Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Insights into the Prostanoid Pathway in the Ovary Development of the Penaeid Shrimp Penaeus monodon

  • Wananit Wimuttisuk ,

    ** E-mail: wananit.wim@biotec.or.th

    Affiliation National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Khlong Luang, Pathum Thani, Thailand

    ⨯
  • Punsa Tobwor,

    Affiliation National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Khlong Luang, Pathum Thani, Thailand

    ⨯
  • Pacharawan Deenarn,

    Affiliation National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Khlong Luang, Pathum Thani, Thailand

    ⨯
  • Kannawat Danwisetkanjana,

    Affiliation National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Khlong Luang, Pathum Thani, Thailand

    ⨯
  • Decha Pinkaew,

    Affiliation National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Khlong Luang, Pathum Thani, Thailand

    ⨯
  • Kanyawim Kirtikara,

    Affiliation National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Khlong Luang, Pathum Thani, Thailand

    ⨯
  • Vanicha Vichai

    Affiliation National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency, Khlong Luang, Pathum Thani, Thailand

    ⨯

Abstract

The prostanoid pathway converts polyunsaturated fatty acids (PUFAs) into bioactive lipid mediators, including prostaglandins, thromboxanes and prostacyclins, all of which play vital roles in the immune and reproductive systems in most animal phyla. In crustaceans, PUFAs and prostaglandins have been detected and often associated with female reproductive maturation. However, the presence of prostanoid biosynthesis genes remained in question in these species. In this study, we outlined the prostanoid pathway in the black tiger shrimp Penaeus monodon based on the amplification of nine prostanoid biosynthesis genes: cytosolic phospholipase A2, hematopoietic prostaglandin D synthase, glutathione-dependent prostaglandin D synthase, prostaglandin E synthase 1, prostaglandin E synthase 2, prostaglandin E synthase 3, prostaglandin F synthase, thromboxane A synthase and cyclooxygenase. TBLASTX analysis confirmed the identities of these genes with 51-99% sequence identities to their closest homologs. In addition, prostaglandin F2α (PGF2α), which is a product of the prostaglandin F synthase enzyme, was detected for the first time in P. monodon ovaries along with the previously identified PUFAs and prostaglandin E2 (PGE2) using RP-HPLC and mass-spectrometry. The prostaglandin synthase activity was also observed in shrimp ovary homogenates using in vitro activity assay. When prostaglandin biosynthesis was examined in different stages of shrimp ovaries, we found that the amounts of prostaglandin F synthase gene transcripts and PGF2α decreased as the ovaries matured. These findings not only indicate the presence of a functional prostanoid pathway in penaeid shrimp, but also suggest a possible role of the PGF2α biosynthesis in shrimp ovarian development.

Citation: Wimuttisuk W, Tobwor P, Deenarn P, Danwisetkanjana K, Pinkaew D, Kirtikara K, et al. (2013) Insights into the Prostanoid Pathway in the Ovary Development of the Penaeid Shrimp Penaeus monodon. PLoS ONE 8(10): e76934. https://doi.org/10.1371/journal.pone.0076934

Editor: Tamas Zakar, John Hunter Hospital, Australia

Received: May 11, 2013; Accepted: September 5, 2013; Published: October 8, 2013

Copyright: © 2013 Wimuttisuk et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work has been supported by the National Science and Technology Development Agency (Grant number BT-02-SG-BC-5105 and BT-02-SG-BO-5203). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Prostanoids are oxygenated derivatives of C-20 polyunsaturated fatty acids (PUFAs) that play active roles in inflammation, immune response, cardiovascular control and reproduction in most animals [1-3]. These PUFAs, which serve as precursors of the prostanoid pathway, include arachidonic acid (AA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). The prostanoid pathway begins with the enzyme phospholipase A2, which releases AA from the phospholipids of cellular and intracellular membranes [3]. The released AA is then cyclized and subsequently reduced by the cyclooxygenase (COX) enzyme to form prostaglandin G2 (PGG2) and prostaglandin H2 (PGH2), respectively [4,5]. Downstream enzymes, including prostaglandin and thromboxane synthases, later convert PGH2 to prostanoids, such as prostaglandins, prostacyclins and thromboxanes, which serve as signaling molecules in various physiological responses [3,6].

The presence of PUFAs and prostaglandins in crustaceans has long been the focus of aquaculture research. All three prostanoid precursors (AA, EPA and DHA) have been identified in the Chinese prawn Penaeus chinensis [7], the Pacific white shrimp Litopenaeus vannamei [8], the green tiger prawn Penaeus semisulcatus [9], the kuruma prawn Marsupenaeus japonicus [10,11], the banana shrimp Penaeus merguiensis [12] and Penaeus monodon [13,14]. In addition, EPA has been identified in the common littoral crab Carcinus maenas [15] and the Atlantic blue crab Callinectes sapidus [16], while DHA has been detected in the crayfish Procambarus clarkii [17]. On the other hand, prostaglandin E2 (PGE2) and prostaglandin F2α (PGF2α) have been identified in M. japonicus [10] and the Florida crayfish Procambarus paeninsulanus [18,19]. Prostaglandin D2 (PGD2), PGE2 and PGF2α have been detected in the fresh water field crab Oziotelphusa senex senex [20], while PGE2, thromboxane B2 (TXB2) and 6-keto-PGF1α have been reported in C. maenas [15]. In addition, PGE2 has been identified in hemolymph, muscle and ovary of domesticated P. monodon [21], but the presence of PGF2α has not been reported in this species.

In crustaceans, one of the more prominent roles of prostanoids is the regulation of female reproductive maturation. For instance, the production of PGE2 and PGF2α is positively correlated with ovarian maturation in P. paeninsulanus [18] and O. senex senex [20]. Furthermore, injection of PGE2 and PGF2α into ovaries of O. senex senex significantly increased the number and the diameter of the oocytes in a dose-dependent manner [20]. In domesticated P. monodon, the amounts of PGE2 in ovaries and haemolymph increased along with developing ovary stages [21]. However, the correlation between prostaglandins and crustacean ovary development may be species specific, as the amounts of PGE2 and PGF2α were highest in ovaries stage I and continued to decrease until stage IV in M. japonicus [10]. Nevertheless, these findings suggest a possible involvement of the prostanoid biosynthesis in crustacean female reproductive system.

Although the production of prostanoids and their precursors is well-established in most crustaceans, prostanoid biosynthesis genes in these species are poorly characterized. Thus far, the only crustacean with a fully constructed prostanoid pathway is the fresh water flea Daphnia pulex, whose annotated genome sequence revealed nine prostanoid biosynthesis genes: cytosolic phospholipase A2 (cPLA2), COX, prostaglandin D2 synthase A, prostaglandin D2 synthase B, prostaglandin E2 synthase (PGES), carbonyl reductase 1, thromboxane A and thromboxane B, and two prostanoid receptors prostanoid receptor EP4 isoform A and B [22]. In marine crustaceans, COX genes have been identified in Gammarus spp. and Caprella spp. [23], while PGES genes have been characterized in L. vannamei [24], the American lobster Homarus americanus (Accession: MGID155886 from the Marine Genomic Project) [24] and the sea lice Lepeophtheirus salmonis and Caligus rogercresseyi [25].

Due to the roles of prostanoids in the reproductive system in most crustaceans, the characterization of the prostanoid pathway in economically valuable organisms, such as penaeid shrimp, is essential for both scientific gain and potential applications in aquaculture practice. In this study, we propose a scheme for the P. monodon prostanoid pathway based on the identification of eight P. monodon prostanoid biosynthesis genes, the detection of lipid precursors and prostaglandins, and the detection of prostaglandin synthase activity. The correlations observed among gene transcription, prostaglandin production, and ovarian maturation also suggest that prostaglandin biosynthesis may be involved in the regulation of the P. monodon female reproductive system.

Results

Identification of P. monodon prostanoid biosynthesis genes

Based on available EST sequences from The Black Tiger Shrimp EST Project [26] and the Marine Genomics Project [24], short fragments of P. monodon prostanoid biosynthesis genes were amplified from shrimp ovary cDNA. RACE-PCR was used to obtain full-length gene sequences, resulting in the identification of nine putative P. monodon prostanoid biosynthesis genes: cytosolic phospholipase A2 (PmcPLA2), hematopoietic prostaglandin D synthase (PmhPGDS), glutathione-dependent prostaglandin D synthase (PmgPGDS), prostaglandin E synthase 1 (PmPGES1), prostaglandin E synthase 2 (PmPGES2), prostaglandin E synthase 3 (PmPGES3), prostaglandin F synthase (PmPGFS), thromboxane A synthase (PmTBXAS), and cyclooxygenase (PmCOX). These gene sequences were then analyzed by TBLASTX, revealing 51-99% sequence identities of the predicted P. monodon enzymes when compared with their closest homologs (Table 1).

GenesPm accession #  AAMatched accession # (Reference species)Identity  E-value
cPLA2JN003878998NM_001081843 (Equus caballus)60%2e-180
hPGDSJN003879203HM231278 (Eriocheir sinensis)99%5e-37
gPGDSJN003880153XM_003694283 (Apis florea)79%4e-23
PGES3JN003881164JF806619 (Litopenaeus vannamei)51%2e-108
PGES1JN003882145JQ917473 (Nilaparvata lugens)76%7e-35
PGES2JN003883338XM_003706983 (Megachile rotundata)89%4e-108
PGFSJN003884317JX513906 (Reticulitermes flavipes)98%3e-67
TBXASJN003885533XM_004069858 (Oryzias latipes)60%8e-62
COXKF501342614GQ180796 (Gammarus sp.)91%0.0

Table 1. TBLASTX analyses of P. monodon prostanoid biosynthesis genes.

CSV
Download CSV

Analysis of conserved residues and domains in PmPGES1, PmPGES2, PmPGES3 and PmPGFS genes

The putative P. monodon prostanoid biosynthesis genes were submitted to the Conserved Domain Architecture Retrieval Tool (CDART) for protein domain prediction, revealing that the P. monodon proteins contain the same domain types and positions as the prostanoid enzymes found in other species (Figure S1). At this point, PmPGES and PmPGFS were examined in more details, as these genes are likely to be responsible for the biosynthesis of PGE2 and PGF2α, which has been shown to affect ovarian development in other crustaceans [10,18,20].

In P. monodon, three isoforms of PmPGES have been cloned and characterized, namely PmPGES1, PmPGES2 and PmPGES3, which have corresponding isoforms in mammals. PGES1 or membrane-associated prostaglandin E synthase 1 is a member of the Membrane-Associated Protein involved in Eicosanoid and Glutathione metabolism (MAPEG) [27,28]. PGES1 requires glutathione for its enzymatic function, which involves converting PGH2 to PGE2 [27]. Multiple sequence alignment of PmPGES1 revealed the conservation of most catalytic residues. For example, D47, which is highly conserved in the PGES1 subgroup of MAPEG, was found in PmPGES1 (Figure 1, star) [29]. In addition, key catalytic residues that interact with PGH2 (R108 and T112 - Figure 1, white arrow heads) as well as glutathione (R36, N72, E75, H111, Y115 and R122 - Figure 1, black arrows) were conserved in PmPGES1 [29-31]. Lastly, PmPGES1 also contains the consensus sequence64ERXXXAXXNXX75 E required for oxygenation product formation (Figure 1, underlined) [31], confirming that PmPGES1 possesses all the necessary residues for its enzymatic function.

thumbnail
Download:
Figure 1. Mapping of essential residues in the predicted P. monodon PGES1 enzyme.

Multiple sequence alignments of P. monodon PGES1 and their homologs showed a conserved residue for the MAPEG family (white star), catalytic residues that interact with PGH2 (white arrow head), essential residues for H-bonding to GSH (black arrows) and consensus sequence required for oxygenation product (underline). Genus and species used in this alignment are abbreviated as followed: Penaeus − P. monodon, Litopenaeus − L. vannamei, Crassostrea − Crassostrea virginica, Homarus − H. americanus, Pediculus − Pediculus humanus corporis, Culex − Culex quinquefasciatus, Tribolium − Tribolium castaneum, Equus − Equus caballus, Bos − Bos taurus and Homo − Homo sapiens.

https://doi.org/10.1371/journal.pone.0076934.g001

PGES2 or membrane-associated prostaglandin E synthase 2 is a Golgi membrane-associated pre-protein that requires spontaneous cleavage of the N-terminal hydrophobic domain to become a mature cytosolic enzyme [32,33]. The catalytic domain of PGES2 is a glutathione/thioredoxin-like domain that can be activated by various thiol reducing reagents [34]. Sequence alignment of PmPGES2 revealed a conserved 66C-X-X- 69C (Figure 2, black arrow), which corresponded to110C-X-X-113 C catalytic triad in the human PGES2 active site [35]. A conserved N-terminal hydrophobic domain (Figure 2, underlined) was also identified in PmPGES2, consistent with N-terminal cleavage to generate the mature enzyme.

thumbnail
Download:
Figure 2. Mapping of essential residues in the predicted P. monodon PGES2 enzyme.

Multiple sequence alignments of P. monodon PGES2 protein and their homologs were performed, revealing conserved Cys residues at the active site (black arrows) and the N-terminal sequence of the mature enzyme (underline). Genus and species used in this alignment are abbreviated as followed: Penaeus − P. monodon, Pediculus − P. humanus corporis, Caligus − Caligus rogercresseyi, Mus − Mus musculus and Homo − H. sapiens.

https://doi.org/10.1371/journal.pone.0076934.g002

PGES3 or cytosolic prostaglandin E synthase (cPGES) is a 23 kDa GSH-requiring enzyme that was originally termed p23 based on its initial characterization as a co-chaperone of heat shock protein 90 [28,36]. Unlike the membrane-bound PGES1 and PGES2, PGES3 is a cytosolic, glutathione-requiring enzyme that interacts with casein kinase II (CKII) and Hsp90 [36,37]. In human PGES3, two serine residues (S113 and S118 − Figure 3, arrows) are phosphorylated by CKII to increase PGES3 enzymatic activity. However, only the putative N-terminal phosphorylated serine is conserved in PmPGES3 (Figure 3, black arrow) [37]. CDART prediction of the putative PmPGES3 enzyme revealed the presence of an alpha crystallin-Hsps-p23 like super family domain, which is the same domain found in all PGES3 homologs (Figure S1), further confirming the identity of the PmPGES3 gene.

thumbnail
Download:
Figure 3. Mapping of essential residues in the predicted P. monodon PGES3 enzyme.

Multiple sequence alignments of P. monodon PGES3 protein and their homologs reveal one conserved serine residue for the CKII phosphorylation site (black arrow), while the other phosphorylation site was not conserved (gray arrow). Genus and species used in this alignment are abbreviated as followed: Penaeus − P. monodon, Litopenaeus − L. vannamei, Danio − Danio rerio, Pediculus − P. humanus corporis, Xenopus − Xenopus laevis, Caenorhabditis − Caenorhabditis elegans, Drosophila − Drosophila melanogaster, Gallus − Gallus gallus, Bos − B. taurus and Homo − H. sapiens.

https://doi.org/10.1371/journal.pone.0076934.g003

Lastly, PGFS encodes a bifunctional enzyme in the aldo-keto reductase (AKR) superfamily that converts PGD2 and PGH2 to (5Z,13E)-(15S)-9α,11β,15-trihydroxyprosta-5,13-dien-l-oic acid (9α,11β-PGF2) and PGF2α, respectively [38-40]. CDART analysis revealed that PmPGFS contains the domain in the aldo-keto reductase superfamily (Figure S1), which is characteristic of PGFS enzymes [41]. Multiple sequence alignment also indicated that residues required for substrate binding site (D49, S165, N166, Q189, L218, S270, R275 - Figure 4, black arrows) and NADP+ cofactor binding site (A51, Y54, W85, H116 - Figure 4, white arrow heads) are also conserved in PmPGFS [42].

thumbnail
Download:
Figure 4. Mapping of essential residues in the predicted P. monodon PGFS enzyme.

Multiple sequence alignments of P. monodon PGFS protein and their homologs were performed, revealing residues that are important for substrate (black arrows) and the NADP+ cofactor (white arrow head) binding. Genus and species used in this alignment are abbreviated as followed: Penaeus − P. monodon, Litopenaeus − L. vannamei, Canis − Canis lupus familiaris, Ovis − Ovis aries, Bos − B. taurus, Equus − Equus caballus and Homo − H. sapiens.

https://doi.org/10.1371/journal.pone.0076934.g004

RP-HPLC and mass spectrometry analysis of PUFAs and prostaglandins in shrimp ovaries

Once the prostanoid biosynthesis genes had been identified, chemical analysis was performed to detect the presence of corresponding prostanoids in wild P. monodon. Stage IV shrimp ovaries from five broodstock were pooled, homogenized and subjected to solvent extraction. Subsequent RP-HPLC analysis led to the detection of PGF2α and PGE2 as two small peaks that eluted at 9.26 and 10.03 minutes, respectively (Figure 5A and 5B). The identities of these prostaglandins were later confirmed by mass analysis (Figure 5C and 5D). In addition, three prostanoid precursors EPA, DHA and AA were detected with elution times of 30.08, 31.74 and 32.56 minutes, respectively (Figure S2, A and B). Again, mass spectra confirmed the identities of these PUFAs (Figure S2, C-E). Other prostanoids i.e. 6-keto-PGF1α and PGD2 were not detected in P. monodon extracts from stage I-III shrimp ovaries, hepatopancreases, lymphoid organs or hemolymph.

thumbnail
Download:
Figure 5. HPLC analysis and mass spectra of the prostaglandins in shrimp ovary extract.

Ovaries from 5 wild broodstock were homogenized in HBSS, pooled together and incubated at 28 °C, 200 rpm for 1 h. The homogenate was extracted and analyzed by RP-HPLC and mass spectrometry as described in Materials and Methods. RP-HPLC elution profiles at 200 nm wavelength of commercially available prostaglandin standards (A) and prostaglandins found in ovary homogenate (B). Subsequent mass spectrometry analysis of PG in ovary homogenate yielded mass spectra of PGE2 (C) and PGF2α (D).

https://doi.org/10.1371/journal.pone.0076934.g005

Prostaglandin synthase activity in P. monodon ovarian tissue

The identification of PmPGES and PmPGFS genes and their corresponding products led us to speculate that prostaglandin synthase activity could be present in shrimp ovaries. To test this hypothesis, in vitro prostaglandin synthase activity assay was performed by incubating shrimp ovary homogenates with 25 µM AA at 28 °C, 200 rpm. The samples were subsequently collected at different time points to monitor prostaglandin production. Prior to the treatment, the basal concentration of PGE2 in shrimp ovary homogenates was 9.6 ng/g tissue. After 30 minutes of incubation with AA, the PGE2 concentration increased to 19.6 ng/g tissue and remained at this level before declining after 120 minutes of treatment (Figure 6A). Similarly, the concentration of PGF2α increased from the basal level of 10.9 ng/g tissue to 23.3 ng/g tissue after 60 minutes of incubation with AA and remained at the same level from 60 to 360 minutes after the treatment (Figure 6B). Together, these results suggest that the prostaglandin synthase activity is present in P. monodon ovary homogenates.

thumbnail
Download:
Figure 6. In vitro prostaglandin synthase activity assay using shrimp ovary homogenates.

Shrimp ovary homogenates were incubated with 25 µM AA at 28 °C and collected at different time points (0, 30, 60, 120, 240 and 360 min). The homogenates were spun down and concentrations of PGE2 (A) and PGF2α (B) in the homogenate supernatant were estimated using EIA. The experiment was performed in triplicate and error bars indicate the standard deviation from the means. Asterisk indicates significant difference between the prostaglandin concentration at 0 h and the marked time point (P<0.05).

https://doi.org/10.1371/journal.pone.0076934.g006

Role of prostaglandin biosynthesis in shrimp ovarian development

The correlation between the amounts of prostaglandin and ovarian maturation in P. paeninsulanus [43], M. japonicus [10] and O. senex senex [20] led to the hypothesis that prostaglandins affect female reproductive development in crustaceans. To assess the possible role of prostaglandin biosynthesis in P. monodon ovarian maturation, we estimated the concentrations of PGE2 and PGF2α in different stages of shrimp ovaries. When compared with stage I ovaries, we observed that the PGE2 concentrations were lower in ovaries stage II and III and higher in ovaries stage IV (Figure 7A). On the other hand, the PGF2α concentrations were highest in stage I ovaries and steadily decreased as the ovaries matured (Figure 7B).

thumbnail
Download:
Figure 7. PGE2 and PGF2α concentrations in each ovary stage.

Shrimp ovaries from each stage were pooled together based on the GSI value (N = 3 for each ovary stage) and homogenized. The amounts of (A) PGE2 and (B) PGF2α were determined using enzyme immunoassay. Error bars indicate the standard deviation from the means. These graphs are representatives of two independent experiments that yielded similar results.

https://doi.org/10.1371/journal.pone.0076934.g007

To correlate the mRNA expression levels of prostaglandin biosynthesis genes with different ovarian maturation stages, quantitative real-time PCR analysis was performed on ovaries of 27 wild-caught broodstock from the Andaman Sea (Table 2). Four sets of primers for PmPGES1, PmPGES2, PmPGES3 and PmPGFS genes were used in this study (Table 3). To determine whether the gene was up- or down-regulated at a certain developmental stage, mRNA expression levels were compared with that of stage I ovaries, which was taken as a baseline. It was observed that all three PmPGES isoforms displayed different expression profiles during the development of ovaries. PmPGES1 was up-regulated 16-fold in stage II ovaries, then continued to decrease until it reached baseline in stage IV (Figure 8A). For PmPGES2, the change in expression from stage I to stage III ovaries was not significant. However, a significant 27-fold down-regulation of this transcript was observed in stage IV ovaries (Figure 8B). The PmPGES3 expression level did not change significantly throughout ovarian development (Figure 8C). Lastly, the amount of PmPGFS gene transcripts steadily decreased as the ovary maturation progressed from stage I to stage IV (Figure 8D).

Ovary stages  N  Body Weight (g)  Body length (cm)  Ovary weight (g)  GSI
17256.59±26.5130.00±0.944.33±0.721.79±0.10
27250.47±41.4030.50±2.656.19±1.262.47±0.21
37239.36±44.0130.00±3.5512.29±2.795.12±0.45
46233.46±33.4729.33±1.5415.56±2.586.95±0.37

Table 2. Lists of ovary maturation stage, the number of shrimp (N), average body weight, body length, ovary weight and GSI of the wild P. monodon samples used in real-time PCR analysis.

CSV
Download CSV
GenesPrimersSequence
PGES1PGES1-RT-FCAAGAAGGTATTCGCCAACC
PGES1-RT-RCCGTTGCTCCTCAGGTACATA
PGES2PGES2-RT-FGGGAAGCATCCACCTGGACGTTCC
PGES2-RT-RGGTGCCGTCTCTTCAGGTTCTTGCC
PGES3PGES3-RT-FGACTGCAAATCTCCCACCAT
PGES3-RT-RACTTTGAGCCAGTGCTGCTT
PGFSPGFS-RT-FGGAGAAGTAATGCAGGCTGT
PGFS-RT-RGCCAGGTCTCAATGTAATCC

Table 3. Primer sequences used in quantitative real-time PCR analysis.

CSV
Download CSV
thumbnail
Download:
Figure 8. Relative expression levels of PmPGES and PmPGFS genes in each ovary stage.

Wild broodstock from the Andaman Sea (N=27) were captured and dissected to obtain ovary samples used in the real-time PCR analysis. Each graph represents the average copy number of prostaglandin biosynthesis gene transcripts normalized against EF1α in each ovary stage. (A) PmPGES1, (B) PmPGES2, (C) PmPGES3 and (D) PmPGFS. Error bars show standard deviations and asterisks indicate significant changes between stages (p < 0.05).

https://doi.org/10.1371/journal.pone.0076934.g008

Discussion

In this study, the characterization of the P. monodon prostanoid pathway reveals that P. monodon contains the same types and number of prostaglandin synthase isoforms as those found in mammals (Fig, 1-4; Table 1). In addition to the three PmPGES isoforms shown in the Results section, P. monodon also encodes two isoforms of prostaglandin D synthase that matched the glutathione-dependent prostaglandin D synthase and hematopoietic prostaglandin D synthase genes originally identified in mammals. Interestingly, the proposed prostanoid pathway in another crustacean Daphnia pulex contains only one isoform of each prostanoid biosynthesis gene [22], suggesting that the organization of the P. monodon prostanoid pathway is more conserved with those in mammals, or other divergent prostanoid biosynthetic genes are present in D. pulex that are not annotated. To compare if the P. monodon prostanoid protein sequence is more closely related to its homologs in D. pulex or mammals, phylogenetic analysis of PGES1 was performed, revealing that PmPGES1 is more closely related to its crustacean homologs, including D. pulex, than to its mammalian homologs (Figure S3).

PUFAs and PGE2 have previously been identified in domesticated P. monodon, although it was not clear whether these molecules were synthesized de novo as the animals had been fed with high-PUFA diets [13,21]. In this study, PGF2α was detected by RP-HPLC and mass spectrometry analysis in ovaries of wild-caught P. monodon, suggesting that these molecules occurred naturally in wild population consistent with de novo synthesis and were not the result of specific diets or rearing conditions. Although PmPGDS and PmTBXAS genes are present in P. monodon (Table 1), we were unable to detect the corresponding prostanoid products PGD2, PGF1α and TBX2 which have previously been identified in other arthropods [1,20,44,45]. Therefore, these prostanoids may be present in small amounts in P. monodon.

To provide further proof of a functioning prostanoid synthetic pathway, we assessed the prostaglandin synthase activity in penaeid shrimp using an in vitro activity assay to monitor PGE2 and PGF2α biosynthesis in P. monodon [46]. After shrimp ovary homogenates were incubated with AA, the PGE2 and PGF2α concentrations increased significantly when compared to the basal concentrations (Figure 6). In particular, the rise and fall of PGE2 concentrations observed in this study is similar to the study performed on A. americanum [47]. As the PGE2 biosynthesis activities have already been established in the Tobacco hornworm Manduca sexta [48], the blood sucking bug Triatoma infestans [49], the firebrat Thermobia domestica [50] and the cricket Teleogryllus commodus [51], we propose that the PGE2 biosynthesis is conserved among different arthropods.

Once the prostanoid pathway had been established in P. monodon, we examined whether there is a correlation between prostanoid biosynthesis and shrimp ovary development. In wild P. monodon broodstock, the concentrations of PGE2 decreased from stage I to stage III, but abruptly increased in stage IV ovaries (Figure 7A). This is inconsistent with the trend found in domesticated shrimp, in which the amounts of PGE2 gradually increased during ovary development [21]. The discrepancy between the two studies may be the result of different shrimp genetic background and/or dietary intake. Interestingly, the PGE2 concentrations were highest at stage IV ovaries in both wild and domesticated shrimp, but the significance of this observation has yet to be explored. When the gene expression of each PmPGES isoform was compared to the concentration of PGE2 found in each ovary stage, we observed no correlation between the two parameters. Furthermore, the lowest amount of PmPGES transcripts was found in stage IV ovaries, making it unlikely that the PGE2 biosynthesis is regulated at the transcriptional level in this organ.

Unlike PGE2, the amount of PGF2α steadily decreased with increasing ovary stages, which followed the same trend observed in M. japonicus [10]. Similarly, the PmPGFS gene expression also decreased as the ovaries matured, making PmPGFS gene expression and PGF2α concentration inversely correlated with shrimp ovarian development. Together, our findings suggest that lowered PGFS gene expression resulted in decreasing concentrations of PGF2α during shrimp ovarian maturation process. Therefore, we propose that the PGF2α biosynthesis may be involved in the P. monodon ovarian development.

In conclusion, a prostanoid pathway in P. monodon is proposed based on the identification of nine prostanoid biosynthesis genes, two prostaglandins and three prostanoid precursors (Figure 9). In addition, PGF2α biosynthesis may play an important role in P. monodon ovarian maturation because PGF2α concentration and PmPGFS gene expression declined as the ovarian development progressed. Collectively, our knowledge of the P. monodon prostanoid pathway may lead to future applications in the black tiger shrimp aquaculture industry. More importantly, the identification of the P. monodon prostanoid biosynthesis genes also suggests the conservation of the prostanoid pathway between marine crustaceans and mammals.

thumbnail
Download:
Figure 9. The proposed prostanoid biosynthesis pathway in P. monodon.

PUFAs, prostaglandins and full-length prostanoid biosynthesis genes identified in this study (black) were used to outline the P. monodon prostanoid pathway based on the previously published pathway in mammals. Prostanoids that have yet to be identified in P. monodon are shown in gray.

https://doi.org/10.1371/journal.pone.0076934.g009

Materials and Methods

Collection of shrimp samples

Wild female P. monodon broodstock (n = 25) were collected from the Andaman Sea, Thailand. The weight and length of broodstock were measured and recorded prior to dissection. Shrimp ovaries were dissected, weighed and either subjected to metabolite extraction or flash frozen in liquid nitrogen and stored at -80 °C for RNA extraction. The gonadosomatic index (GSI) of each shrimp was calculated using the following equation: ovarian weight/body weight x 100. Ovarian developmental stages were assigned according to GSI, separating the broodstock into stage I (GSI < 1.5), stage II (GSI = 2-4), stage III (GSI > 4-6) and stage IV (GSI > 6) [21].

Extraction of prostaglandins from shrimp tissues

Tissue homogenates underwent extraction twice with an equal volume of ethyl acetate. The solvent phases were then pooled together and dried under vacuum. Afterward, the dried crude extract was dissolved in 5% methanol. The solution was filtered to remove insoluble material before being loaded onto a 6-ml C18 SPE cartridge (VertiPakTM, Vertical Chromatography, Co., Ltd., Thailand), which was previously washed with 10 ml methanol and 10 ml water. Columns were then washed with 10 ml water, 4 ml hexane, and again with 10 ml water, before being eluted with 10 ml ethyl acetate. The eluate was then evaporated and dissolved in ethanol for subsequent HPLC analysis.

Identification of PUFAs and prostaglandins by RP-HPLC and mass spectrometry

Shrimp tissue extracts were separated by RP-HPLC using an Acclaim® 120 C18 column (3 µm, 4.6 mm x 150 mm; DIONEX Ltd., Surrey, UK) and a gradient mobile system consisting of acetonitrile (ACN): water: acetic acid (30:70:0.01) to 100% ACN in 35 min, with the flow rate of 0.8 ml/min. Resulting peaks were detected using the DIONEX Ultimate 3000 diode-array detector (DIONEX Ltd.). For RP-HPLC/MS analysis, samples were analyzed using the Agilent 1200 series LC system (Agilent Technologies Inc., Santa Clara, CA, USA) coupled with the micrOTOF mass spectrometer and operated with HyStar version 3.2 (Bruker Daltonics Inc., Billerica, MA, USA).

RNA extraction and cDNA synthesis

Shrimp organs were homogenized and subjected to total RNA extraction using the Trizol reagent (Invitrogen, California, USA). mRNA was purified from total RNA using the Oligotex mRNA Mini Kit (QIAGEN, Maryland, USA). First strand cDNA was synthesized using the RevertAidTM First Strand cDNA Synthesis Kit with oligo (dT)18 primer (Fermentas, Maryland, USA) according to the manufacturer’s instructions.

Gene amplification

Initial PCR fragments were obtained using primers based on short gene sequences from The Black Tiger Shrimp EST Project at http://pmonodon.biotec.or.th [26] and the Marine Genomics Project at http://www.marinegenomics.org [24]. 5′- and 3′-RACE-PCR were performed using the AdvantageTM 2 PCR kit (Clontech, California, USA) and the SmartTM RACE cDNA amplification kit (Clontech). All PCR products were cloned into the pTZ57R/T vector (Fermentas), transformed into DH5α E. coli, and submitted for DNA sequencing (1st-BASE, Malaysia). Identities of the obtained cDNA sequences were verified by TBLASTX analysis [52]. Multiple sequence alignment of prostaglandin biosynthesis genes were performed using CLUSTALX [53]. Rooted phylogenetic tree with branch length were performed using CLUSTALW [53]. Protein domains were predicted using Conserved Domain Architecture Retrieval Tool (CDART - http://www.ncbi.nlm.nih.gov/Structure/lexington/lexington.cgi) [54].

Quantitative real-time PCR analysis

Quantitative real-time PCR analysis was performed using the SsoFastTM EvaGreen® Supermix (Bio-Rad, California, USA) according to the manufacturer’s instructions. Amounts of prostanoid biosynthesis gene transcripts relative to that of the house-keeping gene elongation factor 1α (EF1α) were obtained using the standard curve method [55]. The specificity of the PCR product was confirmed by agarose gel electrophoresis and melting curve analysis performed from 55 °C to 95 °C with a continuous fluorescent reading at 0.5 °C increments.

Identification of shrimp PGE2 and PGF2α by enzyme immunoassay (EIA)

Stage IV shrimp ovaries were harvested and homogenized in Hank’s Balanced Salt Solution (HBSS) with an osmolarity of 720 mmol/kg (Sigma-Aldrich Inc., Missouri, USA). For the in vitro PGE2 synthesis assay, ovary homogenates were incubated in a rotary shaker with 25 µM AA at 28 °C, 200 rpm and collected at 0, 30, 60, 120, 240, and 360 minutes post-incubation. The homogenates were centrifuged at 12,000 x g for 2 min at 4 °C and the amounts of PGE2 and PGF2α in the supernatant were estimated using the prostaglandin E2 EIA kit – Monoclonal and prostaglandin F2α EIA kit (Cayman Chemical, Michigan, USA).

Statistical analysis

Statistical significant was assessed in this study using the T-test with two samples assuming equal variances (P<0.05).

Supporting Information

Figure S1.

Schematic representation of domain types and positions on each putative P. monodon prostanoid biosynthesis enzyme. Prostanoid biosynthesis gene sequences were submitted for the CDART analysis for domain prediction. Solid lines represent the total length of each predicted protein, while ovals and squares denote the conserved domains. C2 domain was first identified in phosphokinase C. TRX is thioredoxin-like superfamily domain. GST_C is glutathione transferase family, C-terminal alpha helical domain. MAPEG is Membrane-Associated Protein involved in Eicosanoid and Glutathione metabolism domain. EGF_CA is calcium-binding, EGF-like domain. An_peroxidase-like is animal heme peroxidases and related protein.

https://doi.org/10.1371/journal.pone.0076934.s001

(TIF)

Figure S2.

HPLC analysis and mass spectra of prostanoid precursors in shrimp ovary extract. Ovaries from 5 wild broodstock were homogenized in HBSS, pooled together, and incubated at 28 °C, 200 rpm for 1 h. The homogenate was extracted as described in materials and methods. The extract was then subjected to analysis by RP-HPLC and mass spectrometry. RP-HPLC elution profiles of commercially available prostanoid standards (A) and prostanoid precursors found in ovary homogenate (B) was obtained at 200 nm wavelength. Subsequent mass spectrometry analysis of prostanoid precursors in ovary homogenate revealed the mass spectra of EPA (C), DHA (D) and AA (E).

https://doi.org/10.1371/journal.pone.0076934.s002

(TIF)

Figure S3.

Phylogenetic trees constructed from PmPGES1 and related sequences from vertebrates and invertebrates. Predicted amino acid sequences from various organisms were obtained from GenBank and the Marine Genomics Project. Sequences were aligned using CLUSTALW multiple sequence alignment program and the rooted phylogenetic tree with branch length (UPGMA) were constructed.

https://doi.org/10.1371/journal.pone.0076934.s003

(TIF)

Acknowledgments

We would like to give our thanks to Dr. Sirawut Klinbunga for his valuable suggestion at the beginning of this project, Dr. Rungnapa Leelatanawit for her expertise in shrimp dissection, and Dr. Philip Shaw for his constructive comments on the manuscript.

Author Contributions

Conceived and designed the experiments: WW KK VV. Performed the experiments: WW PT PD KD DP VV. Analyzed the data: WW PT PD. Contributed reagents/materials/analysis tools: WW PT PD. Wrote the manuscript: WW.

References

  1. 1. Rowley AF, Vogan CL, Taylor GW, Clare AS (2005) Prostaglandins in non-insectan invertebrates: recent insights and unsolved problems. J Exp Biol 208: 3-14. doi:https://doi.org/10.1242/jeb.01275. PubMed: 15601872.
  2. 2. Stanley DW, Howard RW (1998) The Biology of Prostaglandins and Related Eicosanoids in Invertebrates: Cellular, Organismal and Ecological Actions. Am Zool 38: 369-381.
  3. 3. Stanley D (2006) Prostaglandins and other eicosanoids in insects: biological significance. Annu Rev Entomol 51: 25-44. doi:https://doi.org/10.1146/annurev.ento.51.110104.151021. PubMed: 16332202.
  4. 4. Funk CD (2001) Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 294: 1871-1875. doi:https://doi.org/10.1126/science.294.5548.1871. PubMed: 11729303.
  5. 5. Smith WL, Marnett LJ (1991) Prostaglandin endoperoxide synthase: structure and catalysis. Biochim Biophys Acta 1083: 1-17. doi:https://doi.org/10.1016/0005-2760(91)90119-3. PubMed: 1903304.
  6. 6. Smith WL, Marnett LJ, DeWitt DL (1991) Prostaglandin and thromboxane biosynthesis. Pharmacol Ther 49: 153-179. doi:https://doi.org/10.1016/0163-7258(91)90054-P. PubMed: 1905023.
  7. 7. Xu XL, Ji WJ, Castell JD, O’Dor RK (1994) Influence of dietary lipid sources on fecundity, egg hatchability and fatty acid composition of Chinese prawn (Penaeus chinensis) broodstock. Aquaculture 119: 359-370. doi:https://doi.org/10.1016/0044-8486(94)90300-X.
  8. 8. Gonzalez-Felix M, Perez-Velazquez M, Quintero-Alvarez J (2009) Effect of Various Dietary Levels of Docosahexanoic and Arachidonic Acids and Different n-3/n-6 Ratios on Biological Performance of Pacific White Shrimp, Litopenaeus vannamei, Raised in Low Salinity. J World Aquacult Soc 40: 194-206. doi:https://doi.org/10.1111/j.1749-7345.2009.00242.x.
  9. 9. Ravid T, Tietz A, Khayat M, Boehm E, Michelis R et al. (1999) Lipid accumulation in the ovaries of a marine shrimp Penaeus semisulcatus (de haan). J Exp Biol 202(13): 1819-1829.
  10. 10. Tahara D, Yano I (2004) Maturation-related variations in prostaglandin and fatty acid content of ovary in the kuruma prawn (Marsupenaeus japonicus). Comp Biochem Physiol A Mol Integr Physiol 137: 631-637. doi:https://doi.org/10.1016/j.cbpb.2003.12.005. PubMed: 15123170.
  11. 11. Muriana FJ, Ruiz-Gutierrez V, Blaya JA, Bolufer J (1995) Phospholipid fatty acid composition of hepatopancreatic brush-border membrane vesicles from the prawn Penaeus japonicus. Biochimie 77: 190-193. doi:https://doi.org/10.1016/0300-9084(96)88124-7. PubMed: 7647111.
  12. 12. Chansela P, Goto-Inoue N, Zaima N, Hayasaka T, Sroyraya M et al. (2012) Composition and localization of lipids in Penaeus merguiensis ovaries during the ovarian maturation cycle as revealed by imaging mass spectrometry. PLOS ONE 7: e33154. doi:https://doi.org/10.1371/journal.pone.0033154. PubMed: 22432001.
  13. 13. Meunpol O, Meejing P, Piyatiratitivorakul S (2005) Maturation diet based on fatty acid content for male Penaeus monodon (Fabricius) broodstock. Aquacult Res 36: 1216-1225. doi:https://doi.org/10.1111/j.1365-2109.2005.01342.x.
  14. 14. Huang J-H, Jiang S-G, Lin H-Z, Zhou F-L, Ye L (2008) Effects of dietary highly unsaturated fatty acids and astaxanthin on the fecundity and lipid content of pond-reared Penaeus monodon (Fabricius) broodstock. Aquacult Res 39: 240-251. doi:https://doi.org/10.1111/j.1365-2109.2007.01868.x.
  15. 15. Hampson AJ, Rowley AF, Barrow SE, Steadman R (1992) Biosynthesis of eicosanoids by blood cells of the crab, Carcinus maenas. Biochim Biophys Acta 1124: 143-150. doi:https://doi.org/10.1016/0005-2760(92)90090-I. PubMed: 1543736.
  16. 16. Kuley E, Ozoğul F, Ozogul Y, Olgunoglu AI (2008) Comparison of fatty acid and proximate compositions of the body and claw of male and female blue crabs (Callinectes sapidus) from different regions of the Mediterranean coast. Int J Food Sci Nutr 59: 573-580. doi:https://doi.org/10.1080/09637480701451201. PubMed: 19382333.
  17. 17. Kashiwagi T, Meyer-Rochow VB, Nishimura K, Eguchi E (2000) Light activation of phospholipase A2 in the photoreceptor of the crayfish (Procambarus clarkii). Acta Neurobiol Exp Wars 60: 9-16. PubMed: 10769925.
  18. 18. Spaziani EP, Hinsch GW, Edwards SC (1993) Changes in prostaglandin E2 and F2 alpha during vitellogenesis in the Florida crayfish Procambarus paeninsulanus. J Comp Physiol B 163: 541-545. doi:https://doi.org/10.1007/BF00302112. PubMed: 8151012.
  19. 19. Spaziani EP, Hinsch GW, Edwards SC (1995) The effect of prostaglandin E2 and prostaglandin F2 alpha on ovarian tissue in the Florida crayfish Procambarus paeninsulanus. Prostaglandins 50: 189-200. PubMed: 8848543.
  20. 20. Reddy PS, Reddy PR, Nagaraju GP (2004) The synthesis and effects of prostaglandins on the ovary of the crab Oziotelphusa senex senex. Gen Comp Endocrinol 135: 35-41. doi:https://doi.org/10.1016/j.ygcen.2003.08.002. PubMed: 14644642.
  21. 21. Preechaphol R, Klinbunga S, Khamnamtong B, Menasveta P (2010) Isolation and characterization of genes functionally involved in ovarian development of the giant tiger shrimp Penaeus monodon by suppression subtractive hybridization (SSH). Genet Mol Biol 33: 676-685. doi:https://doi.org/10.1590/S1415-47572010000400014. PubMed: 21637577.
  22. 22. Heckmann LH, Sibly RM, Timmermans MJ, Callaghan A (2008) Outlining eicosanoid biosynthesis in the crustacean Daphnia. Front Zool 5: 11. doi:https://doi.org/10.1186/1742-9994-5-11. PubMed: 18625039.
  23. 23. Varvas K, Kurg R, Hansen K, Järving R, Järving I et al. (2009) Direct evidence of the cyclooxygenase pathway of prostaglandin synthesis in arthropods: genetic and biochemical characterization of two crustacean cyclooxygenases. Insect Biochem Mol Biol 39: 851-860. doi:https://doi.org/10.1016/j.ibmb.2009.10.002. PubMed: 19854273.
  24. 24. McKillen DJ, Chen YA, Chen C, Jenny MJ, Trent HF 3rd et al. (2005) Marine genomics: a clearing-house for genomic and transcriptomic data of marine organisms. BMC Genomics 6: 34. doi:https://doi.org/10.1186/1471-2164-6-34. PubMed: 15760464.
  25. 25. Campbell EM, Pert CC, Bowman AS (2009) RNA-interference methods for gene-knockdown in the sea louse, Lepeophtheirus salmonis: studies on a putative prostaglandin E synthase. Parasitology 136: 867-874. doi:https://doi.org/10.1017/S0031182009990357. PubMed: 19493370.
  26. 26. Tassanakajon A, Klinbunga S, Paunglarp N, Rimphanitchayakit V, Udomkit A et al. (2006) Penaeus monodon gene discovery project: the generation of an EST collection and establishment of a database. Gene 384: 104-112. doi:https://doi.org/10.1016/j.gene.2006.07.012. PubMed: 16945489.
  27. 27. Jakobsson PJ, Thorén S, Morgenstern R, Samuelsson B (1999) Identification of human prostaglandin E synthase: a microsomal, glutathione-dependent, inducible enzyme, constituting a potential novel drug target. Proc Natl Acad Sci U S A 96: 7220-7225. doi:https://doi.org/10.1073/pnas.96.13.7220. PubMed: 10377395.
  28. 28. Kudo I, Murakami M (2005) Prostaglandin E synthase, a terminal enzyme for prostaglandin E2 biosynthesis. J Biochem Mol Biol 38: 633-638. doi:https://doi.org/10.5483/BMBRep.2005.38.6.633. PubMed: 16336776.
  29. 29. Sjögren T, Nord J, Ek M, Johansson P, Liu G et al. (2013) Crystal structure of microsomal prostaglandin E2 synthase provides insight into diversity in the MAPEG superfamily. Proc Natl Acad Sci U S A 110: 3806-3811. doi:https://doi.org/10.1073/pnas.1218504110. PubMed: 23431194.
  30. 30. Huang X, Yan W, Gao D, Tong M, Tai HH et al. (2006) Structural and functional characterization of human microsomal prostaglandin E synthase-1 by computational modeling and site-directed mutagenesis. Bioorg Med Chem 14: 3553-3562. doi:https://doi.org/10.1016/j.bmc.2006.01.010. PubMed: 16439136.
  31. 31. Parent J, Chapdelaine P, Fortier MA (2005) Molecular cloning and tissue distribution of microsomal-1 and cytosolic prostaglandin E synthases in macaque. Prostaglandins Other Lipid Mediat 78: 27-37. doi:https://doi.org/10.1016/j.prostaglandins.2005.02.005. PubMed: 16303602.
  32. 32. Murakami M, Naraba H, Tanioka T, Semmyo N, Nakatani Y et al. (2000) Regulation of Prostaglandin E2 biosynthesis by Inducible Membrane-associated Prostaglandin E2 synthase that Acts in Concert with Cyclooxygenase-2. J Biol Chem 275: 32783-32792. doi:https://doi.org/10.1074/jbc.M003505200. PubMed: 10869354.
  33. 33. Murakami M, Nakatani Y, Tanioka T, Kudo I (2002) Prostaglandin E synthase. Prostaglandins Other Lipid Mediat 68-69: 383-399. doi:https://doi.org/10.1016/S0090-6980(02)00043-6. PubMed: 12432931.
  34. 34. Tanikawa N, Ohmiya Y, Ohkubo H, Hashimoto K, Kangawa K et al. (2002) Identification and Characterization of a Novel Type of Membrane-Associated Prostaglandin E Synthase. Biochem Biophys Res Commun 291: 884-889. doi:https://doi.org/10.1006/bbrc.2002.6531. PubMed: 11866447.
  35. 35. Watanabe K, Ohkubo H, Niwa H, Tanikawa N, Koda N et al. (2003) Essential 110Cys in active site of membrane-associated prostaglandin E synthase-2. Biochem Biophys Res Commun 306: 577-581. doi:https://doi.org/10.1016/S0006-291X(03)01025-8. PubMed: 12804604.
  36. 36. Tanioka T, Nakatani Y, Semmyo N, Murakami M, Kudo I (2000) Molecular identification of cytosolic prostaglandin E2 synthase that is functionally coupled with cyclooxygenase-1 in immediate prostaglandin E2 biosynthesis. J Biol Chem 275: 32775-32782. doi:https://doi.org/10.1074/jbc.M003504200. PubMed: 10922363.
  37. 37. Kobayashi T, Nakatani Y, Tanioka T, Tsujimoto M, Nakajo S et al. (2004) Regulation of cytosolic prostaglandin E synthase by phosphorylation. Biochem J 381: 59-69. doi:https://doi.org/10.1042/BJ20040118. PubMed: 15040786.
  38. 38. Watanabe K, Yoshida R, Shimizu T, Hayaishi O (1985) Enzymatic formation of prostaglandin F2 alpha from prostaglandin H2 and D2. Purification and properties of prostaglandin F synthetase from bovine lung. J Biol Chem 260: 7035-7041. PubMed: 3858278.
  39. 39. Liston TE, Roberts LJ (1985) Transformation of prostaglandin D2 to 9 alpha, 11 beta-(15S)-trihydroxyprosta-(5Z,13E)-dien-1-oic acid (9 alpha, 11 beta-prostaglandin F2): a unique biologically active prostaglandin produced enzymatically in vivo in humans. Proc Natl Acad Sci USA 82: 6030-6034. doi:https://doi.org/10.1073/pnas.82.18.6030. PubMed: 3862115.
  40. 40. Watanabe K, Iguchi Y, Iguchi S, Arai Y, Hayaishi O et al. (1986) Stereospecific conversion of prostaglandin D2 to (5Z,13E)-(15S)-9 alpha-11 beta,15-trihydroxyprosta-5,13-dien-1-oic acid (9 alpha,11 beta-prostaglandin F2) and of prostaglandin H2 to prostaglandin F2 alpha by bovine lung prostaglandin F synthase. Proc Natl Acad Sci USA 83: 1583-1587. doi:https://doi.org/10.1073/pnas.83.6.1583. PubMed: 3456602.
  41. 41. Suzuki-Yamamoto T, Nishizawa M, Fukui M, Okuda-Ashitaka E, Nakajima T et al. (1999) cDNA cloning, expression and characterization of human prostaglandin F synthase. FEBS Lett 462: 335-340. doi:https://doi.org/10.1016/S0014-5793(99)01551-3. PubMed: 10622721.
  42. 42. Waclawik A, Rivero-Muller A, Blitek A, Kaczmarek MM, Brokken LJ et al. (2006) Molecular cloning and spatiotemporal expression of prostaglandin F synthase and microsomal prostaglandin E synthase-1 in porcine endometrium. Endocrinology 147: 210-221. PubMed: 16223862.
  43. 43. Spaziani EP, Hinsch GW (1997) Variation in selected unsaturated fatty acids during vitellogenesis in the Florida crayfish Procambarus paeninsulanus. Invertebr Reprod Dev 32: 21-25. doi:https://doi.org/10.1080/07924259.1997.9672600.
  44. 44. Pagés M, Roselló J, Casas J, Gelpí E, Gualde N et al. (1986) Cyclooxygenase and lipoxygenase-like activity in Drosophila melanogaster. Prostaglandins 32: 729-740. PubMed: 3103173.
  45. 45. Bowman AS, Sauer JR, Zhu K, Dillwith JW (1995) Biosynthesis of salivary prostaglandins in the lone star tick, Amblyomma americanum. Insect Biochem Mol Biol 25: 735-741. doi:https://doi.org/10.1016/0965-1748(95)00013-L. PubMed: 7627205.
  46. 46. Sandee D, Sivanuntakorn S, Vichai V, Kramyu J, Kirtikara K (2008) Up-regulation of microsomal prostaglandin E synthase-1 in COX-1 and COX-2 knock-out mouse fibroblast cell lines. Prostaglandins Other Lipid Mediat, 88: 111–6. PubMed: 19114118.
  47. 47. Pedibhotla VK, Sarath G, Sauer JR, Stanley-Samuelson DW (1995) Prostaglandin biosynthesis and subcellular localization of prostaglandin H synthase activity in the lone star tick, Amblyomma americanum. Insect Biochem Mol Biol 25: 1027-1039. doi:https://doi.org/10.1016/0965-1748(95)00039-X. PubMed: 8541884.
  48. 48. Gadelhak GG, Pedibhotla VK, Stanley-Samuelson DW (1995) Eicosanoid biosynthesis by hemocytes from the tobacco hornworm, Manduca sexta. Insect Biochem Mol Biol 25: 743-749. doi:https://doi.org/10.1016/0965-1748(95)00014-M. PubMed: 7627206.
  49. 49. Brenner RR, Bernasconi AM (1987) The occurrence of arachidonic acid in Triatoma infestans. Comp Biochem Physiol B 87: 815-819. PubMed: 3117486.
  50. 50. Ragab A, Durand J, Bitsch C, Chap H, Rigaud M (1991) The lipoxygenase pathway of arachidonic acid metabolism in reproductive tissues of the firebrat, Thermobia domestica (Thysanura). Insect Biochem 21: 321-326. doi:https://doi.org/10.1016/0020-1790(91)90022-7.
  51. 51. Loher W, Ganjian I, Kubo I, Stanley-Samuelson D, Tobe SS (1981) Prostaglandins: Their role in egg-laying of the cricket Teleogryllus commodus. Proc Natl Acad Sci U S A 78: 7835-7838. doi:https://doi.org/10.1073/pnas.78.12.7835. PubMed: 16593135.
  52. 52. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403-410. doi:https://doi.org/10.1016/S0022-2836(05)80360-2. PubMed: 2231712.
  53. 53. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680. doi:https://doi.org/10.1093/nar/22.22.4673. PubMed: 7984417.
  54. 54. Geer LY, Domrachev M, Lipman DJ, Bryant SH (2002) CDART: protein homology by domain architecture. Genone Res 12: 1619-1623. doi:https://doi.org/10.1101/gr.278202. PubMed: 12368255.
  55. 55. Leelatanawit R, Klanchui A, Uawisetwathana U, Karoonuthaisiri N (2012) Validation of reference genes for real-time PCR of reproductive system in the black tiger shrimp. PLOS ONE 7: e52677. doi:https://doi.org/10.1371/journal.pone.0052677. PubMed: 23285145.