Hospital Setting and Patient Enrollment

Saint Luke’s Hospital and Health Network Internal Review Board (IRB), Bethlehem PA, approved this study protocol, identification number, SLHN 2011-04. Patients were screened for enrollment at a Level 1 community trauma center with a 37-bed Intensive Care Unit (ICU), a 45-bed Emergency Department (ED), and an annual census of 75,000. Adult patients (age 18 or older) in the ED and ICU were eligible for inclusion if they presented with signs and symptoms suggestive of serious bacterial infection and if their clinical evaluation included blood cultures at the discretion of the enrolling physician. Upon determination of eligibility, subjects or their health care proxies were approached to volunteer for participation; written informed consent was obtained prior to enrollment.

Clinical Blood Culture Sample Collection and Subsequent Handling

Upon voluntary written consent enrollment, patients underwent a routine blood culture collection procedure as per hospital protocol. Blood culture protocol typically consists of two sets of blood culture bottles (2 aerobic BD-cat# 442192 and 2 anaerobic BD-cat# 442191) collected using aseptic technique. Blood was collected simultaneously into a third aerobic blood culture bottle which was designated only for parallel BACTEC and ETGA blood culture assay analysis (no analyses from this specimen were used in clinical decision making). Hereafter, the third parallel-collected aerobic culture bottle will be referred to as the ETGA-bottle. All 4 hospital culture bottles were incubated in BD BACTEC^TM automated blood culture system (BD Company, Franklin Lakes, NJ) in the hospital lab. A hospital blood culture was defined as positive using criteria outlined by the Centers for Disease Control [22], and the causative microorganism was subsequently identified according to standard clinical microbiology procedures. The ETGA-bottle was routinely drawn last in the draw sequence, blind coded, stored in a refrigerator, and transported twice-weekly 50 miles to our laboratory for independent BACTEC and ETGA analysis.

BACTEC and ETGA Time Course Analysis of Clinical Blood Cultures

At the initiation of this study, ideal resources were not available for around-the-clock time course ETGA monitoring of the ETGA-bottle within the hospital laboratory. Therefore, the ETGA-bottle was refrigerated prior to being transported to our laboratory for ETGA analysis. Although refrigeration is not recommended by CLISI [23], recent studies have shown that microbial growth is unaffected after limited refrigeration of blood culture samples [24]. After being transported from the hospital, the ETGA-bottle was placed into a BACTEC 9050 incubator. One milliliter aliquots were aseptically removed in a time course manner using a 3 mL syringe (21ga. Needle) and were immediately refrigerated to enable synchronization of the ETGA sample preparation procedure. For BACTEC-positive ETGA-bottles, blood culture time course aliquots were promptly removed from refrigeration holding and 0.75 mL was subjected to the ETGA blood culture assay procedure (described below). One hundred micro-liters from each of the remaining blood culture aliquots (non-processed) were also immediately plated onto blood agar for parallel CFU monitoring. After completion of the ETGA blood culture assay procedure, sample lysates were frozen at -20°C to enable subsequent nucleic acid analysis. For BACTEC-positive ETGA-bottles, microbe identification (derived from the corresponding hospital blood cultures) were retrospectively obtained from the hospitals’ microbiology laboratory.

The ETGA Blood Culture Assay Procedure

The ETGA Blood Culture Assay consists of a differential cell lysis procedure followed by measurement of microbe-derived DNA polymerase extension activity via ETGA. A detailed description of the core ETGA technology and subsequent development of the ETGA Blood Culture Assay have been recently described [20,21]. Briefly, 0.75 mL of blood culture is transferred to a 1.5 mL tube already containing 250 uL of 1% Triton X-100. The sample tube is then capped, inverted four times to mix, and incubated for 5 minutes at room temperature. After spinning at 8000 x g for 3 minutes, the supernatant is poured off into a waste container and the tube is then inverted onto a plastic-backed lab wipe to drain any residual liquid. Using an extended pipette tip, 1 ml of 5 mM NaOH is added and subsequently pipetted up and down ten times to resuspend blood debris. The sample tube is then capped, incubated for 5 minutes at room temperature, and spun at 8000 x g for 3 minutes. The supernatant is poured off into a waste container and the tube is then inverted onto a plastic-backed lab wipe to drain any residual liquid. Next, 0.6 mL of a Tris-based wash buffer is added, pipetted up and down 5 times to resuspend the sample, and simultaneously transferred to pre-labeled bead mill lysis tube. All beadmill lysis tubes are then spun at 8000 x g for 3 minutes. After spinning, supernatants are carefully removed using a 1 mL pipette and DNA polymerase extension activity is assayed as described previously [20,21].

Gene Specific qPCR Assays

The primers and probes for the S. aureus and E. coli-specific assays have been previously reported [20]. The primer and probe sequences for the S. agalactiae and S. epidermidis assays are as follows: S. agalactiae - Forward primer 5’ –TCGCATTTTAGATCCATTTGC- 3’, Reverse primer 5’ –GCTCTATCAGTTGGTTTTAAATCAGG- 3’, Probe 5’ –CAATTAAAGCTCAAG TTAACGATGTAAAGGCA 3’. S. epidermidis - Forward primer 5’ –CAACTCGATGCA AATCAGCAA- 3’, Reverse primer 5’ - GAACCGCATAGCTCCCTGC- 3’, Probe 5’ - TACTACGCTGGTGGAACTTCAAA TCGTTATCG- 3’. The qPCR reactions were prepared as follows: 300nM forward and reverse primers, 100nM hydrolysis probe, 15µL Light Cycler 480 Probes Master (Roche Applied Sciences cat# 04902343001), nuclease free water (Life Technologies, cat# AM9932) to a volume of 26µL, and 4µL of sample. The samples were analyzed on a Cepheid Smart Cycler II (Sunnyvale, CA) using the following protocol: 95°C for 5 minutes, and then 45 cycles of 95° for 15 seconds followed by 60°C for 1 minute. Fluorescence was measured during the 60°C stage of each cycle.

BACTEC Results and Corresponding Microbial ID

In this report, we set out to assess the feasibility of detecting microbes from clinical blood culture samples via selective measurement of their DNA polymerase extension activity using ETGA. A schematic diagram of the proposed experimental approach is presented in Figure 1. Initially, 308 ETGA-bottles were collected and subjected to BACTEC analysis. Of these, 22 yielded positive BACTEC results (Table 1). The microbial ID for each of these 22 samples was obtained retrospectively from the parallel-collected blood culture samples that were analyzed by the hospital laboratory, and are also presented in Table 1. The most prevalent organisms found to be associated with the BACTEC-positive samples were E. coli and Streptococcus sp., followed by Staphylococcus sp. Consistent with previous observations, these species are common among BSI-causing microorganisms [14].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. A schematic overview of the study design is presented.

https://doi.org/10.1371/journal.pone.0078488.g001

Growth Monitoring of Clinical Blood Cultures via the ETGA Blood Culture Assay

As mentioned, the primary goal of this study was to assess the feasibility of using the ETGA blood culture assay to detect the presence and growth of microbes within clinical blood cultures. Towards this goal, ETGA blood culture assay time course analysis was performed for each of the 22 ETGA-bottles that were called positive by the BACTEC instrument. The ETGA assay time course analysis data for these samples were assembled into 5 separate groups and are presented in Figures 2A-E. A horizontal red line was incorporated into each graph, representing a positivity threshold cycle threshold (Ct) value of 35.24 that was previously established from ETGA Blood Culture Assay analysis of blood cultures obtained from healthy donors [21]. Despite being determined previously, the 35.24 threshold Ct marker is included as a visual reference within the time course graphs to help differentiate microbial growth from typical blood culture sample background noise. As shown in Figures 2A-E, the ETGA blood culture assay sensitively detected the presence and growth of microbes within all 22 of the ETGA-bottles. The ETGA Ct values and parallel CFU plating data for these samples also correlate well with one another (Tables S2-S6). Of note, the growth curve derived from sample ZSL-229 dipped below the positivity threshold at the 6 hour time point (Figure 2C). This atypical growth curve behavior correlates well with the CFU fluctuation and/or mixed microbial population observed from parallel plating analysis of sample aliquots taken from the corresponding ETGA-bottle (Figure S1).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. ETGA time course monitoring of clinical blood cultures.

(A-E) BACTEC-positive ETGA-bottles that underwent time course monitoring were separated into 5 groups and linear plots were generated using their respective ETGA Blood Culture Assay Ct values versus the time each culture bottle spent within the BACTEC instrument. A horizontal red line, representing a previously determined ETGA blood culture assay positivity threshold, is also included in each plot as a visual reference. The sample ID numbers are also included to the right of the curves in each graph and can be used to locate the corresponding microbial ID and BACTED TTD values using Table 1. (F) Linear plots are also presented from ETGA time course analysis of 15 BACTEC-negative ETGA-bottles.

https://doi.org/10.1371/journal.pone.0078488.g002

Taken together, these preliminary time course studies suggest that the ETGA blood culture assay has potential to reduce the Time-to-Detection (TTD) of microbes from clinical samples, when compared to standard BACTEC analysis (Table S1). In fact, ETGA detected 100% (4 of 4) of the samples containing S. aureus at time zero (Figure 2B). Also, considering the range of bacterial species present (Table 1), these data support the potential universality of detecting microbes from clinical samples via the highly conserved biochemical activity of DNA polymerase extension. Furthermore, when considering these clinical samples and previously published data obtained during assay development studies [20,21], ETGA has detected without fail more than 30 different microbial species.

In addition to the 22 positive samples, time course aliquots from 15 BACTEC-negative ETGA-bottles were subjected to ETGA blood culture assay time course analysis. As shown in Figure 2F, all of the ETGA blood culture assay signals derived from the 15 negative clinical samples remained below the positivity Ct threshold, and are thus consistent with the previously determined healthy donor threshold [21]. Therefore, these results demonstrate that the growth curves presented in Figures 2A-E are specific for microbial growth and not reflective of artifactual changes in assay background signal due to the time that these negative blood cultures spent in refrigeration and/or in the BACTEC incubator. For more accurate clinical diagnostic positivity/negativity and ETGA TTD determinations, a rigorous threshold value will need to be determined statistically using ETGA assay signals derived from a larger number of negative clinical blood culture samples that had not been subjected to atypical handling such as refrigeration.

Nucleic Acid-Based Microbial Identification from ETGA Lysates

In addition to DNA polymerase activity, we previously demonstrated that ETGA lysates from simulated BSI also contain microbe-derived nucleic acid, and thus are readily available for subsequent microbial identification via rapid NAT such as qPCR [21]. To determine the feasibility of parallel NAT analysis of clinical blood cultures, we retrospectively interrogated the ETGA lysates (generated from 13 of the 22 BACTEC-positive ETGA-bottles) for the genomic DNA of S. aureus, E. coli, S. epidermidis, and S. agalactiae, based upon availability of the corresponding in-house gene specific qPCR (gsPCR) assays. The gsPCR ID results presented in Table 2 agree with the Hospital microbiology laboratory’s independent ID, and demonstrate that the ETGA blood culture assay procedure produced lysates from clinical samples that are suitable for rapid parallel nucleic acid-based species identification.