Label-Free Detection of Cu2+ and Hg2+ Ions Using Reconstructed Cu2+-Specific DNAzyme and G-quadruplex DNAzyme

Hui Li; Xiao-Xi Huang; Yang Cai; Hao-Jie Xiao; Qiu-Fen Zhang; De-Ming Kong

doi:10.1371/journal.pone.0073012

Abstract

Label-free metal ion detection methods were developed. To achieve these, a reconstructed Cu²⁺-specific DNA-cleaving DNAzyme (Cu²⁺-specific DNAzyme) with an intramolecular stem-loop structure was used. G-quadruplex-forming G-rich sequence(s), linked at the ends of double-helix stem of an intramolecular stem-loop structure, was partly caged in an intramolecular duplex or formed a split G-quadruplex. Cu²⁺-triggered DNA cleavage at a specific site decreased the stability of the double-helix stem, resulting in the formation or destruction of G-quadruplex DNAzyme that can effectively catalyze the 2,2′-azinobis(3-ethylbenzothiazoline)-6-sulfonic acid (ABTS)-H₂O₂ reaction. Based on these, two label-free, cost-effective and simple Cu²⁺ sensors were designed. These two sensors followed different detection modes: ‘turn-on’ and ‘turn-off’. As for the ‘turn-on’ sensor, the intramolecular stem-loop structure ensured a low background signal, and the co-amplification of detection signal by dual DNAzymes (Cu²⁺-specific DNAzyme and G-quadruplex DNAzyme) provided a high sensitivity. This sensor enabled the selective detection of aqueous Cu²⁺ with a detection limit of 3.9 nM. Visual detection was possible. Although the ‘turn-off’ sensor gave lower detection sensitivity than the ‘turn-on’ one, the characteristics of cost-effectiveness and ease of operation made it an important implement to reduce the possibility of pseudo-positive or pseudo-negative results. Combining the ability of Hg²⁺ ion to stabilize T-T base mismatch, above dual DNAzymes-based strategy was further used for Hg²⁺ sensor design. The proposed sensor allowed the specific detection of Hg²⁺ ion with a detection of 4.8 nM. Visual detection was also possible.

Citation: Li H, Huang X-X, Cai Y, Xiao H-J, Zhang Q-F, Kong D-M (2013) Label-Free Detection of Cu²⁺ and Hg²⁺ Ions Using Reconstructed Cu²⁺-Specific DNAzyme and G-quadruplex DNAzyme. PLoS ONE 8(9): e73012. https://doi.org/10.1371/journal.pone.0073012

Editor: Sabato D'Auria, CNR, Italy

Received: June 5, 2013; Accepted: July 23, 2013; Published: September 6, 2013

Copyright: © 2013 Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by The Natural Science Foundation of China (No. 21175072); The National Natural Science Foundation of Tianjin (No. 12JCYBJC13300); The National Basic Research Program of China (No. 2011CB707703); The Fundamental Research Funds for the Central Universities and the Program for New Century Excellent Talents in University (NCET-10-0504), Chinese Ministry of Education. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

With more and more electronic and industrial waste going to the land, rivers and air, environmental pollution has become one of the most important problems in the world. Heavy metal ions in the waste can cause huge damage to human body through food, water and air [1]. In order to avoid the poison of heavy metal to ecosystem, cost-effective and accurate detection of these metal ions is necessary. To date, numerous approaches, such as colorimetric [2], fluorescent [3], atomic absorption/emission spectroscopy [4], inductively coupled plasma mass spectroscopy (ICP-MS) [5] and electrochemical assays [6], have been developed. Most of them require sophisticated equipments or sample treatments [7]. Recently, DNAzymes have emerged as a promising class of candidate to build sensors [8]. As efficiently catalytic DNA molecules, DNAzymes can be superior in terms of stability, cost-effectiveness and ease of modification [9]. Methods based on DNAzymes are extremely important to meet the requirement for simple, specific and accurate detection of heavy metal ions, especially at low concentrations. Several facile fluorescent and colorimetric sensors based on heavy metal ion-specific DNAzymes have been reported [10–17].

Recently, we reconstructed the Cu²⁺-dependent DNAzyme reported by Carmi et al. [18,19], and thus designed a Cu²⁺-sepecific fluorescent sensor [20]. An attractive feature of the reconstructed DNAzyme is that it makes possible the use of an intramolecular stem-loop structure [20]. The fluorophore/quencher pair labeled at the two ends of the stem-loop structure can contact closely, conferring the fluorescent sensor with a low background fluorescence signal and thus high detection sensitivity. However, this fluorescent sensor needs a dual-labeled fluorescent oligonucleotide probe to produce an efficient fluorescence switch for detection. Considering the price and the difficulty of preparing such probes, it is interesting and significant to develop a simple, cost-effective, and label-free method for Cu²⁺ detection.

G-quadruplex DNAzymes are peroxidase-mimicking artificial enzymes formed by unlabelled G-rich oligonucleotides and hemin. Base on target-triggered formation or destruction of G-quadruplexes, a number of label-free colorimetric and/or chemiluminescence detection methods have been reported [21,22]. In this paper, by using G-quadruplex DNAzyme-catalyzed chromogenic reactions indicating the DNA cleavage reaction of the reconstructed Cu²⁺-specific DNAzyme, label-free Cu²⁺ detection, following ‘turn-on’ or ‘turn-off’ mode, was easily achieved. Visual detection was also possible. In addition, combining the stabilizing ability of Hg²⁺ to T-T mismatches, this reconstructed Cu²⁺-specific DNAzyme was further used for label-free detection of Hg²⁺.

Results and Discussion

Design of ‘turn-on’ Cu²⁺ sensor

The proposed Cu²⁺ sensor was designed on the basis of two DNAzymes: a Cu²⁺-specific DNA-cleaving enzyme (Cu²⁺-specific DNAzyme) and a G-quadruplex DNAzyme. The used Cu²⁺-specific DNAzyme is a reconstructed version of the original one [19]. This reconstructed DNAzyme also uses two oligonucleotide strands, but one strand (we name it MB) exists as a molecular beacon-like intramolecular stem-loop structure, and the cleavage site is embedded in the double-helix stem. The other strand is a polypurine oligonucleotide (PPO), it can hybridize with the loop of MB to form a DNA triple-helix structure, thus providing a Cu²⁺ ion binding site and leading to the Cu²⁺-specific DNA cleavage reaction at a specific site.

To develop a ‘turn-on’ Cu²⁺ sensor, a G-quadruplex-forming G-rich sequence is linked to the 3′-end of the stem of MB, and the 5′-end of the stem is appropriately extended by the complementary sequence of the G-rich sequence. The obtained oligonucleotide (we name it MB-Cu1, Figure 1a) also adopts an intramolecular stem-loop structure. The G-rich sequence is partially caged in the double-helix stem, not able to form a G-quadruplex. The hybridization of MB-Cu1 with PPO and subsequent Cu²⁺-triggered DNA cleavage convert the stable intramolecular double-helix stem to a less stable intermolecular duplex. The decrease of stability results in the release of G-rich sequence, which folds into a G-quadruplex and assembles into a peroxidase-like DNAzyme in the presence of hemin. The resulting G-quadruplex DNAzyme can effectively catalyze the H₂O₂-mediated oxidation of 2,2′-azino-bis(3-ethylbenzothiozoline)-6-sulfonic acid (ABTS) to form the colored radical product ABTS^•+ [23], which has a maximal absorption at 419 nm. Thus, the change in the absorption signal at this wavelength can be employed to monitor the formation of the G-quadruplex structure, which is closely related to Cu²⁺ concentration.

Download:

Figure 1. Working mechanism of the dual DNAzymes-based.

(a) ‘turn-on’ Cu²⁺ sensor, (b) ‘turn-off’ Cu²⁺ sensor and (e) ‘turn-on’ Hg²⁺ sensor. (c, d) Mechanistic representation of switching catalytic activity of the Cu²⁺-specific DNAzyme by modulating the pocket size. (c) Increasing the pocket size makes the DNAzyme lose catalytic activity. (d) Reducing the pocket size via the formation of double-helix stem recovers the catalytic activity.

https://doi.org/10.1371/journal.pone.0073012.g001

The as-designed Cu²⁺ sensor (Figure 1) has two important characteristics: one is the use of dual DNAzymes: a Cu²⁺-specific DNAzyme and a G-quadruplex DNAzyme. During Cu²⁺-specific DNA cleavage reaction, Cu²⁺ can be reused. One Cu²⁺ ion can trigger several DNA cleavage reactions, thus achieving the enrichment of G-quadruplex DNAzyme. The resulting G-quadruplex DNAzyme is subsequently used as the catalyst of ABTS-H ₂O₂ reaction to give enhanced detection signal. Co-amplification of dual DNAzymes can provide the sensing system with high sensitivity. The use of G-quadruplex DNAzyme also makes label-free detection possible.

The other characteristic is the use of the reconstructed Cu²⁺-specific DNAzyme. There are three factors that greatly affect the sensitivity of the proposed sensor: blockage of G-quadruplex formation in the absence of Cu²⁺, Cu²⁺-triggered DNA cleavage, and subsequent release of G-rich sequence. The reconstruction of the Cu²⁺-specific DNAzyme does not change the efficiency of DNA cleavage process, but does bring great effects to the first and the third factors. It is well known that an intramolecular duplex is much more stable than the intermolecular one with identical base sequence [24]. For example, a molecular beacon with 5-base pair stem can keep a stable stem-loop structure even at 50-60 ^oC [25]. That is to say, intramolecular double-helix stem structure of the reconstructed DNAzyme can effectively block the formation of catalytic G-quadruplex, thus keeping the background signal at a low level. In addition, the extraordinary stable intramolecular stem-loop structure makes it possible to use a relatively short stem, thus shortening the length of the intermolecular duplex resulted by DNA cleavage reaction. This makes the release of G-rich sequence much easier. As shown in Figure 2a, in the absence of Cu²⁺, the MB-Cu1/PPO/hemin system showed a low absorption signal, which was comparable to that caused by inherently catalytic activity of free hemin. However, the addition of 200 nM Cu²⁺ could increase the absorption signal of the sensing system to a much higher level, attributed to the Cu²⁺-triggered DNA cleavage and subsequent formation of the catalytic G-quadruplex DNAzyme as described in Figure 1a.

Download:

Figure 2. UV–Vis absorption spectra of the designed sensor.

(a) The absorption signal of the ‘turn-on’ Cu²⁺-sensing system in the absence or presence of 200 nM Cu²⁺. Line 1 represents the sensing system containing free hemin only. The insert shows the photographed images of the reaction tubes. (b) The absorption signal of the ‘turn-off’ Cu²⁺-sensing system in the absence or presence of 200 nM Cu²⁺. (c) The absorption signal of the sensing system containing two oligonucletodies that form similar structures to the Cu²⁺-specific DNAzyme but with different pocket sizes. (d) The absorption signal of the ‘turn-on’ Hg²⁺-sensing system in the absence or presence of 0.5 µM Cu²⁺ and 1 µM Hg²⁺. The insert shows the photographed images of the reaction tubes.

https://doi.org/10.1371/journal.pone.0073012.g002

To study the feasibility of this method for Cu²⁺ quantitation, the absorption signal of the sensing system was measured as a function of Cu²⁺ concentration. As shown in Figure 3a, the absorption signal greatly increased by adding Cu²⁺, and nearly reached a plateau when the Cu²⁺ concentration exceeded 200 nM. A linear relationship (R² = 0.9869) was observed with Cu²⁺concentrations from 8 to 200 nM. On the basis of 3σ/slope of the calibration curve (where σ is the standard deviation of the blank samples), the calculated detection limit was 3.9 nM Cu²⁺, which is much lower the 20 μΜ maximum contamination level set by the US EPA for drinking water, and represents one of the sensitive biosensors of Cu²⁺ with good linearity for quantitative analysis of Cu²⁺ [26–29]. The reproducibility of the proposed method was evaluated by performing ten repetitive experiments for 200 nM Cu²⁺. All of the relative standard deviations (RSD) of intra- (3.12%) and intergroup (2.96%) were <5%, indicating that our assay protocol had good reproducibility. Of note, large absorption signal change could be observed between the systems with or without Cu²⁺, it could even be discriminated by the naked eyes. That is, the proposed ‘turn-on’ sensor can be developed as a simple method for visual detection of Cu²⁺.

Download:

Figure 3. Sensitivity and selectivity of the ‘turn-on’ Cu²⁺ sensor.

(a) Absorption signal response of the sensing system to Cu²⁺ concentration. The insert shows the absorption signal change in the Cu²⁺ concentration range of 8-200 nM. The solid line represents a linear fit to the data. (b) Selectivity of the proposed sensor for Cu²⁺ over other competing divalent metal ions. The absorption signal changes of the sensing system induced by different competing metal ions (200 µM) are shown. The concentrations of Cu²⁺ are shown at the top of the bars. All experiments were performed in triplicate.

https://doi.org/10.1371/journal.pone.0073012.g003

To evaluate the selectivity of this ‘turn on’ Cu²⁺-sensing system, nine competing environmentally relevant metal ions, including Co²⁺, Ca²⁺, Fe³⁺, Ni²⁺, Zn²⁺, Mn²⁺, Pb²⁺, Hg²⁺ and Mg²⁺ were assayed. As shown in Figure 3b, among these competing metal ions, only Fe³⁺ and Hg²⁺ caused detectable changes of fluorescence. However, the change of absorbance signal induced by 200 µM Fe³⁺ was similar to, but a little lower than, that induced by 40 nM Cu²⁺, indicating that the sensor selectivity for Cu²⁺ was at least 5000-fold higher than that for Fe³⁺. As for Hg²⁺, the selectivity was much higher.

To investigate whether the method was applicable to real samples, known amounts of Cu²⁺ were added to real water samples and the recovery values were determined from the calibration graph. As shown in Table S1, the recovery of added Cu²⁺ was in the range of 92.2~108.9%, indicating that this method is able to detect Cu²⁺ in real samples with little interference.

Design of ‘turn-off’ Cu²⁺ sensor

The reconstructed DNAzyme can also be easily used to develop a ‘turn-off’ Cu²⁺ detection method. In this Cu²⁺ sensor, two G-rich sequences, each cannot form a G-quadruplex by itself, are linked to the 5′- and 3′-end of the stem of MB, respectively (we name the obtained oligonucleotide as MB-Cu2, Figure 1b). With the help of double-helix stem, the two G-rich sequences closely contact to each other, thus folding into a split G-quadruplex [30,31], which can form a catalytic G-quadruplex DNAzyme upon hemin binding. Cu²⁺-triggered DNA cleavage can also result in the dissociation of the split G-quadruplex, leading to the reduction of the catalytic activity and subsequent decrease of the absorbance signal of the sensing system. As shown in Figure 2b, in the absence of Cu²⁺, the MB-Cu2/PPO/hemin system showed a high catalytic activity towards ABTS-H ₂O₂ reaction, thus giving a high level of absorption signal. The addition of 200 nM Cu²⁺ led to an obvious decrease of the absorption signal as expected. Of note, a relatively high absorption signal was still observed in the presence of 200 nM Cu²⁺. It is not surprise because the formation of split G-quadruplex at the end of double-helix stem enhances the stability of the stem, thus increasing the difficulty of dissociation of the split G-quadruplex after DNA cleavage.

The feasibility of this ‘turn-off’ sensor for Cu²⁺ detection was also studied. As shown in Figure 4a, the absorption signal of the sensing system continuously decreased with increasing Cu²⁺ concentration from 0 to 2000 nM, and a good linear relationship (R² = 0.9963) between the absorption signal and Cu²⁺ concentration was observed over a range of 20~250 nM. The calculated detection limit was 16.6 nM, which was higher than that of the ‘turn-on’ method described above. This may be attributed to the high background and large standard deviation of the blank samples, which are the inherent drawbacks often faced by ‘turn-off’ detection methods. Of note, its detection limit is still much lower than the 20 μΜ maximum contamination level set by the US EPA for drinking water. The RSDs of inter- (4.9%) and intragroup (2.1%) were all <5%. This indicates that this ‘turn-off’ detection mode has good reproducibility. This ‘turn-off’ detection method also showed a good selectivity for Cu²⁺ compared to potential competing metal ions (Figure 4b). Among the tested competing metal ions, only Hg²⁺ caused the detectable absorbance signal change, but the signal change caused by 5 µM Hg²⁺ was only similar to that caused by 50 nM Cu²⁺, indicating that the selectivity of the sensor for Cu²⁺ was 100-fold than that for Hg²⁺. Like the ‘turn-on’ sensor, the ‘turn-off’ one can also be used to quantify Cu²⁺ in practice. The calculated recovery was in the range of 97.2~101.3% (Table S2). Though the sensitivity and selectivity of the ‘turn-off’ sensor are all not so good as those of the ‘turn-on’ one, the ‘turn-off’ sensor can be used as an important implement for the ‘turn-on’ one. Single detection mode (‘turn-on’ or ‘turn-off’) may suffer from pseudo-positive or pseudo-negative problem. The two label-free detection methods proposed in this work offer the same advantages of cost-effectiveness and ease of operation. Combined use of them is feasible to reduce the possibility of pseudo-positive and pseudo-negative results.

Download:

Figure 4. Sensitivity and selectivity of the ‘turn-off’ Cu²⁺ sensor.

(a) Absorption signal response of the sensing system to Cu²⁺ concentration. The insert shows the absorption signal change in the Cu²⁺ concentration range of 0-250 nM. The solid line represents a linear fit to the data. (b) Selectivity of the proposed sensor for Cu²⁺ over other competing divalent metal ions. The absorption signal changes of the sensing system induced by different competing metal ions (5 µM) are shown. The concentrations of Cu²⁺ are shown at the top of the bars. All experiments were performed in triplicate.

https://doi.org/10.1371/journal.pone.0073012.g004

Design of ‘turn-on’ Hg²⁺ sensor

The experiments mentioned above demonstrated that the reconstructed Cu²⁺-specific DNAzyme provided a good choice for the design of Cu²⁺ sensors. Then, we wonder whether it can be extended to the design of other sensors. As shown in Figure 1, in the complex formed by MB and PPO, there is a single-stranded loop structure, which likes a pocket. Cu²⁺ can bind into this pocket and trigger DNA cleavage reaction. The size of pocket is specific for Cu²⁺. If several nucleotides are inserted into the loop sequence to enlarge the pocket size, the Cu²⁺-specific DNA cleavage will be almost inhibited completely (Figure 1c), which can be reflected by the low absorption signal of corresponding ABTS-H ₂O₂ system (Figure 2c). But we found that if the inserted sequence was self-complementary to form a double-helix stem as in the MB-Hg2/PPO complex shown in Figure 1d, the pocket size would nearly recover. As a result, the efficiency of Cu²⁺-specific DNA cleavage also recovered and high absorption signal could be observed in ABTS-H ₂O₂ system (Figure 2c). This finding provides the possibility for the design of sensors for metal ions that can promote the formation of metal-base pairs [32], and one example is Hg²⁺. It is well known that Hg²⁺ can stabilize T-T base mismatch [33–35]. When the self-complementary stem-forming bases inserted in MB-Hg2 are replaced by T bases (we name the new oligonucleotide as MB-Hg1), the pocket size is enlarged and Cu²⁺-specific DNA cleavage is inhibited. In the presence of Hg²⁺, the pocket size is recovered by the formation of the double-stranded stem containing T-Hg²⁺-T base pairs, thus making Cu²⁺-sepcific DNA cleavage possible (Figure 1e). On the basis of switching modulation of Cu²⁺-specific DNA cleavage by Hg²⁺, a Hg²⁺-specific sensor can be designed.

The results in Figure 2d demonstrated the feasibility of the proposed Hg²⁺ sensor. In the absence of Hg²⁺, the MB–Hg1/PPO/hemin system containing 500 nM Cu²⁺ showed a very low absorption signal, which was comparable to that of the similar system but without Cu²⁺. This result demonstrated that the efficiency of Cu²⁺-specific DNA cleavage was indeed greatly inhibited by enlarging the pocket size. In the presence of 1 µM Hg²⁺, however, the absorption signal of the sensing system increased to a much high level, which could be attributed to the recovery of the pocket size and re-formation of Cu²⁺-specific DNA-cleaving DNAzyme. A linear relationship (R² = 0.9978) was observed with increasing Hg²⁺ concentrations from 10 to 100 nM. The calculated detection limit was 4.8 nM (Figure 5a), which was also lower than the 10 nM maximum contamination level set by the US EPA for drinking water. Among the tested competing metal ions, Fe³⁺ caused the largest absorbance signal enhancement (Figure 5b), but the signal enhancement caused by 20 µM Fe³⁺ was even lower than that caused by 60 nM Hg²⁺, indicating that the selectivity of the sensor for Hg²⁺ was at least 333-fold greater than that for Fe³⁺. As for other metal ions, the selectivity was much higher. Recovery experiments of water samples (the recovery was in the range 95.5-110.5%) suggested that the Hg²⁺ sensor was able to detect low concentrations of Hg²⁺ in real samples (Table S3).

Download:

Figure 5. Sensitivity and selectivity of the ‘turn-on’ Hg²⁺ sensor.

(a) Absorption signal response of the sensing system to Hg²⁺ concentration. The insert shows the absorption signal change in the Cu²⁺ concentration range of 10-100 nM. The solid line represents a linear fit to the data. (b) Selectivity of the proposed sensor for Hg²⁺ over other competing divalent metal ions. The absorption signal changes of the sensing system induced by different competing metal ions (20 µM) are shown. The concentrations of Hg²⁺ are shown at the top of the bars. All experiments were performed in triplicate.

https://doi.org/10.1371/journal.pone.0073012.g005

Conclusion

In summary, on the basis of G-quadruplex DNAzyme and a reconstructed Cu²⁺-specific DNAzyme, two label-free, cost-effective and simple Cu²⁺ sensors were designed. These two sensors followed different detection modes: ‘turn-on’ and ‘turn-off’. The ‘turn-on’ sensor enabled the selective detection of aqueous Cu²⁺ with a detection limit of 3.9 nM and a linear range of 8-200 nM. Visual detection was possible. The ‘turn-off’ one could be used as an important implement to reduce the possibility of pseudo-positive or pseudo-negative results. Combining the modulation of the pocket size in the Cu²⁺-specific DNAzyme and the switching of Cu²⁺-triggered DNA cleavage by the formation of T-Hg²⁺-T base mismatch, above dual DNAzymes-based strategy was further used for Hg²⁺ sensor design. The proposed sensor allowed the specific detection of Hg²⁺ ion with a detection of 4.8 nM. Visual detection was also possible.

Materials and Methods

Materials and reagents

All oligonucleotides (Table 1) were purchased from Sangon Biotech. Co. Ltd (Shanghai, China). The concentrations of the oligonucleotides were represented as single-stranded concentrations. Single-stranded concentrations were determined by measuring the absorbance at 260 nm. Molar extinction coefficients were determined using a nearest neighbour approximation. H₂O₂, 2,2′-azinobis(3-ethylbenzothiazoline)-6-sulfonic acid (ABTS), 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES), Triton X-100, L-ascorbic acid and the used metal salts (NaCl, KAc, Hg(Ac)₂, Mg(NO₃)₂, Cu(NO₃)₂, Mn(Ac)₂, Zn(Ac)₂, Pb(NO₃)₂, Ni(NO₃)₂, Co(Ac)₂, Fe(NO₃)₃ and Ca (Ac)₂) were obtained from Sigma. All chemical reagents were of analytical grade and used without further puriﬁcation.

Oligonucleotide strand	Sequence^a
MB-Cu1	5′-CTACCCAGCCTGGGCCTCTTTCTTCTTTTAGCTTCTTCTTTCTAATACGGCTGGGTAGGGCGGGTTGGG
MB-Cu2	5′-GGGTGGGTTAGCCTGGGCCTCTTTCTTCTTTTAGCTTCTTCTTTCTAATACGGCTTTGGGTGGG
MB-Hg1	5′-CTACCCAGCCTGGGTTTCTTGTTTCCTCTTTCTTCTTTTAGCTTCTTCTTTCTAATACGGCTGGGTAGGGCGGGTTGGG
MB-Hg2	5′-CTACCCAGCCTGGGTTCGAACGAACCTCTTTCTTCTTTTAGCTTCTTCTTTCTAATACGGCTGGGTAGGGCGGGTTGGG
PPO	5′-AAGAAGAAAGAAC

Table 1. The oligonucleotides used in this work.

aThe italic sequences represent the G-quadruplex-forming sequences; the underlined sequences represent the double-helix stem-forming sequences.

CSV

Download CSV

‘Turn-on’ colorimetric detection of Cu²⁺

The mixture of MB-Cu1 (0.5 µM) and PPO (1 µM) was prepared in 25 mM HEPES buffer (pH 7.0) containing 300 mM NaCl, 5 mM Mg(NO₃)₂ and 5 mM KAc. The mixture was heated to 80 °C for 2 min to remove any possible aggregates, then cooled slowly to 20 °C, and incubated at 20 °C for 60 min to form a stable triplex-helix structure. Subsequently, 2 µM L-ascorbic acid and different concentrations of Cu²⁺ were added to the mixture. After a quick vortex, the mixture was incubated at 20 °C for another 30 min. Then hemin (1 µM, final concentration) was added to the mixture. The mixture was held for 1 h at 20 °C. Then, ABTS (3.2 mM, final concentration) and H₂O₂ (2.2 mM, final concentration) were added. The final volume of the mixture was 100 µL. The absorption spectrum of the reaction product ABTS^•+ was recorded by a TU-1901 UV–vis spectrophotometer after the reaction had run for 4 min. The absorbance at 419 nm was used for quantitative analysis.

‘Turn-off’ colorimetric detection of Cu²⁺

The mixture of MB-Cu2 (0.2 µM) and PPO (0.4 µM) was prepared in 25 mM HEPES buffer (pH 7.0) containing 300 mM NaCl. The DNA solution was heated to 80 °C for 2 min, then cooled slowly to 20 °C, and incubated at 20 °C for 60 min to form a stable triplex-helix structure. Then, the other experimental conditions are the same as above.

‘Turn-on’ colorimetric detection of Hg²⁺

The mixture of MB-Hg1 (0.1 µM), PPO (0.2 µM) and Hg²⁺ (different concentration) was prepared in 25 mM HEPES buffer (pH 6.6) containing 200 mM NaAc, 5 mM Mg(NO₃)₂ and 5 mM KAc. The DNA solution was heated to 80 °C for 2 min, then cooled slowly to 20 °C, and incubated at 20 °C for 60 min to form a stable triplex-helix structure. Subsequently, 2 μM ascorbic acid and 2 µM Cu²⁺ were added to the mixture. Then, the other experimental conditions are the same as above.

Supporting Information

Table S1. Cu²⁺ recoveries determined by the ‘turn-on’ Cu²⁺ sensor.

https://doi.org/10.1371/journal.pone.0073012.s001

(DOC)

Table S2. Cu²⁺ recoveries determined by the ‘turn-off’ Cu²⁺ sensor.

https://doi.org/10.1371/journal.pone.0073012.s002

(DOC)

Table S3. Hg²⁺ recoveries determined by the ‘turn-on’ Hg²⁺ sensor.

https://doi.org/10.1371/journal.pone.0073012.s003

(DOC)

Author Contributions

Conceived and designed the experiments: DMK. Performed the experiments: HL XXH YC HJX QFZ. Analyzed the data: HL DMK. Contributed reagents/materials/analysis tools: DMK. Wrote the manuscript: HL DMK.

References

1. Yang X, Wang EK (2011) A nanoparticle autocatalytic sensor for Ag⁺ and Cu²⁺ ions in aqueous solution with high sensitivity and selectivity and its application in test paper. Anal Chem 83: 5005-5011. doi:https://doi.org/10.1021/ac2008465. PubMed: 21591668.
- View Article
- Google Scholar
2. Lin YW, Huang CC, Chang HT (2011) Gold nanoparticle probes for the detection of mercury, lead and copper ions. Analyst 136: 863-871. doi:https://doi.org/10.1039/c0an00652a. PubMed: 21157604.
- View Article
- Google Scholar
3. Liu J, Cao ZH, Lu Y (2009) Functional nucleic acid sensors. Chem Rev 109: 1948-1998. doi:https://doi.org/10.1021/cr030183i. PubMed: 19301873.
- View Article
- Google Scholar
4. Bravo-Sánchez LR, de la Riva BS, Costa-Fernández JM, Pereiro R, Sanz-Medel A (2011) Determination of lead and mercury in seawater by preconcentration in a flow injection system followed by atomic absorption spectrometry detection. Talanta 55: 1071-1078.
- View Article
- Google Scholar
5. Chang LF, Jiang SJ, Sahayam AC (2007) Speciation analysis of mercury and lead in fish samples using liquid chromatography-inductively coupled plasma mass spectrometry. J Chromatogr A 1176: 143-148. doi:https://doi.org/10.1016/j.chroma.2007.10.072. PubMed: 18001749.
- View Article
- Google Scholar
6. Lin ZZ, Li XH, Kraatz HB (2011) Impedimetric immobilized DNA-based sensor for simultaneous detection of Pb²⁺, Ag⁺, and Hg²+. Anal Chem 83: 6896-6901. doi:https://doi.org/10.1021/ac2014096. PubMed: 21797211.
- View Article
- Google Scholar
7. Li J, Lu Y (2000) A highly sensitive and selective catalytic DNA biosensor for lead ions. J Am Chem Soc 122: 10466-10467. doi:https://doi.org/10.1021/ja0021316.
- View Article
- Google Scholar
8. Lan T, Furuya K, Lu Y (2010) A highly selective lead sensor based on a classic lead DNAzyme. Chem Commun 46: 3896-3898. doi:https://doi.org/10.1039/b926910j.
- View Article
- Google Scholar
9. Liu JW, Lu Y (2004) Accelerated color change of gold nanoparticles assembled by DNAzymes for simple and fast colorimetric Pb2+ detection. J Am Chem Soc 126:12298-12305.
- View Article
- Google Scholar
10. Zhang XB, Wang Z, Xing H, Xiang Y, Lu Y (2010) Catalytic and molecular beacons for amplified detection of metal ions and organic molecules with high sensitivity. Anal Chem 82: 5005-5011. doi:https://doi.org/10.1021/ac1009047. PubMed: 20481627.
- View Article
- Google Scholar
11. Hollenstein M, Hipolito C, Dietrich DL, Perrin DM (2008) A highly selective DNAzyme sensor for mercuric ions. Angew Chem Int Ed 47: 4346-4350 doi:https://doi.org/10.1002/anie.200800960.
- View Article
- Google Scholar
12. Li J, Zheng W, Kwon AH, Lu Y (2000) In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. Nucleic Acids Res 28: 481-488. doi:https://doi.org/10.1093/nar/28.2.481. PubMed: 10606646.
- View Article
- Google Scholar
13. Liu J, Brown AK, Meng X, Cropek DM, Istok JD et al. (2007) A catalytic beacon sensor for uranium with parts-per-trillion sensitivity and millionfold selectivity. Proc Natl Acad Sci U S A 104: 2056-2061. doi:https://doi.org/10.1073/pnas.0607875104. PubMed: 17284609.
- View Article
- Google Scholar
14. Peracchi A (2000) Preferential activation of the 8-17 deoxyribozyme by Ca²⁺ ions. Evidence for the identity of 8-17 with the catalytic domain of the Mg5 deoxyribozyme. J Biol Chem 275: 11693-11697. doi:https://doi.org/10.1074/jbc.275.16.11693. PubMed: 10766789.
- View Article
- Google Scholar
15. Wen ZC, Yang R, He H, Jiang YB (2006) A highly selective charge transfer fluoroionophore for Cu²⁺. Chem Commun 42: 106-108.
- View Article
- Google Scholar
16. Xiang Y, Tong AJ, Lu Y (2009) Abasic site-containing DNAzyme and aptamer for label-free fluorescent detection of Pb²⁺ and adenosine with high sensitivity, selectivity, and tunable dynamic range. J Am Chem Soc 131: 15352-15357. doi:https://doi.org/10.1021/ja905854a. PubMed: 19807110.
- View Article
- Google Scholar
17. Liu J, Lu Y (2007) Rational design of "turn-on" allosteric DNAzyme catalytic beacons for aqueous mercury ions with ultrahigh sensitivity and selectivity. Angew Chem Int Ed 46: 7587-7590 doi:https://doi.org/10.1002/anie.200702006. PubMed: 17722216.
- View Article
- Google Scholar
18. Carmi N, Balkhi SR, Breaker RR (1998) Cleaving DNA with DNA. Proc Natl Acad Sci U S A 95: 2233-2237. doi:https://doi.org/10.1073/pnas.95.5.2233. PubMed: 9482868.
- View Article
- Google Scholar
19. Carmi N, Breaker RR (2001) Characterization of a DNA-cleaving deoxyribozyme. Bioorg Med Chem 9: 2589-2600. doi:https://doi.org/10.1016/S0968-0896(01)00035-9. PubMed: 11557347.
- View Article
- Google Scholar
20. Li H, Huang XX, Kong DM, Shen HX (2013) Ultrasensitive, high temperature and ionic strength variation-tolerant Cu²⁺ fluorescent sensor based on reconstructed Cu²⁺-dependent DNAzyme/substrate complex. Biosens Bioelectron 42: 225-228. doi:https://doi.org/10.1016/j.bios.2012.10.070. PubMed: 23208090.
- View Article
- Google Scholar
21. Kosman J, Juskowiak B (2011) Peroxidase-mimicking DNAzymes for biosensing applications: a review. Anal Chim Acta 707: 7-17. doi:https://doi.org/10.1016/j.aca.2011.08.050. PubMed: 22027115.
- View Article
- Google Scholar
22. Kong DM (2011) Applications of G-quadruplex-hemin DNAzymes in sensor design. Prog Chem 23: 2199–2131.
- View Article
- Google Scholar
23. Zhou XH, Kong DM, Shen HX (2010) Ag⁺ and cysteine quantitation based on G-quadruplex-hemin DNAzymes disruption by Ag⁺. Anal Chem 82: 789-793. doi:https://doi.org/10.1021/ac902421u. PubMed: 20039758.
- View Article
- Google Scholar
24. Li H, Zhang Q, Cai Y, Kong DM, Shen HX (2012) Single-stranded DNAzyme-based Pb²⁺ fluorescent sensor that can work well over a wide temperature range. Biosens Bioelectron 34: 159-164. doi:https://doi.org/10.1016/j.bios.2012.01.037. PubMed: 22370100.
- View Article
- Google Scholar
25. Tyagi S, Kramer FR (1996) Molecular beacons: probes that fluoresce upon hybridization. Nat Biotechnol 14: 303-308. doi:https://doi.org/10.1038/nbt0396-303. PubMed: 9630890.
- View Article
- Google Scholar
26. Yin BC, Ye BC, Tan WH, Wang H, Xie CC (2009) An allosteric Dual-DNAzyme unimolecular probe for colorimetric detection of copper. J Am Chem Soc Volumes II: 131:14624-14625.
- View Article
- Google Scholar
27. Fang Z, Huang J, Lie P, Xiao Z, Ouyang C et al. (2010) Lateral ﬂow nucleic acid biosensor for Cu²⁺ detection in aqueous solution with high sensitivity and selectivity. Chem Commun 46: 9043-9045. doi:https://doi.org/10.1039/c0cc02782k.
- View Article
- Google Scholar
28. Liu J, Lu Y (2007) Colorimetric Cu²⁺ detection with a ligation DNAzyme and nanoparticles. Chem Commun 43: 4872-4874. PubMed: 18361353.
- View Article
- Google Scholar
29. Wang Y, Yang F, Yang X (2010) Label-free colorimetric biosensing of copper(II) ions with unimolecular self-cleaving deoxyribozymes and unmodified gold nanoparticle probes. Nanotechnology 21: 205502. doi:https://doi.org/10.1088/0957-4484/21/20/205502. PubMed: 20418604.
- View Article
- Google Scholar
30. Kolpashchikov DM (2008) Split DNA enzyme for visual single nucleotide polymorphism typing. J Am Chem Soc 130: 2934-2935. doi:https://doi.org/10.1021/ja711192e. PubMed: 18281995.
- View Article
- Google Scholar
31. Xu J, Kong DM (2012) Specific Hg 2+ quantitation using intramolecular split G-quadruplex DNAzyme. Chin J Anal Chem 40:347-352.
- View Article
- Google Scholar
32. Clever GH, Kaul C, Carell T (2007) DNA--metal base pairs. Angew Chem Int Ed 46: 6226-6236 doi:https://doi.org/10.1002/anie.200701185. PubMed: 17640011.
- View Article
- Google Scholar
33. Kuklenyik Z, Marzilli LG (1996) Mercury(II) site-selective binding to a DNA hairpin. relationship of sequence-dependent intra- and interstrand cross-linking to the hairpin−duplex conformational transition. Inorg Chem 35: 5654-5662. doi:https://doi.org/10.1021/ic960260a. PubMed: 11666759.
- View Article
- Google Scholar
34. Katz S (1963) The reversible reaction of Hg (II) and double-stranded polynucleotides. A step-function theory and its significance. Biochim Biophys Acta 68: 240–253. doi:https://doi.org/10.1016/0926-6550(63)90435-3. PubMed: 14031334.
- View Article
- Google Scholar
35. Kong DM, Wu J, Wang N, Yang W, Shen HX (2009) Peroxidase activity-structure relationship of the intermolecular four-stranded G-quadruplex-hemin complexes and their application in Hg²+ ion detection. Talanta 80: 459-465. doi:https://doi.org/10.1016/j.talanta.2009.07.010. PubMed: 19836504.
- View Article
- Google Scholar

[ref1] 1. Yang X, Wang EK (2011) A nanoparticle autocatalytic sensor for Ag⁺ and Cu²⁺ ions in aqueous solution with high sensitivity and selectivity and its application in test paper. Anal Chem 83: 5005-5011. doi:https://doi.org/10.1021/ac2008465. PubMed: 21591668.
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Lin YW, Huang CC, Chang HT (2011) Gold nanoparticle probes for the detection of mercury, lead and copper ions. Analyst 136: 863-871. doi:https://doi.org/10.1039/c0an00652a. PubMed: 21157604.
View Article
Google Scholar

[5] View Article

[6] Google Scholar

[ref3] 3. Liu J, Cao ZH, Lu Y (2009) Functional nucleic acid sensors. Chem Rev 109: 1948-1998. doi:https://doi.org/10.1021/cr030183i. PubMed: 19301873.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref4] 4. Bravo-Sánchez LR, de la Riva BS, Costa-Fernández JM, Pereiro R, Sanz-Medel A (2011) Determination of lead and mercury in seawater by preconcentration in a flow injection system followed by atomic absorption spectrometry detection. Talanta 55: 1071-1078.
View Article
Google Scholar

[11] View Article

[12] Google Scholar

[ref5] 5. Chang LF, Jiang SJ, Sahayam AC (2007) Speciation analysis of mercury and lead in fish samples using liquid chromatography-inductively coupled plasma mass spectrometry. J Chromatogr A 1176: 143-148. doi:https://doi.org/10.1016/j.chroma.2007.10.072. PubMed: 18001749.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref6] 6. Lin ZZ, Li XH, Kraatz HB (2011) Impedimetric immobilized DNA-based sensor for simultaneous detection of Pb²⁺, Ag⁺, and Hg²+. Anal Chem 83: 6896-6901. doi:https://doi.org/10.1021/ac2014096. PubMed: 21797211.
View Article
Google Scholar

[17] View Article

[18] Google Scholar

[ref7] 7. Li J, Lu Y (2000) A highly sensitive and selective catalytic DNA biosensor for lead ions. J Am Chem Soc 122: 10466-10467. doi:https://doi.org/10.1021/ja0021316.
View Article
Google Scholar

[20] View Article

[21] Google Scholar

[ref8] 8. Lan T, Furuya K, Lu Y (2010) A highly selective lead sensor based on a classic lead DNAzyme. Chem Commun 46: 3896-3898. doi:https://doi.org/10.1039/b926910j.
View Article
Google Scholar

[23] View Article

[24] Google Scholar

[ref9] 9. Liu JW, Lu Y (2004) Accelerated color change of gold nanoparticles assembled by DNAzymes for simple and fast colorimetric Pb2+ detection. J Am Chem Soc 126:12298-12305.
View Article
Google Scholar

[26] View Article

[27] Google Scholar

[ref10] 10. Zhang XB, Wang Z, Xing H, Xiang Y, Lu Y (2010) Catalytic and molecular beacons for amplified detection of metal ions and organic molecules with high sensitivity. Anal Chem 82: 5005-5011. doi:https://doi.org/10.1021/ac1009047. PubMed: 20481627.
View Article
Google Scholar

[29] View Article

[30] Google Scholar

[ref11] 11. Hollenstein M, Hipolito C, Dietrich DL, Perrin DM (2008) A highly selective DNAzyme sensor for mercuric ions. Angew Chem Int Ed 47: 4346-4350 doi:https://doi.org/10.1002/anie.200800960.
View Article
Google Scholar

[32] View Article

[33] Google Scholar

[ref12] 12. Li J, Zheng W, Kwon AH, Lu Y (2000) In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme. Nucleic Acids Res 28: 481-488. doi:https://doi.org/10.1093/nar/28.2.481. PubMed: 10606646.
View Article
Google Scholar

[35] View Article

[36] Google Scholar

[ref13] 13. Liu J, Brown AK, Meng X, Cropek DM, Istok JD et al. (2007) A catalytic beacon sensor for uranium with parts-per-trillion sensitivity and millionfold selectivity. Proc Natl Acad Sci U S A 104: 2056-2061. doi:https://doi.org/10.1073/pnas.0607875104. PubMed: 17284609.
View Article
Google Scholar

[38] View Article

[39] Google Scholar

[ref14] 14. Peracchi A (2000) Preferential activation of the 8-17 deoxyribozyme by Ca²⁺ ions. Evidence for the identity of 8-17 with the catalytic domain of the Mg5 deoxyribozyme. J Biol Chem 275: 11693-11697. doi:https://doi.org/10.1074/jbc.275.16.11693. PubMed: 10766789.
View Article
Google Scholar

[41] View Article

[42] Google Scholar

[ref15] 15. Wen ZC, Yang R, He H, Jiang YB (2006) A highly selective charge transfer fluoroionophore for Cu²⁺. Chem Commun 42: 106-108.
View Article
Google Scholar

[44] View Article

[45] Google Scholar

[ref16] 16. Xiang Y, Tong AJ, Lu Y (2009) Abasic site-containing DNAzyme and aptamer for label-free fluorescent detection of Pb²⁺ and adenosine with high sensitivity, selectivity, and tunable dynamic range. J Am Chem Soc 131: 15352-15357. doi:https://doi.org/10.1021/ja905854a. PubMed: 19807110.
View Article
Google Scholar

[47] View Article

[48] Google Scholar

[ref17] 17. Liu J, Lu Y (2007) Rational design of "turn-on" allosteric DNAzyme catalytic beacons for aqueous mercury ions with ultrahigh sensitivity and selectivity. Angew Chem Int Ed 46: 7587-7590 doi:https://doi.org/10.1002/anie.200702006. PubMed: 17722216.
View Article
Google Scholar

[50] View Article

[51] Google Scholar

[ref18] 18. Carmi N, Balkhi SR, Breaker RR (1998) Cleaving DNA with DNA. Proc Natl Acad Sci U S A 95: 2233-2237. doi:https://doi.org/10.1073/pnas.95.5.2233. PubMed: 9482868.
View Article
Google Scholar

[53] View Article

[54] Google Scholar

[ref19] 19. Carmi N, Breaker RR (2001) Characterization of a DNA-cleaving deoxyribozyme. Bioorg Med Chem 9: 2589-2600. doi:https://doi.org/10.1016/S0968-0896(01)00035-9. PubMed: 11557347.
View Article
Google Scholar

[56] View Article

[57] Google Scholar

[ref20] 20. Li H, Huang XX, Kong DM, Shen HX (2013) Ultrasensitive, high temperature and ionic strength variation-tolerant Cu²⁺ fluorescent sensor based on reconstructed Cu²⁺-dependent DNAzyme/substrate complex. Biosens Bioelectron 42: 225-228. doi:https://doi.org/10.1016/j.bios.2012.10.070. PubMed: 23208090.
View Article
Google Scholar

[59] View Article

[60] Google Scholar

[ref21] 21. Kosman J, Juskowiak B (2011) Peroxidase-mimicking DNAzymes for biosensing applications: a review. Anal Chim Acta 707: 7-17. doi:https://doi.org/10.1016/j.aca.2011.08.050. PubMed: 22027115.
View Article
Google Scholar

[62] View Article

[63] Google Scholar

[ref22] 22. Kong DM (2011) Applications of G-quadruplex-hemin DNAzymes in sensor design. Prog Chem 23: 2199–2131.
View Article
Google Scholar

[65] View Article

[66] Google Scholar

[ref23] 23. Zhou XH, Kong DM, Shen HX (2010) Ag⁺ and cysteine quantitation based on G-quadruplex-hemin DNAzymes disruption by Ag⁺. Anal Chem 82: 789-793. doi:https://doi.org/10.1021/ac902421u. PubMed: 20039758.
View Article
Google Scholar

[68] View Article

[69] Google Scholar

[ref24] 24. Li H, Zhang Q, Cai Y, Kong DM, Shen HX (2012) Single-stranded DNAzyme-based Pb²⁺ fluorescent sensor that can work well over a wide temperature range. Biosens Bioelectron 34: 159-164. doi:https://doi.org/10.1016/j.bios.2012.01.037. PubMed: 22370100.
View Article
Google Scholar

[71] View Article

[72] Google Scholar

[ref25] 25. Tyagi S, Kramer FR (1996) Molecular beacons: probes that fluoresce upon hybridization. Nat Biotechnol 14: 303-308. doi:https://doi.org/10.1038/nbt0396-303. PubMed: 9630890.
View Article
Google Scholar

[74] View Article

[75] Google Scholar

[ref26] 26. Yin BC, Ye BC, Tan WH, Wang H, Xie CC (2009) An allosteric Dual-DNAzyme unimolecular probe for colorimetric detection of copper. J Am Chem Soc Volumes II: 131:14624-14625.
View Article
Google Scholar

[77] View Article

[78] Google Scholar

[ref27] 27. Fang Z, Huang J, Lie P, Xiao Z, Ouyang C et al. (2010) Lateral ﬂow nucleic acid biosensor for Cu²⁺ detection in aqueous solution with high sensitivity and selectivity. Chem Commun 46: 9043-9045. doi:https://doi.org/10.1039/c0cc02782k.
View Article
Google Scholar

[80] View Article

[81] Google Scholar

[ref28] 28. Liu J, Lu Y (2007) Colorimetric Cu²⁺ detection with a ligation DNAzyme and nanoparticles. Chem Commun 43: 4872-4874. PubMed: 18361353.
View Article
Google Scholar

[83] View Article

[84] Google Scholar

[ref29] 29. Wang Y, Yang F, Yang X (2010) Label-free colorimetric biosensing of copper(II) ions with unimolecular self-cleaving deoxyribozymes and unmodified gold nanoparticle probes. Nanotechnology 21: 205502. doi:https://doi.org/10.1088/0957-4484/21/20/205502. PubMed: 20418604.
View Article
Google Scholar

[86] View Article

[87] Google Scholar

[ref30] 30. Kolpashchikov DM (2008) Split DNA enzyme for visual single nucleotide polymorphism typing. J Am Chem Soc 130: 2934-2935. doi:https://doi.org/10.1021/ja711192e. PubMed: 18281995.
View Article
Google Scholar

[89] View Article

[90] Google Scholar

[ref31] 31. Xu J, Kong DM (2012) Specific Hg 2+ quantitation using intramolecular split G-quadruplex DNAzyme. Chin J Anal Chem 40:347-352.
View Article
Google Scholar

[92] View Article

[93] Google Scholar

[ref32] 32. Clever GH, Kaul C, Carell T (2007) DNA--metal base pairs. Angew Chem Int Ed 46: 6226-6236 doi:https://doi.org/10.1002/anie.200701185. PubMed: 17640011.
View Article
Google Scholar

[95] View Article

[96] Google Scholar

[ref33] 33. Kuklenyik Z, Marzilli LG (1996) Mercury(II) site-selective binding to a DNA hairpin. relationship of sequence-dependent intra- and interstrand cross-linking to the hairpin−duplex conformational transition. Inorg Chem 35: 5654-5662. doi:https://doi.org/10.1021/ic960260a. PubMed: 11666759.
View Article
Google Scholar

[98] View Article

[99] Google Scholar

[ref34] 34. Katz S (1963) The reversible reaction of Hg (II) and double-stranded polynucleotides. A step-function theory and its significance. Biochim Biophys Acta 68: 240–253. doi:https://doi.org/10.1016/0926-6550(63)90435-3. PubMed: 14031334.
View Article
Google Scholar

[101] View Article

[102] Google Scholar

[ref35] 35. Kong DM, Wu J, Wang N, Yang W, Shen HX (2009) Peroxidase activity-structure relationship of the intermolecular four-stranded G-quadruplex-hemin complexes and their application in Hg²+ ion detection. Talanta 80: 459-465. doi:https://doi.org/10.1016/j.talanta.2009.07.010. PubMed: 19836504.
View Article
Google Scholar

[104] View Article

[105] Google Scholar

Label-Free Detection of Cu²⁺ and Hg²⁺ Ions Using Reconstructed Cu²⁺-Specific DNAzyme and G-quadruplex DNAzyme

Label-Free Detection of Cu²⁺ and Hg²⁺ Ions Using Reconstructed Cu²⁺-Specific DNAzyme and G-quadruplex DNAzyme

Correction

Figures

Abstract

Introduction