Figures
Abstract
Background
Lutzomyia longipalpis (Diptera: Psychodidae) is the major vector of Leishmania (Leishmania) infantum and thus plays a crucial role in the epidemiology of American visceral leishmaniasis (AVL). This vector is the best studied species of sand fly in the Neotropical region. Many studies claim that this vector is in fact a species complex; however there is still no consensus regarding the number of species that belong into this complex or the geographical distribution of sibling species. The aim of the present study was to analyze the genetic relationships within Lu. longipalpis populations in the state of Mato Grosso do Sul (MS), Brazil.
Methodology/Principal Findings
We collected 30 Lu. longipalpis (15 females and 15 males) from five localities (Campo Grande, Três Lagoas, Aquidauana, Miranda and Bonito) and 30 Lu. Cruzi from Corumbá, totaling 180 sandflies from MS, and 30 Lu. longipalpis from Estrela de Alagoas, state of Alagoas (AL), Northeast Brazil. We show that eight previously described microsatellite loci were sufficient in distinguishing Lu. longipalpis from Lu. Cruzi, which is a closely related species, and in differentiating between Lu. longipalpis collected in MS versus Estrela de Alagoas. Analyses of the genotypes revealed introgression between sympatric Lu. longipalpis and Lu. Cruzi.
Conclusions/Significance
Our findings support the hypothesis of cryptic species within the Lu. longipalpis complex. Furthermore, our data revealed introgression between Lu. longipalpis and Lu. cruzi. This phenomenon should be further investigated to determine the level and incidence of hybridization between these two species. We also demonstrated that microsatellite markers are a powerful tool for differentiating sand fly populations and species. The present study has elucidated the population structure of Lu. longipalpis in MS and, by extension, the Neotropical Lu. longipalpis complex itself.
Citation: Santos MFC, Ribolla PEM, Alonso DP, Andrade-Filho JD, Casaril AE, Ferreira AMT, et al. (2013) Genetic Structure of Lutzomyia longipalpis Populations in Mato Grosso Do Sul, Brazil, Based on Microsatellite Markers. PLoS ONE 8(9): e74268. https://doi.org/10.1371/journal.pone.0074268
Editor: William J. Etges, University of Arkansas, United States of America
Received: February 26, 2013; Accepted: July 29, 2013; Published: September 16, 2013
Copyright: © 2013 Santos et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work relied on financial support of Fundação de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso do Sul (FUNDECT); Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq); Secretaria Estadual de Saúde de Mato Grosso do Sul (SES/MS) - edital: FUNDECT/MS/CNPq/SES N° 07/2009 and edital: FUNDECT/CNPq Nº 08/2009 - Programa Primeiros Projetos; also Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Leishmaniases are diseases caused by various species of protozoa of the order Kinetoplastida, family Trypanosomatidae and genus Leishmania that affect humans and various wild and domestic animals throughout the world. The disease may present different clinical forms, depending on the species of Leishmania involved in the infection and the relationship between the parasite and its host [1,2]. Visceral leishmaniasis is an anthropozoonosis characterized by chronic evolution and systemic involvement, which if untreated can result in death. In the Americas, Leishmania (L.) infantum is the etiological agent of the disease and Brazil accounts for over 90% of the cases on the continent [3-6].
American visceral Leishmaniasis (AVL) is widely distributed in the state of Mato Grosso do Sul (MS), where it has been reported in several counties [7]. In 2012, 245 cases of AVL were diagnosed throughout 28 localities in MS. Of the total cases in that year, 172 (70.2%) occurred in Campo Grande, followed by Rio Verde de Mato Grosso with 24 cases (9.8%), Aquidauana with 7 cases (2.9%) and Anastácio and Coxim with 6 cases each (2.4%) [8].
Map of Brazil demonstrating the distances of approximately 2.300 km between the states of Mato Grosso do Sul and Alagoas. The map also displays the localities where the specimens were collected in MS and in AL.
Leishmaniases are transmitted by an insect vector in the family Psychodidae. These vectors are distributed throughout the world, and in the Americas there are over 450 known species of sandflies. Approximately 60 of these species are involved in Leishmania transmission [9,10]. In Brazil, the main vector of AVL is Lu. longipalpis, except in Corumbá (MS) where Lu. longipalpis is absent. Lu. cruzi has been identified as a potential vector based on the collection of naturally infected flies [11,12].
Mangabeira [13] was one of the first to seriously discuss the taxonomic status of Lu. longipalpis in Brazil. He observed that males collected in the states of Ceará and Pará differed in the number of spots present on abdominal tergites. Namely, males collected in Ceará had a single pair of pale spots on tergite 4 (1S males), while males captured in Pará had an additional pair of spots on tergite 3 (2S males). This morphological variability was also noticed and investigated by Ward et al. [14] who performed crosses involving populations originated from Ceará (Morada Nova) and Minas Gerais (Lapinha). They demonstrated reproductive isolation between individuals 1S and 2S, further supporting the hypothesis of a "longipalpis" species complex. Since the emergence of this hypothesis and the discovery of cryptic species of Lu. longipalpis, a series of studies have aimed to clarify the taxonomic status of this species [15-26].
Advances in genetic and molecular technologies have provided the tools needed for the elucidation of the biosystematics, population dynamics and phylogenetic relationships among the various species of sandflies. Numerous molecular markers are currently available for entomological analysis and microsatellite loci have been identified and employed as markers in genetic and ecological population studies, including investigations in dipterans vectors of infectious diseases, such as Anopheles darlingi, a malaria vector [27,28] and Aedes aegypti, the vector for yellow fever and dengue fever viruses [29].
Microsatellites are simple sequence repeats arranged in tandem (SSR) of one to six nucleotides that occur throughout eukaryotic genomes. The number of repeats at a microsatellite locus may vary continuously between individuals of a species and are used as co-dominant markers [30]. To date, there is no data available on the sibling species that constitute the Lu. longipalpis complex in Mato Grosso do Sul, or information about the interrelationships between taxonomic species of sandflies found there. The specific aim of the present study was to analyze the genetic relationships, based on microsatellite loci, within and between Lu. longipalpis populations in the state of Mato Grosso do Sul, using a population from Northeast Brazil as an outlying group, and compare it with a population of Lu. cruzi.
Methods
Ethics Statement
For insect collections we obtained a permanent license for collecting and transporting zoological material N° 25592-1 on behalf of Dr. Alessandra Gutierrez de Oliveira, issued by the System of Authorization and Information on Biodiversity of the Brazilian Institute of Environment and Renewable Natural Resources (Sisbio/IBAMA). The collections were performed at private residences, whose owners personally granted permission to enter their backyards to capture the sandflies. All of these residences were located in urban areas and no endangered or protected species were collected in this study.
Sandfly Populations
The phlebotomines were captured using modified CDC light traps from 6 p.m. to 6 a.m. and motorized aspirators at dusk and during the early night hours. We collected Lu. cruzi from Corumbá and Lu. longipalpis from five other localities in MS: Miranda, Aquidauana, Bonito, Campo Grande and Três Lagoas. We also included Lu. longipalpis specimens from Estrela de Alagoas – AL for use as an outgroup in genetic analyses (Figure 1). All sandflies were identified based on morphological characteristics of the genitalia, head, and thorax, as described by Galati [10]. Species confirmation was only performed on male individuals because females of the two species are indistinguishable [31]. We observed the expected pattern of tergite spots in Lu. longipalpis and Lu. cruzi individuals (Table 1). All of the sandflies from Corumbá, Miranda, Aquidauana, Bonito and Três Lagoas had 1S. In Campo Grande there were eleven 1S individuals and four 2S individuals. In Estrela de Alagoas we collected eight individuals with 1S and seven with 2S.
| Species | Tergite spot pattern | Localities, State | Coordinates - Latitude/Longitude |
|---|---|---|---|
| Lu. longipalpis | 1S and 2S | Campo Grande, MS | 20°26'34″ S/54°38'47″ W |
| 1S | Aquidauana, MS | 20°28'16″ S/55°47'14″ W | |
| 1S | Bonito, MS | 21°07'16″ S/56°28'55″ W | |
| 1S | Miranda, MS | 20°14'26″ S/56°22'42″ W | |
| 1S | Três Lagoas, MS | 20°45'04″ S/51°40'42″ W | |
| 1S and 2S | Estrela de Alagoas, AL | 09°23'25″ S/36°45'36″ W | |
| Lu. cruzi | 1S | Corumbá, MS | 19° 00' 33″ S/57°39'12″ W |
Table 1. Collection sites and number of tergite spots in Lutzomyia longipalpis and Lutzomyia cruzi from Mato Grosso do Sul and Alagoas.
Extraction of DNA
After morphological identification, the insects (15 males and 15 females) from each study locality were preserved in 70% alcohol and subsequently crushed using a plastic pestle and portable mixer in 1.5 mL tubes containing 300 µL of 5% Chelex® Molecular Biology Grade Resin (Bio-Rad Laboratories, Hercules, USA) according to the manufacturer’s recommendations. The solution was mixed by vortex for 15s and subsequently subjected to 20 s of centrifugation at 11,000 g. Next, the solution was placed in a water bath at 80°C for 30 min, after which the procedure was repeated. The supernatant was removed, transferred to another sterile Eppendorf tube, and frozen at -20°C.
Microsatellite PCR amplification
To amplify potentially polymorphic regions in genomic DNA, PCR was performed using eight primers described by Watts et al. [32] as listed in Table 2. Twenty five µL of PCR reactions were prepared as follows: 12.5 µL of Gotaq Colorless Master Mix (Madison, WI, USA), 1.0 µL of each oligonucleotide (10 pmol/µL), and 5.0 µL of DNA. Due to the difference in annealing temperature of some oligonucleotides, we standardized two protocols. The reactions were placed in a thermal cycler (Biometra T Gradient, USA) for 5 cycles of denaturation at 94 °C for 15 s, annealing 50/53 °C for 30 s, elongation at 68 °C for 30 s, followed by 25 cycles of denaturation at 94 °C for 15 s, annealing at 50/53 °C for 30 s and elongation at 70 °C for 30 s, and a final extension of 70 °C for 5 min. Once the optimal conditions for PCR were established, reverse primers were labeled with fluorochromes (HEX or FAM). The PCR products obtained with tagged primers were subsequently subjected to fragment analysis in an automated sequencer.
UPGMA dendrogram presenting the genetic distance between Lu. cruzi (Corumbá) and Lu. longipalpis (all of the others) by locality. The dendrogram is based on all of the pair-wise Fst estimates and indicates a genetic difference between the two groups in MS and between these groups and the outgroup.
| Locus | Primer sequence (5’–3’) | Repeat motif | GenBank access no. |
|---|---|---|---|
| LIST6001 | AAAGGGTGCGAAGTTATTGC | (CA)17... (GA)4 | AF411613 |
| GGGTGGGTTGGACATTCTAC | |||
| LIST6005 | CCCTCCTTCTTACAACTCACC | (TG)9 | AF411616 |
| ACCTTTATCGGCCCAGGTAG | |||
| LIST6006 | CCCATTCTGTGTGTTGTCGT | (AC)15 | AF411617 |
| TGCACATTTGAGTGGTTTGTG | |||
| LIST6007 | GCTCCCATTTAATCTCCATAC | (AC)21 | AF411618 |
| CGCCAAGACAAACATTTTCC | |||
| LIST6012 | AAATGGGTGGGTCAAGAGTG | (GT)6... (GT) | AF411620 |
| GTCGCACGGTCTTATGGAAA | |||
| LIST6014 | TTTCGTCTTCTTCAGGCAGTC | (CA)3... (CA)... (CA)5 | AF411621 |
| AAAGTCACCACCCGAGAAAG | |||
| LIST6025 | TTTCGACACCACGTTATGGA | (TG)3... (TG)6 | AF461123 |
| ATCCTCCGCCTACGCTTTAC | |||
| LIST6029 | AACACGCTGGGATTGAA | (TG)8(TC)2(TG) | AF461125 |
| CATCTGAAGTGAATGAGGAAGG |
Table 2. Oligonucleotide panel according to Watts et al. [30].
Microsatellite data analysis
The PCR products were separated on an automated sequencer (ABI 3700, Applied Biosystems, USA), and their sizes and allele peaks were analyzed using the Peak Scanner (Applied Biosystems, USA) software. The genetic and molecular data were analyzed with the MICROSAT program [33] and MEGA4 software [34]. Structure 2.3.3 [35] was used to determine the population structure based on multilocus genotypic data. Cluster analysis was performed using prior information about the geographic collection points and employing the option of admixture, i.e., assuming a degree of ancestry within individuals. Twenty independent replicate runs, each with 50,000 iterations after a burn-in of 100.000 iterations, were performed for the Δk statistic to infer the optimal number of clusters (k).
(A) The numbers under each square stand for 1: Corumbá, 2: Campo Grande, 3: Três Lagoas, 4: Miranda, 5: Aquidauana, 6: Bonito, 7: Estrela de Alagoas. Each color represents samples that have a similar genetic background. Using Δk, 2 populations were obtained. (B) In this picture, Ln (k) was used, and the results reveal 3 assigned populations.
Results
Descriptive analyses
Analysis of microsatellite fragments generated from 180 samples of phlebotomines from Mato Grosso do Sul, were performed to evaluate genetic similarity between the samples. The overall variation of allele sizes was transformed in a genetic distance matrix that was used to calculate a matrix of pairwise allele fixation indices (Fst). Significant differences were observed among all MS populations of Lu. longipalpis compared with the population of Lu. cruzi (Table 3). Fst values ranged from 0.71 (Miranda) to 0.101 (Bonito), with an even higher difference from the Estrela de Alagoas Lu. longipalpis population; the Fst ranged from 0.141 (Bonito) to 0.157 (Três Lagoas). The phenetic UPGMA tree based on all pairwise Fst estimates illustrated the differences between the two different vectors in MS (Lu. longipalpis grouped on the upper part of the tree but still separated from Lu. cruzi) and between those MS sandflies and the outgroup (Estrela de Alagoas – AL) at the base of the tree (Figure 2). Importantly, no genetic difference was found when the two tergite-spot phenotypes were assessed separately.
The dots represent each individual, and the colors represent the localities: Red: Corumbá, Orange, Estrela de Alagoas, Blue: Três Lagoas, Green: Campo Grande, Yellow: Miranda, Violet: Aquidauana, Light Blue: Bonito. The outgroup Estrela de Alagoas (in orange) is clearly distanced from the other populations. The population of Corumbá (in red) is also detached from the other populations but with a small distance compared with the outgroup.
| Corumbá | Campo Grande | Três Lagoas | Miranda | Aquidauana | Bonito | Estrela de Alagoas | |
|---|---|---|---|---|---|---|---|
| Corumbá | 0.000 | - | - | - | - | - | - |
| Campo Grande | 0.072* | 0.000 | - | - | - | - | - |
| Três Lagoas | 0.085* | 0.013 | 0.000 | - | - | - | - |
| Miranda | 0.071* | 0.016 | 0.026* | 0.000 | - | - | - |
| Aquidauana | 0.097* | 0.016 | 0.021 | 0.017 | 0.000 | - | - |
| Bonito | 0.101* | 0.022 | 0.029* | 0.024* | 0.014 | 0.000 | - |
| Estrela de Alagoas | 0.136* | 0.143* | 0.157* | 0.144* | 0.154* | 0.141* | 0.000 |
Table 3. The standard fixation of alleles (Fst) of Lu. longipalpis and Lu. cruzi populations from Mato Grosso do Sul and Alagoas, Brazil.
Population Structure Analyses
We obtained different results depending on the algorithm used in Structure [35] to estimate the best value for k. Using Δk, 2 genetic clusters (one red and one green) were found to outline the populations (Figure 3a), and the Corumbá and Estrela de Alagoas populations contained much more of the red cluster compared with the other MS populations. In contrast, when Ln (k) was used, 3 genetic clusters were produced (Figure 3b); in this figure the green cluster is almost exclusive for Corumbá. The same finding applied to the blue cluster, which is the major cluster for the other populations of MS, and the red cluster, which was found in a major proportion of the population of Estrela de Alagoas. Figure 4 presents the clustering between all of the populations. The population of Corumbá (in red) is clearly isolated from the other populations, including the outgroup of Estrela de Alagoas (in orange).
Discussion
Based on these results, we conclude that Lu. longipalpis from MS and AL are diverging populations, consistent with the geographic distance of at least 2.300 Km between these populations compared with the distance observed for all MS populations (654 Km between Três Lagoas and Corumbá - Figure 1). Furthermore, analysis of allele frequency variation clearly revealed differences between Lu. longipalpis populations in MS and the Lu. cruzi population.
These findings were congruent with cluster phenetic reconstructions based on genetic distances (Figure 2) and, after applying a Bayesian model-based approach, three main vector populations were identified, corresponding to three separate locations: Corumbá, all other municipalities in MS, and Estrela de Alagoas (Figure 3 and Figure 4). Our data also suggest that Lu. longipalpis and Lu. cruzi in Mato Grosso do Sul are not fully reproductively isolated, probably due to the close proximity between these populations, and are two separate sibling species. In Mato Grosso do Sul, there is evidence of the sympatric occurrence of Lu. longipalpis and Lu. cruzi in Campo Grande and Bonito, despite the prevalence of Lu. longipalpis in both localities [36,41], although the catches have not demonstrated sympatry between these different vector populations, suggesting evidence of past introgression.
For insect disease vectors, gene flow between species may yield important epidemiological consequences, because genes controlling aspects of vectorial capacity might be transferred from one species to the other, perhaps changing the disease patterns [42,43]. Based on this rationale we infer that Lu. cruzi is part of Lu. longipalpis complex, and introgression may be occurring, which could lead to further species isolation. Possible morphological hybrids were revealed by the presence of the tuft of setae on gonocoxites that appeared to be a mixture of the two phenotypes as observed several times when analyzing Lu. longipalpis from those localities during routine work in our laboratory.
So far, populations of Lu. Longipalpis have been studied such as analysis of hybridization [05], sex pheromones [15,21,44], isozyme profile analysis [14,45], cytogenetic characters [37], male courtship songs [20,24,38,46], analysis of mitochondrial DNA [45] and microsatellite markers [39,40]. The results of several of these studies support the hypothesis of the existence of a Lu. longipalpis species complex [14,15,45], however, no consensus exists regarding the number and distribution of the different sibling species [23,45,47], although several researchers have demonstrated that, in Brazil, the sibling species differ in their male copulation songs, pheromones and molecular markers [22,25,26,36].
We demonstrate in our study compelling evidence of introgression between Lu. longipalpis and Lu. cruzi. This phenomenon should be fully investigated in future studies to determine which features are implicated in this process. This work presents significant advances in the understanding of the population structure of Lu. longipalpis in MS and, by extension, the neotropical Lu. longipalpis complex itself. We believe that assessing the genetic structure of vector populations may ultimately shed light on sand fly evolution regarding vector-parasite interactions, which might be an essential aspect of the eco-epidemiology of American Visceral Leishmaniasis.
Acknowledgments
We thank the teams of the zoonoses control centers of Bonito and Três Lagoas and the vector control centers in Aquidauana and Miranda for showing and accompanying us to the capture sites. We are also immensely grateful to Dr. Beatriz Brazil and to Helen R. Figueiredo for assistance in collecting samples in Corumbá and Campo Grande, respectively.
Author Contributions
Conceived and designed the experiments: AGO PEMR RPB JDAF. Performed the experiments: MFCS DPA AEC AMTF. Analyzed the data: MFCS PEMR DPA AMTF AGO. Contributed reagents/materials/analysis tools: MFCS PEMR AGO JDAF CESF. Wrote the manuscript: MFCS PEMR DPA AGO.
References
- 1.
Gontijo B, Carvalho MLR (2003) Leishmaniose tegumentar americana. Rev Soc Bras Med Trop 36: 71-80.
- 2.
Lainson R, Shaw JJ (2005) New world leishmaniasis: the neotropical Leishmania species. In: .Cox: FEG, Kreier JP, Wakelin D, (Org). Topley & Wilson's microbiology and microbial infections. London: Hodder Arnold. pp. 313-349.
- 3. Desjeux P (2004) Leishmaniasis: current situation and new perspectives. Comp Immunol Microbiol Infect Dis 27: 305-318. doi:https://doi.org/10.1016/j.cimid.2004.03.004. PubMed: 15225981.
- 4. Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P et al. (2012) Leishmaniasis Worldwide and Global Estimates of Its Incidence. PLOS ONE 7(5): e35671. doi:https://doi.org/10.1371/journal.pone.0035671. PubMed: 22693548.
- 5. Kuhls K, Alam MZ, Cupolillo E, Ferreira GEM, Mauricio IL et al. (2011) Comparative microsatellite typing of New World Leishmania infantum reveals low heterogeneity among populations and its recent Old World origin. PLos Negl Tropi. Drosophila Inf Serv 5(6): e1155. doi:https://doi.org/10.1371/journal.pntd.0001155.
- 6. Ferreira GEM, dos Santos BN, Dorval MEC, Ramos TPB, Porrozzi R et al. (2012) The genetic structure of Leishmania infantum populations in Brazil and its possible association with the transmission cycle of Visceral Leishmaniasis. PLOS ONE 7(5): e36242. doi:https://doi.org/10.1371/journal.pone.0036242. PubMed: 22606248.
- 7.
Dorval MEC, Oshiro ET, Cupollilo E, Castro ACC, Alves TP (2006) Ocorrência de leishmaniose tegumentar americana no Estado de Mato Grosso do Sul, associada à infecção por Leishmania (Leishmania) amazonensis. Rev Soc Bras Med Trop 39: 43-46.
- 8.
Grosso do Sul Mato (2012) Governo do Estado de Mato Grosso do Sul. Secretaria de Saúde de Saúde do Estado Estadual de Vigilância Epidemiológica Coordenadoria. Estadual de Zoonoses Gerência. Informe epidemiológico das leishmanioses nº 4/2012. Campo Grande. Available: http://www.saude.ms.gov.br/controle/ShowFile.php?id=123472. Acessed 23 April 2013.
- 9. Killick-Kendrick R (1990) Phlebotomine vectors of the leishmaniasis: a review. Med Vet Entomol 4: 1-24. doi:https://doi.org/10.1111/j.1365-2915.1990.tb00255.x. PubMed: 2132963.
- 10. Galati EAB (2003) Morfologia e taxonomia: classificação de Phlebotominae. Rangel Lainson R (Org) Flebotomíneos Brasil Rio De Janeiro Fiocruz: 23-51.
- 11. Santos SO, Arias J, Ribeiro AA, Hoffmann MP, Freitas RU, Malacco MAF (1998) Incrimination of Lutzomyia cruzi as a vector of American Visceral Leishmaniasis. Med Vet Entomol 12: 315-317. doi:https://doi.org/10.1046/j.1365-2915.1998.00104.x. PubMed: 9737605.
- 12. Maia-Elkhoury ANS, Alves WA, Sousa-Gomes ML, Sena JM, Luna EA (2008) Leishmaniose Visceral americana: evolução e desafios. Cad Saúde Pública 24: 2941-2947. PubMed: 19082286.
- 13.
Mangabeira Filho O (1969) Sobre a sistemática e biologia dos Phlebotomus do Ceará. Rev Bras Mal Doenç Trop 21: 3-26.
- 14. Ward PC, Ribeiro AL, Ready PD, Murtagh A (1983) Reproductive isolation between different forms Lutzomyia longipalpis (Lutz & Neiva) (Diptera: Psychodidae) the vector of Leishmania donovani chagasi Cunha & Chagas and its significance to kalazar distribution in South America. Mem Inst Oswaldo Cruz 78: 269–280.
- 15. Lanzaro GC, Ostrovska K, Herrero MV, Lawyer PG, Warburg A (1993) Lutzomyia longipalpis is a species complex: genetic divergence and interspecific hybrid sterility among three populations. Am J Trop Med Hyg 48: 839–847. PubMed: 8333579.
- 16. Arrivillaga JC, Feliciangeli MD (2001) Lutzomyia pseudolongipalpis: the first new species within the longipalpis (Diptera: Psychodidae: Phlebotominae) complex from La Rinconada, Curarigua, Lara State, Venezuela. J Med Entomol 38: 783–790. doi:https://doi.org/10.1603/0022-2585-38.6.783. PubMed: 11761375.
- 17.
Bauzer LGRS, Souza NA, WArd RD, Peixoto AA (2002) The period gene and genetic differentiation between three Brazilian populations of Lutzomyia longipalpis. Insecta Mol Bio 11: 315-323.
- 18.
Hodgkinson VH, Birungi J, Quintana M, Deitze R, Munstermann LE (2003) Mitochondrial cytochrome B variation in populations of the visceral L.sis vector Lutzomyia longipalpis across eastern Brazil. Am J Trop Hyg 69: 386-392.
- 19. Bottecchia M, Oliveira SG, Bauzer LGRS, Souza NA, Ward RD, Garner KY, Kyriacou CP, Peixoto AA (2004) Genetic divergence in the cacophony IVS6 intron among Five brazilian populations of Lutzomyia longipalpis. J Med Evol 58: 754-761. doi:https://doi.org/10.1007/s00239-004-2586-y. PubMed: 15461432.
- 20. Souza NA, Vigoder FM, Araki AS, Ward RD, Kyriacou CP, Peixoto AA (2004) Analysis of the copulatory courtship songs of Lutzomyia longipalpis in six populations from Brazil. J Med Entomol 41: 906–913. doi:https://doi.org/10.1603/0022-2585-41.5.906. PubMed: 15535620.
- 21. Hamilton JG, Maingon RD, Alexander B, Ward RD, Brazil RP (2005) Analysis of the sex pheromone extract of individual male Lutzomyia longipalpis sandflies from six regions in Brazil. Med Vet Entomol 19: 480–488. doi:https://doi.org/10.1111/j.1365-2915.2005.00594.x. PubMed: 16336313.
- 22. Balbino VQ, Coutinho-Abreu IV, Sonoda IV, Melo MA, Andrade PP et al. (2006) Genetic structure of natural populations of the sand fly Lutzomyia longipalpis (Diptera: Psychodidae) from the Brazilian northeastern region. Acta Trop 98: 15–24. doi:https://doi.org/10.1016/j.actatropica.2006.01.007. PubMed: 16480941.
- 23. Bauzer LG, Souza NA, Maingon RD, Peixoto AA (2007) Lutzomyia longipalpis in Brazil: a complex or a single species? A mini-review. Mem Inst Oswaldo Cruz 102: 1–12. doi:https://doi.org/10.1590/S0074-02762007000100001. PubMed: 17293992.
- 24. Araki AS, Vigoder FM, Bauzer LG, Ferreira GE, Souza NA et al. (2009) Molecular and behavioral differentiation among Brazilian populations of Lutzomyia longipalpis (Diptera: Psychodidae: Phlebotominae). PLoS Negl Trop. Drosophila Inf Serv 3: e365.
- 25. Vigoder FM, Araki AS, Bauzer LG, Souza NA, Brazil RP et al. (2010) Lovesongs and period gene polymorphisms indicate Lutzomyia cruzi (Mangabeira, 1938) as a sibling species of the Lutzomyia longipalpis (Lutz and Neiva, 1912) complex. Infect Genet Evol 10: 734–739. doi:https://doi.org/10.1016/j.meegid.2010.05.004. PubMed: 20478408.
- 26. Lins RMMA, Souza NA, Brazil RP, Maingon RDC, Peixoto AA (2012) Fixed Differences in the paralytic Gene Define Two Lineages within the Lutzomyia longipalpis Complex Producing Different Types of Courtship Songs. PLOS ONE 7: e44323. doi:https://doi.org/10.1371/journal.pone.0044323. PubMed: 22970200.
- 27. Angêlla AF, Gil LHS, Silva LHP, Ribolla PEM (2007) Population structure of the malaria vector Anopheles darlingi in Rondônia, Brazilian Amazon, based on mitochondrial DNA. Mem Inst Oswaldo Cruz 102: 953-958. doi:https://doi.org/10.1590/S0074-02762007000800010. PubMed: 18209934.
- 28. Molina-Cruz A, De Mérida AMP, Mills K, Rodríguez F, Schoua C, Yurrita MM et al. (2004) Gene flow among Anopheles albimanus populations in Central America, South America, and Caribbean assessed by microsatellites and mitochondrial DNA. Am J Trop Med Hyg 71: 350–359. PubMed: 15381818.
- 29. Chambers EW, Meece JK, Mcgowan JA, Lovin DD et al. (2007) Microsatellite Isolation and Linkage Group Identification in the Yellow Fever Mosquito Aedes aegypti. J Hered 9: 202–210. PubMed: 17420178.
- 30. Weber JL, May PE (1989) Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am J Hum Genet 44: 388–396. PubMed: 2916582.
- 31. Martins AV, Falcão A, Silva JE, Dias ES (1984) Nota sobre Lutzomyia (Lutzomyia) cruzi (Mangabeira, 1938), com descrição da fêmea (Diptera, Psychodidae, Phlebotominae). Mem Inst Oswaldo Cruz 79: 439-442. doi:https://doi.org/10.1590/S0074-02761984000400007.
- 32. Watts PC, Boyland E, Noyes HA, Maingon R, Kemp SJ (2002) Polymorphic dinucleotide microsatellite loci in the sandfly Lutzomyia longipalpis (Diptera: Phlebotominae). Mol Ecol Notes 2: 60–61. doi:https://doi.org/10.1046/j.1471-8286.2002.00149.x.
- 33.
Minch E, Ruiz-Linares A, Goldstein D, Feldman M, Cavalli-Sforza LL (1996) Microsat (version 1.5b): a computer program for calculating various statistics on microsatellite allele data. Available: http://lotka.stanford.edu/microsat.html. Accessed 12 December 2012.
- 34. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599. doi:https://doi.org/10.1093/molbev/msm092. PubMed: 17488738.
- 35. Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155: 945–959. PubMed: 10835412.
- 36. Mutebi JP, Tripet F, Alexander JB, Lanzaro GC (2002) Genetic Differentiation of Lutzomyia longipalpis in Latin America. Ann Entomol Soc Am 95: 741-752.
- 37. Yin H, Mutebi JP, Marriott S, Lanzaro GC (1999) Metaphase karyotypes and G-banding in sandflies of the Lutzomyia longipalpis complex. Med Vet Entomol 13: 72–77. doi:https://doi.org/10.1046/j.1365-2915.1999.00139.x. PubMed: 10194752.
- 38. Souza N, Ward RD, Hamilton JGC, Kyriacou CP, Peixoto AA (2002) Copulation songs in three siblings of Lutzomyia longipalpis (Diptera: Psychodidae). Trans R Soc Trop Med Hyg 96: 102–103. doi:https://doi.org/10.1016/S0035-9203(02)90258-0. PubMed: 11925981.
- 39. Day JC, Ready PD (1999) Relative abundance, isolation and structure of phlebotomine microsatellites. Insect Mol Biol 8: 575–580. doi:https://doi.org/10.1046/j.1365-2583.1999.00142.x. PubMed: 10620055.
- 40. Watts PC, Hamilton JG, Ward RD, Noyes HA, Souza NA, Kemp SJ, Feliciangeli MD, Brazil RP, Maingon RD (2005) Male sex pheromones and the phylogeographic structure of the Lutzomyia longipalpis species complex (Diptera: Psychodidae) from Brazil and Venezuela. Am J Trop Med Hyg 73: 734-743. PubMed: 16222018.
- 41.
Dias ES, Fortes-Dias CL, Stiteler JM, Perkins PV, Lawyer PG (1998) Random amplified polymorphic DNA (RAPD) analysis of Lutzomyia longipalpis laboratory populations. Rev . Inst Med Trop 40: 49–53.
- 42. Mazzoni CJ, Araki AS, Ferreira GEM, Azevedo RVDM, Barbujani G, Peixoto AA (2008) Multilocus analysis of introgression between two sand fly vectors of leishmaniasis. BMC Evol Biol 8: 141. doi:https://doi.org/10.1186/1471-2148-8-141. PubMed: 18474115.
- 43. Marcondes CB, Day JC, Ready PD (1997) Introgression between Lutzomyia intermedia and both Lu. neivai and Lu. whitmani, and their roles as vectors of Leishmania braziliensis. Trans R Soc Trop Med Hyg 91: 725-726. doi:https://doi.org/10.1016/S0035-9203(97)90540-X. PubMed: 9509190.
- 44. Hamilton JGC, Dawson GW, Pickett JA (1996) 9-Methylgermacrene-B; proposed structure for novel homosesquiterpene sex pheromone glands of Lutzomyia longipalpis (Diptera: Psychodidae) from Lapinha, Brazil. J Chem Ecol 22: 1477–1491. doi:https://doi.org/10.1007/BF02027726.
- 45. Arrivillaga J, Mutebi JP, Piñango H, Norris D, Alexander B et al. (2003) The taxonomic status of genetically divergent populations of Lutzomyia longipalpis (Diptera: Psychodidae) based on the distribution of mitochondrial and isozyme variation. J Med Entomol 40: 615–627. doi:https://doi.org/10.1603/0022-2585-40.5.615. PubMed: 14596274.
- 46. Maingon RDC, Ward RD, Hamilton JGC, Noyes HA, Souza N, Kemp SJ, Watts PC (2003) Genetic identification of two sibling species of Lutzomyia longipalpis (Diptera: Psychodidae) that produce distinct male sex pheromones in Sobral, Ceará State, Brazil. Mol Ecol 12: 1879–1894. doi:https://doi.org/10.1046/j.1365-294X.2003.01871.x. PubMed: 12803639.
- 47. Maingon RD, Ward RD, Hamilton JG, Bauzer LG, Peixoto AA (2008) The Lutzomyia longipalpis species complex: does population sub-structure matter to Leishmania transmission? Trends Parasitol 24: 12–17. doi:https://doi.org/10.1016/j.pt.2007.10.003. PubMed: 18023260.