detect expressed nucleotide sequence variants (eSNVs), including somatic mutations. In general, genotype calling algorithms for SNVs were designed for germline DNA and not for RNA. Hence, the false detection rates to call an SNV are high in RNA-Seq data from tumors. We have developed an eSNV-Detect (expressed single nucleotide variant detection) workflow with parallel alignment strategies (Bowtie and BWA). The advantage of using two aligners in eSNV-Detect is that we take complementary strengths of two aligners and reduce the weakness of these tools. Figure 2 shows the flowchart of the workflow for eSNV-Detect. We have used eSNV-Detect, to call novel SNVs in tumors using a combination of computational tools and methods. We merged both junction and genomic alignment reads from BWA and generated one pileup file for each sample as previously described [25]. The pileup file generated from each BWA BAM file was used to predict SNVs using SNVMix software [27]. Reads with low quality (mapQ score < 20) were filtered by SNVMix. We obtained the reference allele, number of reads supporting reference call, alternate allele, and number of reads supporting alternate allele, for every transcribed position for which evidence of an alternate allele was present. We also filtered reads for read depth <4 and ratio of alternate allele <0.1 (ratio of alternate allele = number of reads with alternate allele/total read depth). TopHat (Bowtie) analysis was used to eliminate duplicate reads and multi-region hit reads from the BAM file. We generated a pileup file from the filtered BAM file. For each nucleotide position, we obtained the reads supporting A+, A-, C+, C-, G+, G-, T+ and T-, where + and - indicate the polarity of the read strand. For a position with alternate allele evidence from BWA, we made sure that the variant called is not due to strand bias by making use of TopHat data. For example if the variant allele is G, we examined the sequences of both G+ and G- data to ascertain that the variant allele was present on both the strands and that the ratio of alternate allele count on positive and negative strand was >0.1. After removing the SNVs that exhibited strand bias, we obtained the eSNV candidates that were confidently called by two approaches. Consensus SNVs were obtained and filtered based on annotation as shown in our eSNV-Detect workflow (Figure 2). Only the eSNVs that were present from two approaches and were non-synonymous were carried further for analysis. The final eSNVs obtained from our method were filtered for germline or known SNVs present in dbSNP 135, 1000 genome, or 5400 exome datasets. After a series of annotation filters as shown in Figure 2 were applied, we identified novel eSNVs for each sample. All the eSNVs identified were stored in a MySQl database along with the tumor type for a sample. The database was queried to obtain eSNVs that were detected only in HER2-positive. Finally, HER2-positive eSNVs were evaluated for 3’ or 5’ end bias using the data from pileup files; alternate allele reads uniquely detected at either 5’ or 3’ ends of the reads were eliminated using VCF tools.
Flow chart of the eSNV-Detect – a method to identify expressed SNVs from paired-end RNA-Sequencing data.
Network analysis
Genomic features (differential expression, alternative splicing, and eSNVs) that were differentially detected in the HER2-positive tumors included in the test set were compiled for network analysis using Cytoscape [28]. Network analysis was performed in Cytoscape using the Reactome FI feature [29] and network analyzer [30] plug-ins to construct an interactome model. Linker genes (not present in our list but known to interact with our integrated gene list based on literature evidence) were excluded from the HER2 network to emphasize the degree of direct connectivity between and among our HER2-positive genomic features. Comprehensive network parameters such as number of edges for each node, distribution of degree counts and neighborhood connectivity were obtained using network analyzer in Cytoscape. We also performed clustering analysis in Cytoscape to identify modules or clusters in the HER2 network. The Pathway Enrichment analysis tool in Cytoscape was used to identify pathways enriched in each module of the HER2 network.
Cell Line Encyclopedia data analysis
Gene expression and pharmacodynamic data for paclitaxel and lapatinib were obtained for cancer cell lines from the cancer cell line encyclopedia (CCLE) data sets [31]. Of note is that we did not include trastuzumab data, as Cell Line Encyclopedia data for trastuzumab are not available. There were 58 breast cancer cell lines in the encyclopedia database, of which 20 have paclitaxel response data (EC50) and 18 have lapatinib response data (EC50). Spearman log rank correlation analysis was used to identify HER2 network genes that correlated with EC50 values for these two drugs.
Analysis of association between genes in the HER2 network and clinical outcome following HER2-targeted therapy
DASL expression array data were obtained from the NCCTG N9831 adjuvant trastuzumab clinical trial for 1282 patients for whom we have clinical response data [12]. All patients in the N9831 study were randomized to receive the anthracycline doxorubicin plus cyclophosphamide followed by paclitaxel alone (Arm A), paclitaxel followed by trastuzumab (Arm B), and concurrent paclitaxel plus trastuzumab (Arm C) [13]. Gene Set Analysis [32] was carried out using data from Arm C and genes from the HER2 transcriptome model to determine if any of the modules within this network are associated with risk of relapse, defined by univariable Cox Hazard ratio analysis of individual genes from the DASL array dataset versus time to event (distant relapse) as a continuous variable [33].
The Cancer Genome Atlas (TCGA) validation of candidate pathways
Gene count data from TCGA breast tumor samples (RNA-Seq) were downloaded from the TCGA data portal. PAM50 definitions of intrinsic subtype were used to assort samples into HER2-enriched (n=66), basal-like (n=140), and luminal (n=604) cohorts. DTK analysis was carried out using TCGA gene counts for differentially expressed genes from our initial analysis of 32 tumors. Fisher’s exact test was used to determine if genes associated with relevant pathways were significantly enriched in HER2 samples from TCGA. Gene copy number and mutational data from TCGA breast tumors were extracted from Cbioportal (www.cbioportal.org).
RT-PCR and Sanger sequencing validation
Genomic DNA from tumors was extracted from the BCT40 HER2 tumor and tumor adjacent normal tissue, and 83 eSNVs were validated using Sanger sequencing. Primer pairs for the eSNVs were designed using Primer3 version 4.0 software, and were used to amplify all variants by PCR. PCR products were purified from unincorporated nucleotides using a Millipore PCR purification plate. A total volume of 10μl, containing 80ng of the purified PCR product and 1.6pM of one of the primers (forward or reverse), was used for sequencing. Electropherograms were analyzed with SeqScape v2.5 (ABI, Applied Biosystems, Foster City, CA, USA). Quantitative real time PCR (qPCR) was used to verify two alternative splice isoforms of MPG transcripts (MPG-002, MPG-201) in tumor and benign samples. Equal aliquots of total RNA from samples were converted to cDNA with the High-Capacity cDNA Archive kit (Applied Biosystems), and qPCR reactions were performed in triplicate with 10ng of cDNA and the TaqMan® Universal PCR master mix (Applied Biosystems). Custom primer/probe sets were purchased from Applied Biosystems: NM_001015052.1 forward primer GGTCCGAGTCCCACGAA, reverse primer CTGGTCGCTGCTTCTTTTGC, reporter CCCAGTTTTGCCGACGGATG; NM_001015054.1 forward primer GTGCCCAGTTGCTCTTCAAG, reverse primer CTGGTCGCTGCTTCTTTTGC, reporter CCGTCGGCAAAACTGAAAA. All amplification data were collected with an Applied Biosystems Prism 7900 sequence detector and analyzed with Sequence Detection System software (Applied Biosystems). Data were normalized to POLR2A, and mRNA abundance was calculated using the ΔΔCT method.
Results
The analytical plan, outlined in Figure 3, began with paired end (2x50nt) RNA sequence (RNA-Seq) analysis of polyA+ RNA from a survey panel of samples that consisted of 8 benign breast tumor samples plus 8 each ER+, HER2-positive, and triple negative (TN) primary invasive breast tumors. Sequence alignment data are summarized in Table S2; but, briefly, percent aligned reads ranged from 73-86%, with GeneCount-ReadStart aligned ranging from 22M to 68M read pairs per sample. (Note that for paired end sequencing, total aligned 50nt tags is equal to twice the number of read pairs.) Mode normalization of gene counts was carried out as described previously [25]. As shown in Figure S1, density plots indicated that genes with <16 total aligned tags were near or below the limits of detection; and these were eliminated from the analyses. Transcripts with >16 tags aligned ranged from 14-17K per sample, with the exception of one outlier, a TN tumor with only 11,230 transcripts (ID - BR73 in Table S2). Principle components analysis indicated that this tumor did not cluster with the TN tumors, or any of the other tumor cohorts (not shown); this sample was excluded from all subsequent analyses.
Computational approach to identify and characterize genomic features associated with HER2-positive tumors.
As indicated in Figure 3, the summarized RNA-Seq data were used (as described below) to identify genes that were differentially expressed or alternatively spliced in the HER2-positive tumors in our test set, as well as genes that contained expressed single nucleotide variants that were detected only in this HER2-positive tumor cohort. Genes associated with such features were used to build an integrated transcriptome landscape map that identified a number of biological processes that appear to be predominant in the HER2-positive tumors included in this analysis.
Identification of genomic features that define the HER2-positive tumors in our test set
Differential expression.
Mean gene expression was compared between the tumor types using the Dunnett-Tukey-Kramar procedure, which controls type1 error for all pair-wise comparisons between the groups. We used mode normalized, log2 transformed mRNA abundance of individual genes in the four sample cohorts (HER2, ER+, TN, benign). We identified 685 genes that were differentially expressed in these HER2-positive tumors at p<0.05 compared to each of the other breast tumor subtypes in the test set. Nine representative genes are shown in Figure 4, and the remainder in Table S3. Hierarchical clustering (Figure 5) graphically illustrates the distribution of all 685 genes in the tumors analyzed in this cohort.
Box plot representation of nine differential expressed genes that are specific to the HER2-positive tumors compared to other tumors in our test set, shown in log2 scale.
Hierarchical clustering of 685 significantly differentially expressed genes in HER2-positive tumors compared to other tumor subtypes in our test set of tumors.
Alternative splicing.
The activity of a given gene is influenced not only by changes in the abundance of the gene product (mRNA), but also by changes in the nucleotide sequence of the transcript. Alternative splicing can give rise to protein products with different functions, such that differential expression of splice variants represents one potential mechanism to affect changes in gene activity. The CASPER package was used to quantify known RefSeq splice variants in the four sample cohorts. The relative abundance of each alternatively spliced isoform was calculated as counts assigned to an individual isoform/total counts for all transcript isoforms for each gene. Splice variants in the four sample cohorts were identified by Dunnett-Tukey-Kramar analysis of the relative (fractional) abundance of the isoforms. Although CASPER interrogates only known splice variants, we have previously validated the utility of this tool for identifying alternatively spliced genes in lung cancer samples [25]. Representative data from two genes (PPM1A and MPG) that are alternatively spliced in a pattern that was observed in the HER2-positive tumors are shown in Figure 6. For example, PPM1A splice variant NM_177952 is relatively abundant in our test set of HER2-positive tumors whereas NM_021003 is relatively abundant in the benign, ER+, and TN tumors included in this group of samples. A total of 199 transcripts, corresponding to 102 genes, were alternatively spliced in a manner that was uniquely associated with our HER2-positive tumors (Table S4).
Visualization of output values from CASPER splicing analysis method for PPM1A and MPG genes. Data indicates that PPM1A and MPG transcripts are uniquely and alternately spliced in HER2-positive tumors compared to other groups.
Expressed single nucleotide sequence variants.
In addition to alternative splicing, it is clear that genetic (mutational) events play a significant role in the generation of gene products with altered functions in tumor cells. Identification of expressed single nucleotide sequence variants (eSNVs) from RNA-Seq data has been challenging due to the dynamic range of RNA abundance, which imposes significant limits upon the confidence with which one can identify such features in transcripts that are expressed at low abundance. Additional issues related to sequence strand, exon junction, and 5’ end bias are also common sources of false positive detection, as discussed in the Materials and Methods section. As described on Figure 2, we have developed a novel analytical workflow that addresses and eliminates most of these issues.
Using the filters described in Materials and Methods, we identified 318 high confidence novel exonic non-synonymous eSNVs that were expressed at >3 counts of the alternate allele in one or more of our HER2-positive tumors but not in benign, ER+, or TN samples or in any of the SNP databases (e.g. dbSNP135, 1000 genome, or 5400 exome). These candidate novel eSNVs are listed in Table S5. The HER2-associated eSNVs correspond to 303 genes, listed in Table S6. The range of high confidence novel eSNVs per HER2-positive tumor was 22-83, median 35 (Table S7). Median eSNVs that were unique to our ER+ and TN tumor samples were 34 and 57 respectively, with no statistically significant differences in eSNV/tumor for any of the subtypes.
We used an earlier version of our eSNV workflow to call KRAS mutations in lung adenocarcinoma samples with 100% accuracy [25]. We selected one HER2-positive tumor to validate the current version of this analytical tool in breast cancer. Tumor BCT40 was selected because it had the largest number of candidate eSNVs among the HER2-positive cohort, with 83 high-confidence candidates nominated (Table S8). Total read depth for these 83 candidates ranged from 6 to 327 reads, and alternate allele reads ranges from 4 to 93 reads. PCR amplification followed by Sanger sequence analysis of genomic DNA from tumor and tumor-adjacent normal tissue confirmed 79 of these candidate eSNVs, indicating that our false detection rate for this analysis is in the range of about 5%. The three candidates that did not validate had minimal read depth (4 alternate allele reads); however, 6/9 candidates with alternate read depth = 4 validated, and all candidates with 5 or more alternate reads were validated. We conclude that filtering for 4 or more alternate allele reads gives us an acceptable false detection rate on the order of 5%.
Since germ line (blood) DNA was not available for these samples, we used tumor-adjacent normal tissue for identification of potential somatic mutations. Among the 79 validated eSNVs, 51 were unique to the tumor genomic DNA, whereas 28 were detected in both tumor and tumor-adjacent normal tissue. Although all of the eSNVs were filtered to remove known polymorphisms (present in dbSNP135, 1000 genome, and 5400 exome datasets), our data suggest that at most 1/3 of our candidate eSNVs may be rare germ line polymorphisms. This conclusion must be advanced with caution, since tumor-adjacent tissue may be contaminated with tumor cells. Be that as it may be, we conservatively predict that at least two-thirds of our candidate eSNVs are bona fide somatic mutations.
Sanger sequence chromatograms for two validated somatic mutations are shown in Figures 7 and 8 to illustrate the range of allelic frequencies that we commonly observed. MRPL3 was nominated in tumor BCT40 as a C to G variant on chromosome 3 at coordinates 131220447 (chromosome 3: 131220447) with 53 reads supporting the reference allele (C) and 79 reads supporting the alternate allele (G). Sanger sequence analysis (Figure 7) confirmed this as a heterozygous D69H (chromosome 3: 131220447) somatic mutation. In contrast, the gene encoding transcription factor FOXA1 was called as a C to T variant (chromosome 14:38061115) with 4 reference allele reads and 6 alternate allele reads. Although this variant was confirmed as a somatic mutation by Sanger sequence analysis (Figure 8), the variant allele appears to be present in less than half of the alleles in tumor genomic DNA. This observation informs our strong supposition that RNA-Seq is a very sensitive tool for detecting eSNVs that are expressed in a subset of tumor cells.
Sanger sequence validation of highly expressed novel somatic SNVs for MRPL3 variant in the BCT40 HER2 tumor sample. RNA-Seq sequence reads shown above Sanger sequencing tracing, with mutation shown by an arrow.
Sanger sequence validation of low expressed novel somatic SNVs for FOXA1 in the BCT40 HER2 tumor sample. RNA-Seq sequence reads shown over Sanger sequence trace with mutation indicated by an arrow.
Nine of the HER2-restricted eSNVs were predicted to be nonsense mutations (“stopgain” in Table S5, column J “Exonic Function”). This group included TP53, AMPD3, CPPED1, KDM5C, NIF3L1, NUP214, RERE, SP110, and ZNF552. Five of these genes have been implicated in transcriptional regulation (TP53, KDM5C, RERE, SP110, and ZNF552); whereas two of these genes are known to participate in activation of cell death (TP53 and RERE). The remaining eSNVs were non-synonymous coding variants, predicted to alter the amino acid sequence of the protein product.
Nine of the 318 novel eSNVs were detected with high confidence in 2 different HER2-positive tumors. We also identified 16 eSNVs that were expressed with high confidence in one or more tumors and with lower confidence (as evidenced by lower depth of coverage at the cognate genomic coordinates) in multiple tumors (Table S9). For example, NUCB2 is an expressed non-synonymous A to G variant (chromosome 11:17352483). This variant was detected with very high confidence in two tumors (BCT40 with 9 alternate reads and BCT32 with 8 alternate reads) and with reduced confidence in a third tumor (BCT39 with 2 alternate reads). One non-synonymous eSNV in the MLL (KMT2A) gene (chromosome 11:118375914) was detected in 4/8 HER2-positive tumors, although at low read depth in 3 of these samples. In addition to these two eSNV, 14 additional candidates corresponding to TXLNA, HNRNPF, IQGAP2, OTUD7B, GPN3, APS32, WNK4, ANKRD40, RIF1, RPL3, GSK3B, RUVBL1, MRPL3 and THAP5 genes were detected with high confidence in some samples and at low depth of coverage in other samples (Table S9).
We interrogated the TCGA exome sequence database to determine if mutations were detected (from exome-seq data) in any of the genes that had stopgain mutations (9 genes) or expressed recurrent eSNVs (16 genes), as described above. As shown in Table S10, we identified 129 TCGA tumors with ERBB2 amplification. Considering the genes with stopgain mutations in our test set, we identified 2 TCGA tumors with KDM5C mutations, 2 with NUP214 mutations, 1 with RERE mutation, 1 with SP110, and 59 with TP53 mutations. Among the genes that expressed recurrent nonsynonymous mutations in our test set, we detected 5 TCGA tumors with MLL (KMT2A) mutations and 2 with RIF1 mutations. ANKRD40, HNRNPF, IQGAP2, OTUD7B, and THAP5 mutations were detected in 1 tumor, each. Somewhat to our surprise, we noticed that many of the tumors that were detected as eSNVs in our test set exhibited copy number variations in TCGA breast tumors. Strikingly ANKRD40 was amplified in 90/129 tumors. This gene is on chromosome 17q21 and not part of the ERBB2 amplicon at 17q12 (Table S10). OTUD7B (1q21.2) was amplified in 92/129 tumors, whereas CPPED1 (16p13.12) and WNK4 (17q21-q22, adjacent to ANKRD40) were amplified in 69/129 and 61/129 tumors, respectively. Thus, eSNV data from our test set of HER2-positive tumors has identified a number of genes that appear to be mutated, both at the single nucleotide sequence and gene copy number levels, in TCGA tumors with ERBB2 amplification.
Integrated analysis of HER2-specific genomic features
It should be emphasized that although the genomic features described above are confined to the HER2-positive tumors within our survey panel, we do not wish to imply that these features are HER2-specific in any general sense or that they may have applicability as biomarkers of HER2-positive tumors. Rather, our goal was to define a set of genomic features that were unique to a test set of HER2-positive tumors, to use these features to develop a model of the genomic architecture of the tumors within that test set, and then to test the ability of that model to make predictions about the biological and/or clinical behavior of HER2-positive tumors. Our analyses have identified 685 genes that are differentially expressed in a pattern that is unique to the HER2-positive tumors in our test set of samples. Likewise, we identified 102 genes that are alternatively spliced and 303 genes that contain eSNVs that are uniquely expressed in this panel of HER2-positive tumors. Moreover, our data indicate that there is limited overlap between these genomic features, as illustrated by the VENN diagram in Figure 9. Only 8 of these genes were differentially expressed (DE in Figure 9) and alternatively spliced (AS), whereas 20 of the genes that contain eSNVs (SNV in Figure 9) were also differentially expressed. A single gene, MPG (N-methylpurine-DNA glycosylase; EC3.2.2.21), was differentially expressed, alternatively spiced, and contained a non-synonymous somatic mutation. Considering the uniqueness of MPG, we elected to independently validate both the splice variants and the eSNV. RNA-Seq analysis nominated a G to A eSNV (chr16:133064) with 14 reads supporting the alternate allele (A) and 11 reads supporting the reference allele (G). Sanger sequencing confirmed that this is a somatic R105Q (G314A) mutation that appears to be heterozygous in the tumor genomic DNA (Figure 10).
Venn diagram representation of genes obtained from three genomic features analyses.
Sanger sequencing validation of MPG eSNV in HER2 tumor. RNA-Seq reads shown over Sanger sequence tracing with mutation indicated by an arrow.
RNA-Seq analysis indicated that 2 isoforms of the MPG (NM_001015052 and NM_001015054) were expressed in breast tumors. CASPER predicted that the NM_001015054 splice form was expressed at high levels uniquely in our HER2-positive tumors, compared to NM_001015052, as illustrated by the black bars in Figure 11. Overexpression of NM_0010154 in the HER2-positive test set was confirmed using isoform-specific qPCR primer/probes, as shown by the gray bars in Figure 11.
qPCR validation of the two isoforms in breast tumor samples for MPG splicing variants. Isoform abundance by qPCR is indicated by gray bars, whereas isoform abundance determined by CASPER is shown in black bars.
The 1090 genomic features that we have identified in our HER2 tumor panel (685 differentially expressed, 102 alternatively spliced, 303 eSNVs) correspond to 1055 genes. We next asked whether any or all of these genes interact in a manner that might define processes that are associated with the HER2-positive tumors in our sample cohort. To this end we used the Reactome FI feature of Cytoscape to build an interactome map that incorporates genes that encode proteins with known functional interactions [29]. Reactome FI generated a highly integrated network of 244 genes with 541 edges (connections), as shown in Figure 12. To test for random association, we ran 20 Cytoscape simulations using 1055 genes selected at random from the dataset. The mean number of genes integrated into these random networks was 108 (standard deviation = 22) and the mean number of connections generated at random was 175 (standard deviation = 39). Thus the level of integration that we observed within the network shown in Figure 12 (244 genes with 541 edges) was >5 standard deviations above the mean predicted for random association. Bearing in mind that these edges are defined by known interactions, and therefore likely to have functional significance, it is notable that 80 of the nodes within the overall network have 5 or more connections; whereas 32 nodes have 10 or more connections (Table S11).
HER2 tumor interactome network developed using cytoscape and functional reactome of 1055 genes obtained from integration analyses of genomic features. Different functional modules within the network are color coded.
The interactome model shown in Figure 12 is comprised of 12 functionally discrete sub-networks or modules. A high degree of connectivity is apparent within the individual modules, each of which is, in turn, linked to the integrated network through multiple module to module connections. Functional annotation of the modules is given in Table 1, and can be broadly summarized as signal transduction and transcription (modules 2, 3, 5, 6, 8, and 12); protein synthesis, degradation, and secretion (modules 7 and 11); RNA processing (module 4); and processes associated with G2/M phase of the cell cycle (modules 1,9, and 10). Given that this network accommodates a set of genomic features that are associated with the HER2-positive tumors in our samples, we posit that these processes represent a set of interconnected functions that are critical to the establishment and/or maintenance of the HER2-positive tumor phenotype.
| Module | Pathway | Number of Genes in Module | Number of Genes in Pathway | P-value | FDR Pathway Enrichment | Nodal Genes in Pathway |
|---|---|---|---|---|---|---|
| 1 | Aurora A signaling (N) | 44 | 6 | 0 | <1.00e-03 | CYLD, BCL3, CHUK, RELA, TP53, BIRC2 |
| 2 | Integrin signaling pathway (P) | 33 | 10 | 0 | <1.00e-03 | CAV1, ACTG1, LAMB2, ITGAX, ARPC2, ITGAV, COL6A2 ,FLNB, FYN, ABL1 |
| 3 | Phosphatidyl-inositol signaling system(K) | 33 | 7 | 0 | <1.00e-03 | PIP5K1C, PLCB4, PIK3CA, INPP5E, PIK3R1, DGKQ, INPP4A |
| 4 | Transport of Mature Transcript to Cytoplasm (R) | 27 | 10 | 0 | <1.00e-03 | NUP214, CDC40, NUP54, RANBP2, TPR, NUP133, NUPL2, UPF3B, NUP205, NUP107 |
| 5 | Signaling by NGF(R) | 24 | 8 | 0 | <1.00e-03 | PPP2R1B, RTN4, CREB1, FOXO1, ATF1, GSK3B, PRKACA, AKT2 |
| 6 | FOXA1 transcription factor network (N) | 23 | 2 | 0.0009 | 2.26E-01 | FOXA1, NR2F2 |
| 7 | Ubiquitin mediated proteolysis (K) | 17 | 5 | 0 | <1.00e-03 | UBE3A, ANAPC10, STUB1, UBE2D1, UBE2E1 |
| 8 | Signaling by Rho GTPases (R) | 9 | 6 | 0 | <1.00e-03 | TAGAP, PLEKHG2, RHOT2, ARHGEF17, AKAP13, ARAP2 |
| 9 | G2/M Transition (R) | 9 | 5 | 0 | <1.00e-03 | PLK4, CEP57, CKAP5, ALMS1, TUBA1A |
| 10 | M Phase (R) | 8 | 3 | 0 | <1.00e-03 | SMC3, STAG2, STAG1 |
| 11 | Insulin Synthesis and Secretion (R) | 7 | 3 | 0 | 1.00E-03 | SRP54, TRAM1, SSR1 |
| 12 | TGF-beta receptor signaling | 6 | 4 | 0 | <1.00e-03 | SNX6, TGFBR1, YAP1, ENG |
Table 1. Sub networks from the HER2-positive tumor interactome model.
Confirmation of pathway enrichment in TCGA samples
The genomic landscape model described above was generated from a survey panel containing 8 HER2-positive tumors. It is therefore relevant to ask to what extent the pathways described above can be applied generally to HER2-positive tumors. To address this issue, we used gene expression data (RNA-Seq gene counts) from TCGA breast tumors to determine if any or all of the 12 pathways described above was enriched in HER2-positive tumors from a much larger dataset. Initially, we summarized p-values for differential expression, in the TCGA samples, of genes that had been identified as differentially expressed in our study cohort. As shown in Figure S2, we observed that these genes were significantly enriched, based on distribution of p-values, in comparisons of HER2 to tissue adjacent normal and to basal tumors. A significant trend towards enrichment was observed in the comparison of HER2 versus luminal tumors. We then used Fisher’s exact test to determine the extent to which genes that were incorporated in the 12 Cytoscape network pathways were enriched in TCGA samples, relative to genes that were identified as differential features in HER2-positive tumors, but were not incorporated into any of the Cytoscape pathways. As shown in Table 2, genes associated with all 12 pathways were significantly enriched in the comparison of HER2-positive versus normal; whereas 11 out of 12 pathways were enriched when HER2-positive samples were compared to basal tumors. Integrin signaling, ubiquitin-mediated proteolysis, and TGFbeta receptor signaling were significantly enriched in the comparison of HER2-positive versus luminal tumors. We suspect that the relatively lower level of enrichment in the comparison with luminal tumors (in contrast to HER2 vs basal) reflects the well-known overlap between the clinical HER2-positive definition, which we used in our initial analysis, and the luminal intrinsic subtype used for TCGA data. Nevertheless, genes associated with integrin signaling, ubiquitin-mediated proteolysis, and TGF-beta receptor signaling were significantly enriched in HER2-positive versus normal, basal, and luminal samples from TCGA, thereby providing supporting evidence for our conclusion that integrin signaling has some critical role in HER2-positive tumors, compared to the other forms of breast cancer.
| Differential Expression at p<0.05 in pairwise comparsions | ||||||||
|---|---|---|---|---|---|---|---|---|
| PathNo. | Pathway Description | Genes in Pathway | HER2 vs Normal Genes | p-value | HER2 vs Basal Genes | p-value | HER2 vs Luminal Genes | p-value |
| p01 | Aurora A signaling(N) | 44 | 27 | 2.99E-08 | 25 | 8.46E-07 | 15 | 9.83E-02 |
| p02 | Integrin signalling pathway(P) | 33 | 23 | 9.59E-09 | 20 | 2.93E-06 | 16 | 1.19E-03 |
| p03 | Phosphatidy-linositol signaling system(K) | 33 | 23 | 9.59E-09 | 19 | 1.53E-05 | 11 | 2.05E-01 |
| p04 | Transport of Mature Transcript to Cytoplasm(R) | 27 | 18 | 1.27E-06 | 17 | 8.32E-06 | 9 | 2.45E-01 |
| p05 | Signalling by NGF(R) | 24 | 20 | 4.36E-10 | 13 | 8.41E-04 | 8 | 2.27E-01 |
| p06 | FOXA1 transcription factor network(N) | 23 | 14 | 9.59E-05 | 10 | 4.10E-02 | 2 | 1.32E-01 |
| p07 | Ubiquitin mediated proteolysis(K) | 17 | 14 | 3.18E-07 | 11 | 2.67E-04 | 8 | 3.59E-02 |
| p08 | Signaling by Rho GTPases(R) | 9 | 8 | 5.39E-05 | 6 | 6.43E-03 | 1 | 6.93E-01 |
| p09 | G2/M Transition(R) | 9 | 6 | 6.43E-03 | 7 | 7.67E-04 | 4 | 2.24E-01 |
| p10 | M Phase(R) | 8 | 5 | 1.92E-02 | 6 | 2.65E-03 | 3 | 3.96E-01 |
| p11 | Insulin Synthesis and Secretion(R) | 7 | 5 | 8.85E-03 | 4 | 5.40E-02 | 2 | 6.65E-01 |
| p12 | TGF-beta receptor signaling | 6 | 4 | 2.82E-02 | 4 | 2.82E-02 | 4 | 2.82E-02 |
Table 2. Pathway enrichment statistics in breast cancer subtypes from TCGA.
Potential clinical significance of the HER2 interactome map
Linking the model to response to HER2-targeted therapy in vitro.
Landscape models of the sort shown in Figure 12 can be used to define processes that are critical to the pathology of tumors. However, from a translational standpoint, such models are useful to the extent that they can be linked to therapeutic response. Initially, we asked if any of the genes from our network modules might be associated with response to abrogation of HER2 signaling. To this end we used our landscape model genes to interrogate data from the recently published Cell Line Encyclopedia [31], which includes both gene expression (Affymetrix arrays) and sensitivity (EC50) to the HER2 small molecule tyrosine kinase inhibitor lapatinib in 18 established breast cancer cell lines. Rank order correlation was used to determine if expression of any of our 244 HER2-associated genes from the interactome map correlated with response to HER2-targeted therapy in vitro. It should be noted that in this analysis, and those described below, we are in some cases interrogating differences in mRNA abundance of genes that were initially identified based on eSNV or alternative splicing. This approach was adopted based on the rationale that a gene that might be activated or suppressed by mutation or alternative splicing in a given tumor might also be activated or repressed by altered expression in a different tumor. In all of these analyses we are asking if the pathway is important, irrespective of the precise mechanism ascribed to individual genes within the pathway. The validity of this proposition is re-enforced by the observation that many of the genes that we detected as eSNVs in our survey panel were overexpressed due to gene amplification in TCGA breast samples. Using this approach, we identified 26 genes whose expression correlated with lapatinib response (Table 3). Monte Carlo simulation suggest that the probability that such a correlation might occur at random is <0.001. The most significant of these was integrin-linked kinase (ILK, p<0.0001). Genes involved in RHO-family GTPase signaling and M-phase progression were also prominent in this cohort. Broadly speaking, these data suggest that response to HER2-targeted therapy is likely to be influenced not only by ERBB2 (the target of such therapy) but also by the pathways that are associated with HER2-mediated transformation. Among these pathways, our data indicate that integrin signaling, processes associated with M-phase progression, and RHO-family GTPase signaling are associated with, and perhaps likely to impinge upon, the extent to which cells respond to abrogation of HER2 signaling.
| ID | Gene Description | Type | r(Spearman) | p-value | Function |
|---|---|---|---|---|---|
| ILK | integrin-linked kinase | DE | -0.791538 | 9.10E-05 | Integrin signaling |
| ALMS1 | Alstrom syndrome 1 | SNV | 0.76677 | 2.00E-04 | cell transport, microtubules |
| CDC40 | cell division cycle 40 homolog (S. cerevisiae) | DE | 0.680083 | 1.90E-03 | RNA processing |
| STAG2 | stromal antigen 2 | DE | 0.673891 | 2.17E-03 | M-phase |
| MBD4 | methyl-CpG binding domain protein 4 | DE | 0.636739 | 4.49E-03 | Mismatch repair |
| ANAPC10 | anaphase promoting complex subunit 10 | DE | 0.622291 | 5.82E-03 | M-phase |
| ATF1 | activating transcription factor 1 | DE | 0.587203 | 1.04E-02 | cAMP signaling |
| ZNF385A | zinc finger protein 385A | AS | -0.581011 | 1.15E-02 | unknown (transcription?) |
| NUP54 | nucleoporin 54kDa | DE | 0.560372 | 1.56E-02 | Nuclear pore comples |
| APPL1 | adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 | SNV | -0.547988 | 1.86E-02 | RHO-GTPase signaling |
| NFATC3 | nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 | DE | 0.54386 | 1.96E-02 | Calcium signaling |
| MCL1 | myeloid cell leukemia sequence 1 (BCL2-related) | AS | 0.54386 | 1.96E-02 | Apoptotic regulation |
| RAB10 | RAB10, member RAS oncogene family | DE | 0.539732 | 2.08E-02 | RHO-GTPase signaling |
| VBP1 | von Hippel-Lindau binding protein 1 | SNV | 0.527348 | 2.45E-02 | Protein folding |
| ARFGEF1 | ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited) | SNV | -0.517028 | 2.80E-02 | RHO-GTPase signaling |
| RFX1 | regulatory factor X, 1 (influences HLA class II expression) | DE | 0.517028 | 2.80E-02 | Transcriptional regulation |
| RAP1A | RAP1A, member of RAS oncogene family | DE | 0.508772 | 3.11E-02 | RHO-GTPase signaling |
| RRN3 | RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) | DE | 0.506708 | 3.19E-02 | Transcriptional regulation |
| UPF3B | UPF3 regulator of nonsense transcripts homolog B | SNV | 0.504644 | 3.27E-02 | RNA processing |
| UBE2E1 | ubiquitin-conjugating enzyme E2E 1 | DE | 0.498452 | 3.53E-02 | Protein processing |
| TPR | translocated promoter region | DE | -0.494324 | 3.70E-02 | M-phase |
| LAMB2 | laminin, beta 2 (laminin S) | DE | -0.49226 | 3.80E-02 | Extracellular matrix/adhesion |
| NIF3L1 | NIF3 NGG1 interacting factor 3-like 1 (S. pombe) | SNV | 0.490196 | 3.89E-02 | unknown (transcription?) |
| PRKACA | protein kinase, cAMP-dependent, catalytic, alpha | DE | 0.479876 | 4.39E-02 | cAMP signaling |
| PPP1R2 | protein phosphatase 1, regulatory subunit 2 | DE | 0.477812 | 4.49E-02 | Protein phosphorylation |
| ZNF638 | zinc finger protein 638 | DE | 0.475748 | 4.60E-02 | Transcriptional regulation |
Table 3. Correlation of genes with lapatinib response in breast cancer cell lines.
Linking the model to taxane sensitivity in-vitro.
Several large clinical trials have demonstrated that in the adjuvant setting, the efficacy of HER2-targeted therapy is enhanced by concurrent treatment with taxanes [34]. We therefore asked whether our HER2 transcriptome model might identify potential mechanistic links between HER2 signaling and response to therapies that target processes that are involved in maintenance of the cytoskeletal architecture (e.g., tubulin, the target of taxanes). Thus we used our landscape model genes to interrogate gene expression (Affymetrix arrays) and paclitaxel sensitivity (EC50) for breast cancer cell lines from the Cell Line Encyclopedia dataset. Rank order correlation identified 17 genes that correlated with p<0.05, as shown in Table 4. Four of these genes (RAB11B, IQGAP1, TAGAP, and PLEKHG2) are involved in RHO-family GTPase signaling and therefore potentially involved in remodeling of the cytoskeleton. Four other genes are also involved in regulation of the cytoskeleton: CCT6A is a chaperon involved in tubulin folding, whereas SON is involved in tubulin splicing; KDELR1 is involved in vesicular transport, a process that is linked to the tubulin cytoskeleton; and KIFIP3 is involved in cytokinesis, which likewise depends on cytoskeletal architecture. We found that eight-seventeenths of the HER2-associated genes that correlate with paclitaxel sensitivity are also involved in regulating the dynamics of the cytoskeleton. The data suggest that a subset of HER2-associated genomic features may contribute to the well-known therapeutic efficacy of combining therapies that simultaneously target growth factor signaling (trastuzumab) and cytoskeletal processes (paclitaxel). We used Monte Carlo simulation to evaluate the possibility that the associations which we described might arise at random. Initially, we noted that six-seventeenths of the genes that correlated with paclitaxel sensitivity were identified (by GO terms) as being involved in signal transduction (GO:0007165). We ran 1000 simulations using 244 genes selected at random from the dataset and determined that the likelihood that any six genes would correlate with paclitaxel sensitivity and also map to a single broad biological process was <0.001. Based on this observation, we conclude that the observation that 8/17 genes have known functions related to cytoskeletal dynamics is very unlikely to be due to random association.
| ID | Gene Description | Degree | Type | r(Spe-arman) | p-value | Function |
|---|---|---|---|---|---|---|
| CCT6A | chaperonin containing subunit 6A | 3 | SNV | -0.60 | 5.31E-03 | tubulin folding |
| ATN1 | atrophin 1 | 2 | DE | 0.59 | 6.07E-03 | transcriptional co-regulator |
| STRN4 | striatin, calmodulin binding protein 4 | 2 | DE | 0.54 | 1.34E-02 | caclium signaling |
| RAB11B | RAB11B, RAS oncogene family | 2 | DE | 0.52 | 1.79E-02 | RHO-GTPase signaling and endosomal trafficking |
| NR2F2 | nuclear receptor subfamily 2, group F, member 2 | 4 | AS | 0.51 | 2.12E-02 | nuclear receptor activated by retinoids |
| TOPORS | topoisomerase I binding, arginine/serine-rich | 1 | DE | 0.51 | 2.26E-02 | ubiquitin ligase regulates TP53 turnover |
| IQGAP1 | IQ motif containing GTPase activating protein 1 | 2 | SNV | 0.51 | 2.31E-02 | RHO-GAP associated with cytoskeletal reorganization |
| TGFBR1 | transforming growth factor,betareceptor1 | 10 | DE | -0.50 | 2.61E-02 | TGF-beta signal transduction |
| CASP3 | caspase 3, apoptosis-related cysteine peptidase | 10 | DE | -0.50 | 2.61E-02 | apoptotic signaling |
| KIFAP3 | kinesin-associated protein 3 | 2 | DE,AS | 0.49 | 2.88E-02 | cytokinesis |
| SF3A2 | splicing factor 3a, subunit 2, 66kDa | 9 | DE | 0.49 | 2.99E-02 | RNA splicing |
| MAP3K10 | mitogen-activated protein kinase kinase kinase 10 | 2 | DE | 0.47 | 3.49E-02 | activates JNK signaling |
| TAGAP | T-cell activation RhoGTPase activating protein | 1 | SNV | 0.46 | 4.20E-02 | RHO-GTPase signaling |
| SON | SON DNA binding protein | 1 | SNV | -0.45 | 4.43E-02 | RNA splicing, tubulin |
| KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | 2 | DE | 0.45 | 4.43E-02 | vesicular transport |
| SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | 6 | DE | -0.45 | 4.51E-02 | chromatin remodeling, ER signaling |
| PLEKHG2 | pleckstrin homology domain containing, family G member 2 | 1 | DE | 0.45 | 4.84E-02 | RHO-GTPase signaling |
Table 4. Correlation of genes with paclitaxel response in breast cancer cell lines.
Linking the model to adjuvant trastuzumab therapy in patients.
The ultimate goal of integrated genomic analysis of this sort is to create a model that has predictive value for clinical management of cancer patients. We took advantage of a recently-developed set of genomic data derived from the NCCTG N9831 clinical trial, in which DASL microarray technology was used to quantify mRNA abundance in 488 patients with HER2-positive tumors treated concurrently with trastuzumab (Herceptin®) plus paclitaxel in the adjuvant setting [12]. A manuscript describing the analysis of the N9831 data (Perez et al. “Genomic analysis reveals that immune function genes are strongly linked to clinical outcome in the NCCTG (Alliance) N9831 adjuvant trastuzumab trial”) is currently under review. Geneset Analysis [32] was used to determine if any of the modules described in the HER2 interactome map correlated with risk of recurrence (using time to event as a continuous variable). As shown in Table 5, module 2 (integrin signaling) was highly associated with risk of relapse (p=0.003, FDR=0.04). There was a tendency for module 8 (RHO-GTPase signaling, p=0.07) and module 12 (TGF-beta signaling, p=0.06) to correlate with relapse.
| Arm C | |||||
|---|---|---|---|---|---|
| Gene_set_name | Pathway | Score | p-value | FDR | pos.neg.vector |
| HER2.network.01 | Aurora A signaling(N) | -0.1 | 0.1756 | 0.571 | negative |
| HER2.network.02 | Integrin signalling pathway(P) | -0.555 | 0.0032 | 0.042 | negative |
| HER2.network.03 | Phosphatidy-linositol signaling system(K) | 0.0859 | 0.2798 | 0.548 | positive |
| HER2.network.04 | Transport of Mature Transcript to Cytoplasm(R) | 0.0316 | 0.4296 | 0.621 | positive |
| HER2.network.05 | Signalling by NGF(R) | 0.2084 | 0.1126 | 0.366 | positive |
| HER2.network.06 | FOXA1 transcription factor network(N) | 0.0936 | 0.2948 | 0.548 | positive |
| HER2.network.07 | Ubiquitin mediated proteolysis(K) | 0.3351 | 0.0344 | 0.366 | positive |
| HER2.network.08 | Signaling by Rho GTPases(R) | -0.486 | 0.0739 | 0.48 | negative |
| HER2.network.09 | G2/M Transition(R) | 0.1197 | 0.3491 | 0.567 | positive |
| HER2.network.10 | M Phase(R) | -0.266 | 0.1583 | 0.571 | negative |
| HER2.network.11 | Insulin Synthesis and Secretion(R) | 0.2276 | 0.2188 | 0.548 | positive |
| HER2.network.12 | TGF-beta receptor signaling | 0.512 | 0.0611 | 0.366 | positive |
| HER2.network.all | 0.0936 | 0.366 | positive |
Table 5. Gene set analysis of 12 sub-network genes with N9831 clinical trial data.
Discussion
The studies described in this report were motivated by two central hypotheses. The first of these was that we could integrate multiple genomic features from RNA-Seq data to model the genomic architecture of a test set of HER2-positive tumors. The second hypothesis was that this model would make relevant biological predictions about HER2-positive tumors from other sample cohorts. We have identified over 1000 genes that potentially manifest differential activity in the test set of HER2-positive tumors, either at the level of expression (mRNA abundance) or nucleotide sequence (alternative splicing or eSNV). These genomic features are organized into distinct functional processes that appear to be critical to establishment and maintenance of the HER2-positive phenotype in our test set of tumors. The generality of our model is substantiated by the observation that many of the functional processes defined by this model are also enriched in HER2-postive tumors from TCGA. The predictive potential of the model is evidenced by the link between the functional process identified in the test set and both cellular and clinical properties of HER2-positive cells and tumors. This report represents, to our knowledge, the first attempt to use RNA-Seq data to develop a functional interactome map that integrates multiple genomic features in HER2-positive breast tumors. Having said that, it must be emphasized that this is a “first draft” model, built using a survey panel of tumors. Development of a more comprehensive model will require analysis of a much larger panel of tumors, and this effort is currently ongoing.
From the standpoint of tumor biology, the interactome model that we have developed makes several novel and testable predictions about the processes that underlie the HER2 phenotype. Most obvious of these is the potential role of integrin signaling, which has not been previously evaluated in depth in cells derived from HER2-positive tumors. The implications of RHO-family GTPase signaling and processes linked to the cytoskeleton (e.g. M-phase progression) are equally provocative. A key question, which cannot be easily answered from a systems biology model of the sort that we have developed, is whether these processes are activated or repressed in HER2-positive tumor cells. The network predicts that these processes are important, but directionality must be assessed in vitro.
We used two independent approaches to test the hypothesis that these HER2-associated genomic features and processes are informative of the manner in which HER2-positive tumors or breast cancer cells respond to therapy. Initially, we utilized the Cell Line Encyclopedia dataset, which contains gene expression and drug sensitivity data for a panel of established breast cancer cells. We initially looked for genes from our interactome map that correlated with lapatinib sensitivity in vitro. We appreciate that there are significant limitations to this approach including the facts that lapatinib is not uniquely a HER2 inhibitor, the cell lines that we interrogated were not primarily derived from HER2-positive tumors, and the data that were available for those cells was limited to mRNA abundance. However, lacking a comprehensive set of data on trastuzumab sensitivity in vitro, we asked if any of the genomic features that were identified using HER2-positive tumors correlated with inhibition of cell proliferation by lapatinib in vitro. We identified 26 genes including integrin linked kinase (ILK). A number of genes linked to RHO-family GTPase and M-phase progression were also identified, consistent with our hypothesis that HER2-positive tumors manifest processes that impinge on organization and function of the subcellular architecture.
The standard of care for HER2-positive tumors involves combined HER2-targeted and microtubule-targeted therapy with taxanes. We therefore interrogated the Cell Line Encyclopedia data to test the hypothesis that HER2-positive tumors manifest unique features that are associated with sensitivity to taxanes (paclitaxel). We identified 17 HER2-associated genes that correlate with taxane sensitivity, including a number of genes that are linked to functions related to the subcellular architecture (RHO-family GTPase signaling and microtubule dynamics).
Overall, the data from cell lines are consistent with our hypothesis that the HER2-positive tumor interactome map identifies features and processes that predict the biological properties of HER2-positive tumor cells, as assessed by response to lapatinib and paclitaxel in vitro. However, the critical test of the hypothesis is inherent in the extent to which the processes that we have identified are informative of therapeutic response in the clinic. To test this hypothesis, we used gene set analysis to determine if any of the 12 modules from the interactome map was associated with risk of relapse in the N9831 clinical trials specimens. Integrin signaling was associated with risk of relapse with a very high degree of statistical significance. RHO-family GTPase signaling and TGF-beta signaling exhibited a trend towards association with relapse-free survival in the N9831 samples. Extension of our findings to a larger dataset (TCGA) emphasizes the potential significance of integrin signaling, ubiquitin-mediated proteolysis, and TGF-beta receptor signaling in HER2-positive breast cancer, and suggests that processes linked to M-phase may also be of particular importance in this breast cancer subtype.
In conclusion, we have shown that there are functional genomic process that are consistently associated with HER2-positive tumors, that these processes can be elucidated by an integrated analysis of multiple genomic features, and that some of these processes appear to predict both biological and clinical properties of HER2 tumor cells and HER2-positive tumors. The most striking evidence of this assertion is, perhaps, the identification of a strong and previously unappreciated link between integrin signaling and response to HER2-targeted therapy. Our data suggest that surrogate markers of integrin signaling (e.g. ILK) may be useful as predictors of therapeutic efficacy. Two significant challenges inform our future directions. The most obvious of these challenges is to refine the HER2-positive tumor transcriptome landscape model using a larger cohort of samples for which mRNA abundance, alternative splicing, and eSNVs can be interrogated. The second challenge is to dissect the functionally significant modules within this model and identify new therapeutic targets that can be developed for treatment of patients who have failed HER2-targeted therapy. Achievement of this aim will obviously require analysis of pre-clinical models, and studies to this end are currently underway.
Supporting Information
Figure S1.
Normalization plots. Before and after normalization plots of gene expression counts for samples.
https://doi.org/10.1371/journal.pone.0079298.s001
(TIF)
Figure S2.
Enrichment of differentially expressed genes in TCGA. DTK was used to calculate p-values for differential expression, within TCGA samples, of genes that had been identified as differentially expressed in HER2+ tumors from the initial analysis. The frequency distribution of p-values for all genes in each of the subtypes is shown.
https://doi.org/10.1371/journal.pone.0079298.s002
(TIFF)
Table S1.
Sample characteristics. Clinical/pathological characteristics of these tumors sequenced.
https://doi.org/10.1371/journal.pone.0079298.s003
(XLSX)
Table S2.
Alignment statistics. Summary of alignment statistics for 8 ER+, 8 TN, 8 HER2 and 8 benign breast lesion samples.
https://doi.org/10.1371/journal.pone.0079298.s004
(XLSX)
Table S3.
Differentially expressed genes. List of 685 genes that are differentially expressed in HER2-positive tumor samples compared to other groups with a p-value <0.05.
https://doi.org/10.1371/journal.pone.0079298.s005
(XLSX)
Table S4.
List of splicing variants. List of 199 transcripts that are alternately spliced in HER2-positive tumors compared to other groups.
https://doi.org/10.1371/journal.pone.0079298.s006
(XLSX)
Table S5.
The eSNVs in HER2-positive tumors. List of 318 expressed SNVs (eSNvs) that are expressed in HER2 tumors compared to other tumor subtypes.
https://doi.org/10.1371/journal.pone.0079298.s007
(XLSX)
Table S6.
Genes associated with eSNVs in HER2-positive tumors. List of 303 genes corresponding to 318 eSNVs in HER2-positive tumors.
https://doi.org/10.1371/journal.pone.0079298.s008
(XLSX)
Table S7.
Summary of eSNVs. Summary of eSNVs per sample and per breast tumor subtype.
https://doi.org/10.1371/journal.pone.0079298.s009
(XLSX)
Table S8.
Summary of Sanger sequencing validation results. Sanger sequencing details of 83 high confident eSNVs nominated in a HER2-positive tumor sample (BTC40) for validation.
https://doi.org/10.1371/journal.pone.0079298.s010
(XLSX)
Table S9.
List of eSNvs in HER2-positive tumors. List of low and high confidence eSNVs that were detected in HER2-positive tumors.
https://doi.org/10.1371/journal.pone.0079298.s011
(XLSX)
Table S10.
Investigation of eSNVs genes with TCGA exome sequencing and copy number data. Summary of somatic SNVs and CNVs from TCGA exome sequening data in 25 genes with stop gain or nonsynonymous SNVs from our survey panel.
https://doi.org/10.1371/journal.pone.0079298.s012
(XLSX)
Table S11.
Transcriptome landscape statistics. Network statistics of nodes or genes with at least 5 more connections in the HER2 integrated network.
https://doi.org/10.1371/journal.pone.0079298.s013
(XLSX)
Acknowledgments
We wish to express our particular thanks to Mr. Bruce Eckloff of the Mayo Genomics Facility, who carried out all of the sequencing described in this manuscript. Infrastructure and analytical support were provided by the Mayo Clinic Bioinformatics Core.
Author Contributions
Conceived and designed the experiments: KRK BMN XT ML JEEP ZS DCR RWJ HC YWA EAT EAP. Performed the experiments: KRK BMN XT ML SKA SB JMC TRB HC JMK. Analyzed the data: KRK BMN JEEP SKA PB HC YWA EAT EAP KJT. Contributed reagents/materials/analysis tools: SAM SC DR. Wrote the manuscript: KRK BMN EAT EAP.
References
- 1. Owens MA, Horten BC, Da Silva MM (2004) HER2 amplification ratios by fluorescence in situ hybridization and correlation with immunohistochemistry in a cohort of 6556 breast cancer tissues. Clin Breast Cancer 5: 63-69. doi:https://doi.org/10.3816/CBC.2004.n.011. PubMed: 15140287.
- 2. Sjögren S, Inganäs M, Lindgren A, Holmberg L, Bergh J (1998) Prognostic and predictive value of c-erbB-2 overexpression in primary breast cancer, alone and in combination with other prognostic markers. J Clin Oncol 16: 462-469. PubMed: 9469329.
- 3. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A et al. (1987) Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235: 177-182. doi:https://doi.org/10.1126/science.3798106. PubMed: 3798106.
- 4. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG et al. (1989) Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 244: 707-712. doi:https://doi.org/10.1126/science.2470152. PubMed: 2470152.
- 5. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S et al. (1999) Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17: 2639-2648. PubMed: 10561337.
- 6. Romond EH, Perez EA, Bryant J, Suman VJ, Geyer CE Jr. et al. (2005) Trastuzumab plus adjuvant chemotherapy for operable HER2-positive breast cancer. N Engl J Med 353: 1673-1684. doi:https://doi.org/10.1056/NEJMoa052122. PubMed: 16236738.
- 7. Marty M, Cognetti F, Maraninchi D, Snyder R, Mauriac L et al. (2005) Randomized phase II trial of the efficacy and safety of trastuzumab combined with docetaxel in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer administered as first-line treatment: the M77001 study group. J Clin Oncol 23: 4265-4274. doi:https://doi.org/10.1200/JCO.2005.04.173. PubMed: 15911866.
- 8. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V et al. (2001) Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344: 783-792. doi:https://doi.org/10.1056/NEJM200103153441101. PubMed: 11248153.
- 9. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN et al. (2002) Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2-overexpressing metastatic breast cancer. J Clin Oncol 20: 719-726. doi:https://doi.org/10.1200/JCO.20.3.719. PubMed: 11821453.
- 10. von Minckwitz G, du Bois A, Schmidt M, Maass N, Cufer T et al. (2009) Trastuzumab beyond progression in human epidermal growth factor receptor 2-positive advanced breast cancer: a german breast group 26/breast international group 03-05 study. J Clin Oncol 27: 1999-2006. doi:https://doi.org/10.1200/JCO.2008.19.6618. PubMed: 19289619.
- 11. Perez EA, Dueck AC, McCullough AE, Reinholz MM, Tenner KS et al. (2012) Predictability of adjuvant trastuzumab benefit in N9831 patients using the ASCO/CAP HER2-positivity criteria. J Natl Cancer Inst 104: 159-162. doi:https://doi.org/10.1093/jnci/djr490. PubMed: 22138096.
- 12. Perez EA, Eckel-Passow JE, Ballman KV, Anderson KE, Kalari KR et al. (2012) Predictive genomic markers to chemotherapy and adjuvant trastuzumab via whole genome expression DASL profiling in the N9831 adjuvant study. Cancer Res 72(24_suppl): 145s.
- 13. Perez EA, Romond EH, Suman VJ, Jeong JH, Davidson NE et al. (2011) Four-year follow-up of trastuzumab plus adjuvant chemotherapy for operable human epidermal growth factor receptor 2-positive breast cancer: joint analysis of data from NCCTG N9831 and NSABP B-31. J Clin Oncol 29: 3366-3373. doi:https://doi.org/10.1200/JCO.2011.35.0868. PubMed: 21768458.
- 14. Curtis C, Shah SP, Chin SF, Turashvili G, Rueda OM et al. (2012) The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 486: 346-352. PubMed: 22522925.
- 15. Cancer Genome Atlas Network (2012) Comprehensive molecular portraits of human breast tumours. Nature 490: 61-70. doi:https://doi.org/10.1038/nature11412. PubMed: 23000897.
- 16. Menon R, Omenn GS (2010) Proteomic characterization of novel alternative splice variant proteins in human epidermal growth factor receptor 2/neu-induced breast cancers. Cancer Res 70: 3440-3449. doi:https://doi.org/10.1158/1538-7445.AM10-3440. PubMed: 20388783.
- 17. Eswaran J, Horvath A, Godbole S, Reddy SD, Mudvari P et al. (2013) RNA sequencing of cancer reveals novel splicing alterations. Sci Rep 3: 1689. PubMed: 23604310.
- 18. Lapuk A, Marr H, Jakkula L, Pedro H, Bhattacharya S et al. (2010) Exon-level microarray analyses identify alternative splicing programs in breast cancer. Mol Cancer Res 8: 961-974. doi:https://doi.org/10.1158/1541-7786.MCR-09-0528. PubMed: 20605923.
- 19. Asmann YW, Necela BM, Kalari KR, Hossain A, Baker TR et al. (2012) Detection of redundant fusion transcripts as biomarkers or disease-specific therapeutic targets in breast cancer. Cancer Res 72: 1921-1928. doi:https://doi.org/10.1158/1538-7445.AM2012-1921. PubMed: 22496456.
- 20. Fujita PA, Rhead B, Zweig AS, Hinrichs AS, Karolchik D et al. (2011) The UCSC Genome Browser database. Update. Nucleic Acids Res 39: D876-882.
- 21. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25: 1754-1760. doi:https://doi.org/10.1093/bioinformatics/btp324. PubMed: 19451168.
- 22. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G et al. (2010) Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28: 511-515. doi:https://doi.org/10.1038/nbt.1621. PubMed: 20436464.
- 23. Wang K, Li M, Hakonarson H (2010) ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 38: e164. doi:https://doi.org/10.1093/nar/gkq603. PubMed: 20601685.
- 24. Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10: R25. doi:https://doi.org/10.1186/gb-2009-10-3-r25. PubMed: 19261174.
- 25. Kalari KR, Rossell D, Necela BM, Asmann YW, Nair A et al. (2012) Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations. Front Oncol 2: 12. PubMed: 22655260.
- 26. Dunnett CW (1980) Pairwise Multiple Comparisons in the Unequal Variance Case. J Am Stat Assoc 75: 796-800. doi:https://doi.org/10.1080/01621459.1980.10477552.
- 27. Goya R, Sun MG, Morin RD, Leung G, Ha G et al. (2010) SNVMix: predicting single nucleotide variants from next-generation sequencing of tumors. Bioinformatics 26: 730-736. doi:https://doi.org/10.1093/bioinformatics/btq040. PubMed: 20130035.
- 28. Smoot ME, Ono K, Ruscheinski J, Wang PL, Ideker T (2011) Cytoscape 2.8: new features for data integration and network visualization. Bioinformatics 27: 431-432. PubMed: 21149340.
- 29. Matthews L, Gopinath G, Gillespie M, Caudy M, Croft D et al. (2009) Reactome knowledgebase of human biological pathways and processes. Nucleic Acids Res 37: D619-D622. PubMed: 18981052.
- 30. Assenov Y, Ramírez F, Schelhorn SE, Lengauer T, Albrecht M (2008) Computing topological parameters of biological networks. Bioinformatics 24: 282-284. PubMed: 18006545.
- 31. Barretina J, Caponigro G, Stransky N, Venkatesan K, Margolin AA et al. (2012) The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 483: 603-607. PubMed: 22460905.
- 32.
Efron B, Tibshirani R (2010) On testing the significance of sets of genes. Gene set analysis R package version 1,03 http://CRANR-projectorg/package=GSA. Acessed 2012, June.
- 33. Perez EAE-P, Ballman KV, Anderson SK, Thompson EA, Asmann YW, Jen J, Dueck AC, Lingle WL, Sledge GW, Winer EP, Gralow J, Jenkins RB, Reinholz MM (2012) Predictive genomic markers to chemotherapy and adjuvant trastuzumab via whole genome expression DASL profiling in the N9831 adjuvant study Cancer Res 72.
- 34. Perez EA, Suman VJ, Davidson NE, Gralow JR, Kaufman PA et al. (2011) Sequential versus concurrent trastuzumab in adjuvant chemotherapy for breast cancer. J Clin Oncol 29: 4491-4497. doi:https://doi.org/10.1200/JCO.2011.36.7045. PubMed: 22042958.