Figures
Abstract
Purpose
Both telomere length and mitochondrial function are accepted as reflective indices of aging. Recent studies have shown that telomere dysfunction may influence impaired mitochondrial biogenesis and function. However, there has been no study regarding the possible association between telomere and mitochondrial function in humans. Therefore, the purpose of the study was to identify any relationships between mitochondrial and telomere function.
Methods
The present study included 129 community-dwelling, elderly women. The leukocyte mitochondrial DNA copy number and telomere length were measured using a quantitative real-time polymerase chain reaction method. Anthropometric measurement, biochemical blood testing, a depression screening questionnaire using a 15-question geriatric depression scale (GDS-15), and a cognitive function test using the Korean version of the mini mental state examination (K-MMSE) were performed.
Results
Leukocyte mtDNA copy number was positively associated with telomere length (r=0.39, p=<0.0001) and K-MMSE score (r=0.06, p=0.02). Additionally, leukocyte mtDNA copy number was negatively correlated with GDS-15 score (r=-0.17, p=0.04). Age (r=-0.15, p=0.09), waist circumference (r=-0.16, p=0.07), and serum ferritin level (r=-0.13, p=0.07) tended to be inversely correlated with leukocyte mtDNA copy number. With a stepwise multiple regression analysis, telomere length was found to be an independent factor associated with leukocyte mtDNA copy number after adjustment for confounding variables including age, body mass index, waist circumference, total cholesterol, HDL-cholesterol, LDL-cholesterol, triglycerides, hs-CRP, serum ferritin, HOMA-IR, K-MMSE, GDS-15, hypertension, diabetes, dyslipidemia, currently smoking, alcohol drinking, and regular exercise.
Citation: Kim J-H, Kim HK, Ko J-H, Bang H, Lee D-C (2013) The Relationship between Leukocyte Mitochondrial DNA Copy Number and Telomere Length in Community-Dwelling Elderly Women. PLoS ONE 8(6): e67227. https://doi.org/10.1371/journal.pone.0067227
Editor: Jose Vina, University of Valencia, Spain
Received: March 18, 2013; Accepted: May 15, 2013; Published: June 13, 2013
Copyright: © 2013 Kim et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: No current external funding sources for this study
Competing interests: The authors have declared that no competing interests exist.
Introduction
Mitochondria are the cellular energy-generation organelles that convert ingested food into adenosine triphosphate (ATP) using the electron transport chain. In this process, reactive oxygen species (ROS) are produced as necessary by-products and can easily lead to mitochondrial DNA damage and respiratory chain impairment [1]. Mitochondria also play an essential role in cell proliferation, differentiation and apoptosis [2]. Functional changes in mitochondria may be associated with aging, age-related conditions or disorders, and age-related loss of vigor [3,-5]. Therefore, mitochondrial gene stability and biogenesis are necessary for maintaining the functions of cells, tissues and organs.
Telomeres are repetitive sequences of DNA (TTAGGG) located at the ends of mammalian chromosomes and contribute to the stability and function of chromosomes [6]. Telomere length is influenced not only by birth telomere length as the genetic factor [7] but also by inflammation, oxidative stress, or psychosocial as environmental factors [8,-10]. Leukocyte telomere length decreases in length with age, and its shortening is thought to be associated with increased aging-related diseases, such as cardiovascular disease, dementia and type 2 diabetes mellitus, as well as overall mortality [11,,-14]. Furthermore, telomere length in red blood cells is a strong predictor of lifespan in birds [15]. Therefore, telomere length has been deemed a useful marker for monitoring aging.
Both telomere length and mitochondrial function are generally accepted as being reflective of aging. Recent studies showed that telomere dysfunction including shortening is associated with impaired mitochondrial biogenesis and function, as well as increased ROS level [16]. It has been suggested that the telomere-p53-peroxisome proliferator-activated receptor gamma coactivator (PGC) axis has a direct connection with telomere dysfunction and mitochondrial compromise in a telomere dysfunction mouse model [16].
However, there has been no study about the possible association between telomere and mitochondrial function in humans. Therefore, the purpose of the present study was to determine the relationship between mitochondrial and telomere functions using leukocyte mtDNA copy number and telomere length.
Patients and Methods
Ethics Statement
All subjects participated in the study voluntarily, and written informed consent was obtained from each participant. The study complied with the Declaration of Helsinki and the institutional review board of Gangnam Severance Hospital approved this study.
Study subjects
The Yonsei Aging Study was designed to identify factors related to cognitive function, physical performance and the aging process in community dwelling, otherwise healthy elderly people in Korea [17,18]. In all, 200 elderly people were recruited through public health centers located in the Yangpyung and Ilsan districts in 2008. In this cross-sectional study, we included 129 women over the age of 60 years. The subjects had no previous diagnoses of dementia, Parkinson’s disease, stroke, ischemic heart disease, congestive heart failure, arrhythmia, depression, cancer, thyroid disorders, or chronic renal disease. Patients who were taking estrogen or those with histories of estrogen replacement therapy were excluded. Additionally, individuals with serious cognitive dysfunction (MMSE score ≤10) or functional impairment of Activities of Daily Living and Instrumental Activities of Daily Living (score >0) were also ruled out.
Assessment of clinical parameters
All subjects completed a lifestyle questionnaire which assessed alcohol consumption, smoking status, physical exercise, current medications, and medication history. Alcohol consumption was defined as the consumption of one or more drinks per week. Patients who reported that they smoked at the time of the study were considered to have a smoking habit. Regular exercise was defined as physical exercise performed for at least 30 min more than three times each week.
One highly trained examiner conducted all of the anthropometric measurements. Body weight was measured to the nearest 0.1 kg using an electronic scale while participants wore light clothing and no shoes. Height was measured to the nearest 0.1 cm using a stadiometer. Waist circumference was measured midway between the lowest rib and the iliac crest while participants stood upright, and hip circumference was measured at the maximal protrusion of the greater trochanter. Body mass index (BMI) was calculated as weight/height2 (kg/m2). Bioelectrical impedence analysis was used to estimate body fat percentage using an Inbody 3.0 meter (Biospace, Seoul, Korea). Blood pressure was measured in the sitting position after a 10-min rest period.
Biochemical tests were performed on blood samples collected after overnight fasting (>12 hours). Serum levels of fasting glucose, total cholesterol, HDL-cholesterol, triglycerides, and high-sensitivity C-reactive protein (hs-CRP) were measured using an ADVIA 1650 Chemistry System (Siemens, Tarrytown, NY, USA). Low-density lipoprotein (LDL)-cholesterol was calculated using Friedewald’s formula [LDL-cholesterol=total cholesterol − high-density liproprotein (HDL)-cholesterol − (triglycerides/5)] if the serum triglyceride level was below 400 mg/dL. Fasting insulin level was measured by electrochemiluminescence immunoassay (Roche, Indianapolis, IN, USA), and insulin resistance was estimated using the homeostasis model assessment of insulin resistance (HOMA-IR) index [(insulin (µlU/ml) × fasting blood glucose (mg/dl)/18)/22.5]. Ferritin level was assayed using an Immulite 2000 (Siemens, Tarrytown, NY, USA). The hypertension group was defined as patients with systolic BP ≥140 mmHg or diastolic BP ≥90 mmHg or use of anti-hypertensive medication. The diabetes group was defined as participants with fasting blood glucose ≥126 mg/dL or those who used insulin or hypoglycemic medication. The dyslipidemia group was defined as patients with hypercholesterolemia (>240 mg/dL), hypertriglyceridemia (≥150 mg/dL), low HDL-cholesterol (<50 mg/dL), or those using lipid-lowering agents.
Assessment of depression and cognitive function
For screening of depression, we used the validated Korean version of the short-form Geriatric Depression Scale (GDS-15), which consists of 15 questions [19]. Cognitive function was evaluated with the Korean Mini-Mental State Examination (K-MMSE). Both questionnaires were administered by two experienced family physicians who fully understood their use.
Measurement of leukocyte mitochondrial DNA (mtDNA) copy number
DNA from peripheral leukocytes was extracted from 1 ml of whole blood using a commercial kit (Qiagen Inc, Valencia, CA, USA). The relative mtDNA copy number was measured using real-time polymerase chain reaction (RT-PCR) with the Light Cycler-Fast Start DNA Master SYBR Green I kit from Roche Molecular Biochemicals (Pleasanton, CA, USA). mtDNA quantity was normalized by simultaneous measurement of the nuclear gene β-globin [20]. Forward and reverse primers for β-globin were 5′-GAAGAGCCAAGGACAGGTAC-3′ and 5′-CAACTTCATCCACGTTCACC-3′, respectively, and forward and reverse primers for the mitochondrial ND1 gene were 5′-AACATACCCATGGCCAACCT-3′ and 5′-AGCGAAGGGTTGTAGTAGCCC-3′, respectively. After denaturation at 95 °C for 300 s, DNA samples were subjected to 40 cycles of incubation at 95 °C for 0.1 s, 58 °C for 6 s, and 72 °C for 18 s. The number of PCR cycles necessary to produce 20 ng of DNA product was defined as the threshold cycle number (Ct), and the mtDNA copy number was calculated using the following equation: relative copy number = 2ΔCt (ΔCt = Ctβ-globin − CtND1).
Measurement of leukocyte telomere length
Genomic DNA was extracted from whole blood using the G-spinTM Genomic DNA Extraction Kit for Blood (iNtRON Biotechnology Inc., Korea). All DNA samples were diluted to the same concentration (based on ultraviolet (UV) absorbance) and stored at -80°C until use. Leukocyte telomere length was measured as telomere repeat copy number relative to single gene copy number (T/S ratio) by quantitative real-time PCR, as previously described by Cawthon [21]. Real-time PCR was performed using a LightCycler 2.0 (Roche, Mannheim, Germany), and the rate of accumulation of amplified DNA was measured by continuous monitoring with the LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostic, Mannheim, Germany), with MgCl2 at a final concentration of 2 mM. The primers for the telomere PCR were 200 nmol/L of 5'-GGTTTTTGAGGGT GAGGGTGAGGGTGAGGGTGAGGGT-3' and 200 nmol/L of 5'-TCCCGACTATCCC TATCCCTATCCCTATCCCTATCC CTA-3'. The primers for the beta-globin PCR were 300 nmol/L of 5’-GCTTCTGACACAACTGTGTTCACTAGC-3' and 500 nmol/L of 5'-CACCAACTTCATCCACGTTCACC-3'. The thermal cycling profile for telomere amplification was 95°C for 10 min followed by 25 cycles of 95°C for 10 s and 58°C for 1 min; the beta-globin amplification was 95°C for 10 min followed by 35 cycles of 95°C for 10 s and 56°C for 15s. Each sample was run in duplicate using 25 ng of DNA per 10 µl reaction. A no-template control was included in each run, and the same calibrator sample was used in all runs to allow comparison of results across runs. A melting curve analysis was performed on every run to verify specificity and identity of the PCR products. Quantitative values were obtained from the Ct value at which a single increase associated with exponential growth of PCR products was detected using LightCycler analysis software. The Ct values were used to calculate the T/S ratio for each sample using the following equation: T/S=2−ΔCt (where ΔCt = Ctsingle-copy gene-Cttelomere). The coefficients of variation (CV) of the telomere, single-gene and T/S ratio duplicate assays were <4%, <3%, and <5%, respectively.
Statistical analyses
Data are presented as mean ± standard deviation (SD) in a normal distribution, median with interquartile range (IQR, 25th-75th percentile) in non-normal distribution or number (%) in categorical variables. Insulin, HOMA-IR, hs-CRP, triglycerides, serum ferritin, and mtDNA copy numbers were logarithmically transformed prior to statistical analyses in order to approximate a normal distribution. Pearson correlation coefficients were calculated to evaluate the relationships between mtDNA copy number and the continuous variables. Significance was defined at the 0.05 level of confidence. We performed a stepwise multiple linear regression analysis to exclude the influences of potential confounding variables. Significance for entry into the model used the 0.15 level automatically determined in the stepwise regression. All calculations were performed using the SAS 9.1 statistics package (SAS Institute, Inc., Cary, NC, US).
Results
The mean age of the participants was 73.74±6.99 years, and the mean log transformed mtDNA copy number and telomere length were 0.63±0.25 and 0.91±0.36, respectively. Table 1 shows the clinical characteristics of the study participants.
| Variables | Value | |
|---|---|---|
| Age (years) | 73.74 ± 6.99 | |
| Body mass index (kg/m2) | 25.23 ± 3.25 | |
| Waist circumference (cm) | 87.87 ± 8.81 | |
| Cardiometabolic parameters | ||
| Systolic blood pressure (mmHg) | 131.04 ± 16.98 | |
| Diastolic blood pressure (mmHg) | 73.66 ± 10.32 | |
| Fasting glucose (mg/dL) | 100.38 ± 24.59 | |
| Fasting insulin (µIU/mL) | 5.91 (4.04-9.21) | |
| HOMA-IR | 1.42 (0.90-2.26) | |
| Total cholesterol (mg/dL) | 188.62 ± 36.84 | |
| High-density lipoprotein cholesterol (mg/dL) | 53.43 ± 12.73 | |
| Low-density lipoprotein cholesterol (mg/dL) | 108.89 ± 35.59 | |
| Triglyceride (mg/dL) | 110 (89-55) | |
| High-sensitivity C-reactive protein (mg/mL) | 0.10 (0.053-0.172) | |
| Ferritin (ng/mL) | 76.39 (54.39-110.90) | |
| Log mitochondrial DNA copy number | 0.63 ± 0.25 | |
| Telomere length (T/S ratio) | 0.91 ± 0.36 | |
| Mental function | ||
| Korean mini-mental state examination (score) | 24.58 ± 4.18 | |
| Geriatric depression scales-15 (score) | 6.31 ± 3.78 | |
| Hypertension | 80 (62.02) | |
| Diabetes | 21 (16.28) | |
| Dyslipidemia | 64 (49.61) | |
| Regular exercise | 62 (48.06) | |
| Alcohol drinking | 6 (4.65) | |
| Current smoking | 4 (3.10) | |
Table 1. Clinical characteristics of study subjects (N=129).
Table 2 shows the associations between leukocyte mtDNA copy number and measured parameters. In univariate analyses, leukocyte mtDNA copy number was positively associated with K-MMSE score (r=0.06, p=0.02). Additionally, leukocyte mtDNA copy number was negatively correlated with GDS-15 score (r=-0.17, p=0.04). Age (r=-0.15, p=0.09), waist circumference (r=-0.16, p=0.07), and serum ferritin level (r=-0.13, p=0.07) tended to be inversely correlated with leukocyte mtDNA copy number, although the relationship was not statistically significant. Figure 1 shows the relationship between leukocyte mtDNA copy number and telomere length (r=0.39, p=<0.0001).
| Variables | r | P-value |
|---|---|---|
| Age | -0.15 | 0.09 |
| Body mass index | -0.01 | 0.90 |
| Waist circumference | -0.16 | 0.07 |
| Cardiometabolic parameters | ||
| Systolic blood pressure | -0.07 | 0.45 |
| Diastolic blood pressure | 0.02 | 0.81 |
| Fasting glucose | -0.05 | 0.12 |
| Fasting insulin | 0.08 | 0.36 |
| HOMA-IR | -0.12 | 0.10 |
| Total cholesterol | 0.02 | 0.78 |
| High-density lipoprotein cholesterol | 0.13 | 0.11 |
| Low-density lipoprotein cholesterol | -0.07 | 0.46 |
| Triglyceride | 0.02 | 0.80 |
| High-sensitivity C-reactive protein | -0.04 | 0.67 |
| Ferritin | -0.13 | 0.07 |
| Mental function | ||
| Korean mini-mental state examination | 0.06 | 0.02 |
| Geriatric depression scales-15 | -0.17 | 0.04 |
Table 2. Correlation between leukocyte mtDNA copy numbers and various parameters.
Values of mtDNA copy number were analyzed after log-transformation. p-values were calculated by Pearson’s correlation.
Table 3 shows the independent associations between telomere length and mtDNA copy number. The multivariate model explained 16% of the variance of mtDNA copy number by telomere length (β=0.253, p=<0.0001), 3% by current smoking (β=-0.028, p=0.03), 3% by hypertension (β=-0.091, p=0.03), 2% by serum ferritin (β=-0.056, p=0.06), and 1% by waist circumference (β=-0.004, p=0.12) in stepwise multiple regression analysis that included age, BMI, waist circumference, total cholesterol, HDL-cholesterol, LDL-cholesterol, triglycerides, hs-CRP, serum ferritin, HOMA-IR, K-MMSE score, GDS-15 score, hypertension, diabetes, dyslipidemia, current smoking, alcohol drinking, and regular exercise.
| β coefficient | SE | F-value | P-value | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Telomere length | 0.253 | 0.056 | 23.12 | <0.0001 | |||||
| Current smoking | -0.028 | 0.012 | 5.06 | 0.03 | |||||
| Hypertension | -0.091 | 0.040 | 4.66 | 0.03 | |||||
| Ferritin | -0.056 | 0.032 | 3.50 | 0.06 | |||||
| Waist circumference | -0.004 | 0.002 | 2.47 | 0.12 |
Table 3. Stepwise multiple regression analysis for leukocyte mtDNA copy number.
Discussion
This study showed that leukocyte mtDNA copy number was positively correlated with leukocyte telomere length in elderly women. We also found that leukocyte telomere length was an independent factor associated with leukocyte mtDNA copy number after adjusting for potential confounders including age, obesity and inflammatory indices in a stepwise multiple linear regression analysis.
Recently, many studies have shown that a low leukocyte mtDNA copy number is correlated with mitochondrial-related metabolic disorders or conditions, such as insulin resistance [22,23], glucose dysregulation [24], non-alcoholic fatty liver disease [25], elevated homocysteine level [26], and hyperlipidemia [27]. Therefore, leukocyte mtDNA copy number could not only be related with mitochondrial biogenesis reflecting mitochondrial function, but also might be used as a surrogate marker of numerous metabolic diseases associated with mitochondrial dysfunction. Mitochondrial dysfunction may additionally be related to the aging process [1,2,4,5]. The increase of ROS production and the decrease of ATP generation in the mitochondria both play a pivotal role in cellular aging, and mitochondrial dysfunction can lead to aging-associated conditions or disorders such as neurodegenerative diseases, sarcopenia and malignancy [3].
The mitochondrial circular genomes that encode 37 genes are composed only of respiratory complex subunits and some mitochondrial tRNA and rRNA [28]. Therefore, in the regulation of mitochondrial biogenesis as well as various functions including cellular respiration, nuclear proteins play an important role through the expression of nuclear-encoded genes. These proteins which regulate mitochondrial functions include transcription factors such as nuclear respiratory factor (NRF)-1 and peroxisome proliferator-activated receptor (PPAR) α and γ, transcriptional coactivator such as PGC-1α and -1β, and enzymes such as Sirt1 (NAD+-dependent deacetylase), AMP-activated protein kinase, and the mammalian target of rapamycin (mTOR, kinase) [28]. Interestingly, a recent study showed that telomeres, the nucleoprotein complexes found at chromosome ends, can influence not only oxidative defense mechanisms, but also mitochondrial function, including biogenesis and metabolism in transcriptomic, molecular, genetic, and functional analyses of various cells or organs such as proliferative and post-mitotic tissues [16]. Further impaired mitochondrial biogenesis and decreased energy production were observed in telomerase-deficient mice with severe telomere dysfunction compared to that in telomerase-deficient mice with largely intact telomeres [16]. It has been suggested that p53 induced by telomere dysfunction and PGCs repressed by the p53 or directly by telomere dysfunction act as potential pathophysiologic mediators between telomere dysfunction and mitochondrial compromise [16]. Therefore, this telomere-p53-PGC-mitochondria axis may explain why shortened telomeres lead to metabolic deterioration related to biological aging.
Caloric restriction (CR), the reduction of total caloric intake while still maintaining adequate nutrition, is the most effective and useful manner to increase the lifespan [29,-31] and is also associated with improvement of metabolic compromises and prevention of aging-related disorders [32,33]. The longer lifespan associated with CR is involved in increased mitochondrial mass and respiration [34]. Although it has been reported that proteins, such as Sirt1, play a key role in the interaction of CR and lifespan lengthening [34], the mechanism of longevity extension by CR is not fully understood. A recent study suggested that adult-onset, short-term CR may prevent telomere shortening without increased telomerase activity or reduced oxidative damage in the small intestine and the liver of mice [35]. A conflicting result has also been reported regarding the effects of CR on telomere function. Long-term CR did not influence telomere length in leukocytes or muscles of rhesus monkeys [36]. In humans, further research will be needed to clarify the relationship between CR and telomere function/dynamics. However, the possibility cannot be excluded that improvement of mitochondrial function via preservation of telomere function is involved in other mechanisms of CR-associated health benefits.
Serum ferritin reflects body iron stores and is known to be an index of oxidative stress [37]. It has been reported that increased serum ferritin level is associated with insulin resistance [38], chronic inflammation [39] and metabolic syndrome [40]. Additionally, cigarette smoke contains many oxidants [41], and smokers show an elevated oxidative stress status [42]. In our study, serum ferritin concentration and current cigarette smoking status were inversely correlated with leukocyte mtDNA copy number. These results support the previous findings that oxidative stress can lead to a decrease in mitochondrial biogenesis.
Increasing evidence also indicates that there is a highly significant association between mitochondrial dysfunction and vascular diseases such as hypertension [43,,,-47]. It has been suggested that mitochondrial dysfunction, related to elevated ROS production [43,-45], increased mitochondrial Ca2+ accumulation [46], and polymorphisms of mitochondria-shaping genes [47], may act as potential pathophysiological mechanisms in hypertension. We also found that patients in the hypertension group consistently showed decreased mtDNA copy numbers in this study.
This study has some limitations. First, it is difficult to identify the mechanisms that underlie the relationship between leukocyte mtDNA copy number and telomere length with a cross-sectional study design. Second, our results may not be generalizable to men or adults because our subjects are only elderly women. Third, the small sample size of our study is another limitation. Although our results showed a positive association between leukocyte mtDNA copy number and telomere length, further study is needed for a valid conclusion. Fourth, we did not examine mitochondrial biogenesis in skeletal muscle, which is generally accepted as the gold standard for evaluation of mitochondrial function. However, repair and regeneration of skeletal muscle, a post-mitotic tissue, may be limited, and most studies relating to the human telomeres use leukocytes, since peripheral blood can be obtained with a relatively noninvasive procedure. It has been suggested that the mtDNA content of the peripheral blood may reflect mtDNA density of muscle and liver tissue in rats [48]. And, data of telomere length and mtDNA copy number, provided in the same resources, could impart coherence in interpretation of results. Finally, we did not measure the levels of oxidative stress and therefore cannot directly investigate the role of oxidative stress as a mediator between leukocyte mtDNA copy number and telomere length. In spite of these limitations, this study was the first to show the relationship between mitochondrial biogenesis and telomere length in humans.
In conclusion, this study showed that leukocyte mtDNA copy number was positively correlated with leukocyte telomere length in community-dwelling elderly women. Our findings suggest that telomere function may influence mitochondrial function in humans. Further studies are needed to clearly examine the associations not only between mitochondrial and telomere function, but also between mitochondrial dysfunction-dependent metabolic disorders and telomere dysfunction.
Author Contributions
Conceived and designed the experiments: J.H. Kim KHK J.H. Ko HB DCL. Performed the experiments: J.H. Kim KHK DCL. Analyzed the data: J.H. Kim DCL. Contributed reagents/materials/analysis tools: J.H. Ko HB. Wrote the manuscript: J.H. Kim HB DCL.
References
- 1. Wei YH, Lu CY, Lee HC, Pang CY, Ma YS (1998) Oxidative damage and mutation to mitochondrial DNA and age-dependent decline of mitochondrial respiratory function. Ann N Y Acad Sci 854: 155-170. doi:https://doi.org/10.1111/j.1749-6632.1998.tb09899.x. PubMed: 9928427.
- 2. Kiefel BR, Gilson PR, Beech PL (2006) Cell biology of mitochondrial dynamics. Int Rev Cytol 254: 151-213. doi:https://doi.org/10.1016/S0074-7696(06)54004-5. PubMed: 17147999.
- 3. Wallace DC (2005) A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet 39: 359-407. doi:https://doi.org/10.1146/annurev.genet.39.110304.095751. PubMed: 16285865.
- 4. Balaban RS, Nemoto S, Finkel T (2005) Mitochondria, oxidants, and aging. Cell 120: 483-495. doi:https://doi.org/10.1016/j.cell.2005.02.001. PubMed: 15734681.
- 5. Conley KE, Marcinek DJ, Villarin J (2007) Mitochondrial dysfunction and age. Curr Opin Clin Nutr Metab Care 10: 688-692. doi:https://doi.org/10.1097/MCO.0b013e3282f0dbfb. PubMed: 18089948.
- 6. Eisenberg DT (2011) An evolutionary review of human telomere biology: the thrifty telomere hypothesis and notes on potential adaptive paternal effects. Am J Hum Biol 23: 149-167. doi:https://doi.org/10.1002/ajhb.21127. PubMed: 21319244.
- 7. Njajou OT, Cawthon RM, Damcott CM, Wu SH, Ott S et al. (2007) Telomere length is paternally inherited and is associated with parental lifespan. Proc Natl Acad Sci U S A 104: 12135-12139. doi:https://doi.org/10.1073/pnas.0702703104. PubMed: 17623782.
- 8. Epel ES (2009) Psychological and metabolic stress: a recipe for accelerated cellular aging? Hormones (Athens) 8: 7-22. PubMed: 19269917.
- 9. Alder JK, Guo N, Kembou F, Parry EM, Anderson CJ et al. (2011) Telomere length is a determinant of emphysema susceptibility. Am J Respir Crit Care Med 184: 904-912. doi:https://doi.org/10.1164/rccm.201103-0520OC. PubMed: 21757622.
- 10. Entringer S, Epel ES, Kumsta R, Lin J, Hellhammer DH et al. (2011) Stress exposure in intrauterine life is associated with shorter telomere length in young adulthood. Proc Natl Acad Sci U S A 108: E513-E518. doi:https://doi.org/10.1073/pnas.1107759108. PubMed: 21813766.
- 11. Cawthon RM, Smith KR, O’Brien E, Sivatchenko A, Kerber RA (2003) Association between telomere length in blood and mortality in people aged 60 years or older. Lancet 361: 393-395. doi:https://doi.org/10.1016/S0140-6736(03)12384-7. PubMed: 12573379.
- 12. Mainous AG 3rd, Codd V, Diaz VA, Schoepf UJ, Everett CJ et al. (2010) Leukocyte telomere length and coronary artery calcification. Atherosclerosis 210: 262-267. doi:https://doi.org/10.1016/j.atherosclerosis.2009.10.047. PubMed: 19945703.
- 13. Tentolouris N, Nzietchueng R, Cattan V, Poitevin G, Lacolley P et al. (2007) White blood cells telomere length is shorter in males with type 2 diabetes and microalbuminuria. Diabetes Care 30: 2909-2915. doi:https://doi.org/10.2337/dc07-0633. PubMed: 17666463.
- 14. von Zglinicki T, Serra V, Lorenz M, Saretzki G, Lenzen-Grossimlighaus R et al. (2000) Short telomeres in patients with vascular dementia: an indicator of low antioxidative capacity and a possible risk factor? Lab Invest 80: 1739-1747. doi:https://doi.org/10.1038/labinvest.3780184. PubMed: 11092534.
- 15. Heidinger BJ, Blount JD, Boner W, Griffiths K, Metcalfe NB et al. (2012) Telomere length in early life predicts lifespan. Proc Natl Acad Sci U S A 109: 1743-1748. doi:https://doi.org/10.1073/pnas.1113306109. PubMed: 22232671.
- 16. Sahin E, Colla S, Liesa M, Moslehi J, Müller FL et al. (2011) Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 470: 359-365. doi:https://doi.org/10.1038/nature09787. PubMed: 21307849.
- 17. Lee JW, Park KD, Im JA, Kim MY, Lee DC (2010) Mitochondrial DNA copy number in peripheral blood is associated with cognitive function in apparently healthy elderly women. Clin Chim Acta 411: 592-596. doi:https://doi.org/10.1016/j.cca.2010.01.024. PubMed: 20114042.
- 18. Kim MY, Lee JW, Kang HC, Kim E, Lee DC (2011) Leukocyte mitochondrial DNA (mtDNA) content is associated with depression in old women. Arch Gerontol Geriatr 53: e218-e221. doi:https://doi.org/10.1016/j.archger.2010.11.019. PubMed: 21159390.
- 19. Cho MJ, Bae JN, Suh GH, Hahm BJ, Kim JK et al. (1999) Validation of Geriatric Depression Scale, Korean Version(GDS) in the Assessment of DSM-III-R Major Depression. J Korean Neuropsychiatr Assoc 38: 48-63.
- 20. Wong A, Cortopassi G (2002) Reproducible quantitative PCR of mitochondrial and nuclear DNA copy number using the LightCycler. Methods Mol Biol 197: 129-137. PubMed: 12013791.
- 21. Cawthon RM (2002) Telomere measurement by quantitative PCR. Nucleic Acids Res 30: e47. doi:https://doi.org/10.1093/nar/30.10.e47. PubMed: 12000852.
- 22. Song J, Oh JY, Sung YA, Pak YK, Park KS et al. (2001) Peripheral blood mitochondrial DNA content is related to insulin sensitivity in offspring of type 2 diabetic patients. Diabetes Care 24: 865-869. doi:https://doi.org/10.2337/diacare.24.5.865. PubMed: 11347745.
- 23. Lee HK, Song JH, Shin CS, Park DJ, Park KS et al. (1998) Decreased mitochondrial DNA content in peripheral blood precedes the development of non-insulin-dependent diabetes mellitus. Diabetes Res Clin Pract 42: 161-167. doi:https://doi.org/10.1016/S0168-8227(98)00110-7. PubMed: 9925346.
- 24. Weng SW, Lin TK, Liou CW, Chen SD, Wei YH, Lee HC, Chen IY, Hsieh CJ, Wang PW (2009) Peripheral blood mitochondrial DNA content and dysregulation of glucose metabolism. Diabetes Res Clin Pract;83: 94-99. doi:https://doi.org/10.1016/j.diabres.2008.10.002. PubMed: 19019479.
- 25. Lim CY, Jun DW, Jang SS, Cho WK, Chae JD et al. (2010) Effects of carnitine on peripheral blood mitochondrial DNA copy number and liver function in non-alcoholic fatty liver disease. Korean J Gastroenterol 55: 384-389. doi:https://doi.org/10.4166/kjg.2010.55.6.384. PubMed: 20571306.
- 26. Lim S, Kim MS, Park KS, Lee JH, An GH et al. (2001) Correlation of plasma homocysteine and mitochondrial DNA content in peripheral blood in healthy women. Atherosclerosis 158: 399-405. doi:https://doi.org/10.1016/S0021-9150(01)00436-1. PubMed: 11583719.
- 27. Liu CS, Kuo CL, Cheng WL, Huang CS, Lee CF et al. (2005) Alteration of the copy number of mitochondrial DNA in leukocytes of patients with hyperlipidemia. Ann N Y Acad Sci 1042: 70-75. doi:https://doi.org/10.1196/annals.1338.008. PubMed: 15965047.
- 28. Lombard DB, Tishkoff DX, Bao J (2011) Mitochondrial sirtuins in the regulation of mitochondrial activity and metabolic adaptation. Handb Exp Pharmacol 206: 163-188. doi:https://doi.org/10.1007/978-3-642-21631-2_8. PubMed: 21879450.
- 29.
Weindruch R, Walford RL (1988) The retardation of aging and disease by dietary restriction. Springfield, IL: C.C. Thomas Publisher.
- 30. Masoro EJ (2006) Caloric restriction and aging: controversial issues. J Gerontol A Biol Sci Med Sci 61: 14-19. doi:https://doi.org/10.1093/gerona/61.1.14. PubMed: 16456190.
- 31. Colman RJ, Anderson RM, Johnson SC, Kastman EK, Kosmatka KJ et al. (2009) Caloric restriction delays disease onset and mortality in rhesus monkeys. Science 325: 201-204. doi:https://doi.org/10.1126/science.1173635. PubMed: 19590001.
- 32. Colman RJ, Beasley TM, Allison DB, Weindruch R (2008) Attenuation of sarcopenia by dietary restriction in rhesus monkeys. J Gerontol A Biol Sci Med Sci 63: 556-559. doi:https://doi.org/10.1093/gerona/63.6.556. PubMed: 18559628.
- 33. Das M, Gabriely I, Barzilai N (2004) Caloric restriction, body fat and ageing in experimental models. Obes Rev 5: 13-19. doi:https://doi.org/10.1111/j.1467-789X.2004.00115.x. PubMed: 14969503.
- 34. Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM et al. (2005) Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 434: 113-118. doi:https://doi.org/10.1038/nature03354. PubMed: 15744310.
- 35. Wang C, Maddick M, Miwa S, Jurk D, Czapiewski R et al. (2010) Adult-onset, short-term dietary restriction reduces cell senescence in mice. Aging (Albany NY) 2: 555-566. PubMed: 20844316.
- 36. Smith DL Jr, Mattison JA, Desmond RA, Gardner JP, Kimura M et al. (2011) Telomere dynamics in rhesus monkeys: no apparent effect of caloric restriction. J Gerontol A Biol Sci Med Sci 66: 1163-1168. PubMed: 21860014.
- 37. Syrovatka P, Kraml P, Potockova J, Fialova L, Vejrazka M et al. (2009) Relationship between increased body iron stores, oxidative stress and insulin resistance in healthy men. Ann Nutr Metab 54: 268-274. doi:https://doi.org/10.1159/000229507. PubMed: 19641304.
- 38. Kim CH, Kim HK, Bae SJ, Park JY, Lee KU (2011) Association of elevated serum ferritin concentration with insulin resistance and impaired glucose metabolism in Korean men and women. Metabolism 60: 414-420. doi:https://doi.org/10.1016/j.metabol.2010.03.007. PubMed: 20423745.
- 39. Gabay C, Kushner I (1999) Acute-phase proteins and other systemic responses to inflammation. N Engl J Med 340: 448-454. doi:https://doi.org/10.1056/NEJM199902113400607. PubMed: 9971870.
- 40. Kang HT, Linton JA, Shim JY (2012) Serum ferritin level is associated with the prevalence of metabolic syndrome in Korean adults: The 2007-2008 Korean National Health and Nutrition Examination Survey. Clin Chim Acta 413: 636-641. PubMed: 22212623.
- 41. Mur C, Clària J, Rodela S, Lario S, Campistol JM et al. (2004) Cigarette smoke concentrate increases 8-epi-PGF2alpha and TGFbeta1 secretion in rat mesangial cells. Life Sci 75: 611-621. doi:https://doi.org/10.1016/j.lfs.2003.12.026. PubMed: 15158370.
- 42. Yamaguchi Y, Haginaka J, Morimoto S, Fujioka Y, Kunitomo M (2005) Facilitated nitration and oxidation of LDL in cigarette smokers. Eur J Clin Invest 35: 186-193. doi:https://doi.org/10.1111/j.1365-2362.2005.01472.x. PubMed: 15733073.
- 43. Puddu P, Puddu GM, Cravero E, De Pascalis S, Muscari A (2007) The putative role of mitochondrial dysfunction in hypertension. Clin Exp Hypertens 29: 427-434. doi:https://doi.org/10.1080/10641960701613852. PubMed: 17994352.
- 44. Ramachandran A, Levonen AL, Brookes PS, Ceaser E, Shiva S et al. (2002) Mitochondria, nitric oxide, and cardiovascular dysfunction. Free Radic Biol Med 33: 1465-1474. doi:https://doi.org/10.1016/S0891-5849(02)01142-5. PubMed: 12446203.
- 45. Zimmerman MC, Zucker IH (2009) Mitochondrial dysfunction and mitochondrial-produced reactive oxygen species: new targets for neurogenic hypertension? Hypertension 53: 112-114. PubMed: 19114641.
- 46. Dedkova EN, Blatter LA (2008) Mitochondrial Ca2+ and the heart. Cell Calcium;44(1): 77-91. doi:https://doi.org/10.1016/j.ceca.2007.11.002. PubMed: 18178248.
- 47. Jin HS, Sober S, Hong KW, Org E, Kim BY et al. (2011) Age-dependent association of the polymorphisms in the mitochondria-shaping gene, OPA1, with blood pressure and hypertension in Korean population. Am J Hypertens 24: 1127-1135. doi:https://doi.org/10.1038/ajh.2011.131. PubMed: 21796221.
- 48. Lim S, Kim SK, Park KS, Kim SY, Cho BY et al. (2000) Effect of exercise on the mitochondrial DNA content of peripheral blood in healthy women. Eur J Appl Physiol 82: 407-412. doi:https://doi.org/10.1007/s004210000238. PubMed: 10985594.