Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The Escherichia coli Translation-Associated Heat Shock Protein YbeY Is Involved in rRNA Transcription Antitermination

  • Maya Grinwald,

    Affiliation Department of Molecular Microbiology and Biotechnology, Life Sciences, Tel Aviv University, Tel Aviv, Israel

  • Eliora Z. Ron

    eliora@post.tau.ac.il

    Affiliation Department of Molecular Microbiology and Biotechnology, Life Sciences, Tel Aviv University, Tel Aviv, Israel

Abstract

A new group of translation-associated heat shock genes has been recently identified. One of these novel genes is ybeY which is highly conserved in bacteria. In Escherichia coli the YbeY protein is important for efficient translation at all temperatures and is essential at high temperatures. Deletion mutants of ybeY are defective in protein translation, due to impaired 30 S ribosomal subunits. Here we provide evidence which tie YbeY to the transcription antitermination process. Thus, in ybeY deletion mutants transcription is significantly inhibited when the “nut like” sequences required for transcriptional antitermination are present, while if these sequences are removed transcription is not affected by the mutation.

Introduction

Efficient protein translation requires an accurate biogenesis of the ribosomes, which consists of a complex series of processes [1], [2]. It begins with the transcription of rRNA precursors from the seven rrn operons which undergo nucleolytic processing by RNases to generate the mature rrn molecules [3]. The final steps of rRNA maturation occur in the early stages of protein synthesis by the newly-assembled ribosome [4], [5].

Transcription of the rrn genes is regulated mainly at the level of transcription initiation but further control involves an antitermination system which overcomes rho- dependent transcriptional terminators located along the rrn operon [6], [7]. This system prevents transcriptional polarity of the rrn operon and insures that all three RNA species (5, 16 and 23 S) are transcribed in equal amounts [8].

The formation of the transcription antitermination complex requires an RNA sequences known as “nut like sequences” which are located in the leader of the 16 S and in the spacer between the 16 S and the 23 S. These elements include three sequences: boxA, boxB and boxC which bind the cellular factors that construct the antitermination complex [9], [10]. These cellular factors include the Nus factors (factors also involved in the transcription antitermination of phage lambda [11]) and several ribosomal proteins [12], [13]. The factors facilitate the interaction between the box elements, RNAP and Rho and secure the transcription antitermination process [14][17].

The transcription antitermination process has two roles in addition to its primary function: to assist processing of the mature rrn transcript from the precursor state [18][21] and to modulate the transcription elongation rate [16], [22] thus ensuring the proper folding of the rRNA.

It is, therefore, clear that the transcriptional antitermination system is critical for several stages of ribosome biogenesis. Here we present evidence suggesting the involvement of a newly-analyzed protein YbeY in the transcription antitermination process.

YbeY is a 17 kD heat shock protein that belongs to the UPF0054 family and is highly conserved in bacteria [23][25]. Previous studies indicated that YbeY is important for translation and its absence results in production of impaired 30 S ribosomal subunits because of abnormal maturation of rRNA [26][28]. Recently [29] YbeY was shown to be a metallo endoribonuclease and with several functions including rRNA maturation and 70 S ribosome quality control. The results presented here indicate that YbeY has an additional role in transcriptional antitermination, that is critical for production of ribosomal subunits and could explain the defect in rRNA maturation.

Results

YbeY Affects the Transcription Antitermination of RNA

It has been shown that YbeY is essential for correct rRNA maturation, but the molecular basis of this effect has not been elucidated. One factor that could play a role in RNA maturation is the transcription antitermination process which is important for maintaining an optimal elongation rate for correct processing and folding of the RNA. In order to examine the possible effect of YbeY on the transcription antitermination process, we constructed a series of pACYC plasmids (NEW ENGLAND BioLabs) which contain three types of the rrn promoter regions fused upstream to a promoterless lacZ gene (Figure 1A). These promoter regions differ in respect to the presence of the antitermination “nut-like” sequences. The first rrn promoter region was short and contained only the P1 promoter sequence of the rrn promoter (S = short). The second rrn promoter contained the P1 and P2 promoters as well as the nut -like sequences (boxA, boxB and boxC) involved in transcription antitermination (M = medium length). The third and longest promoter region contained the P1 and P2 promoters, nut -like sequences and the tL region of the rrn operon, which is a putative Rho-independent pausing site of transcription (L = long). All the regions also include FIS elements and additional sequences required for transcription initiation. In addition, the lacZ contains four Rho- dependent terminators. Using this experimental system it is possible to examine the affect of YbeY on transcription antitermination.

thumbnail
Figure 1. Transcript levels of lacZ transcribed from various rrn promoter regions.

The pACYC plasmids were constructed so that they contained various rrn operon promoter regions fused upstream a promoterless lacZ gene, as described in Materials and Methods. The short promoter region of rrn contained only the P1 sequence of the rrn promoter (S = short), the second segment contained the P1, P2 and nut -like sequences (boxA, boxB and boxC) (M = medium length) and a longer segment contained the P1, P2, nut like sequences and tL region of the rrn operon (L = long). All the promoter regions contained the FIS elements and other elements required for initiation of transcription. The pACYC plasmids were transformed into the lacZ and ybeY, lacZ deletion strains. (A) a schematic description of the three promoter regions which were fused to lacZ. The rrn sequence, the FIS elements, P1, P2, nut -like sequences and tL region are marked. (B) Cultures of ΔlacZ (“wild type ybeY”) and ΔlacZΔybeY (“ΔybeY”) carrying the pACYC plasmids were grown in LB at 37°C and harvested at O.D600 = 0.45. RNA was extracted from these samples and analyzed by qRTPCR.

https://doi.org/10.1371/journal.pone.0062297.g001

These plasmids were transformed into the wild type strain and the ΔybeY strain, both containing a lacZ deletion (ΔlacZ ). The lacZ mRNA levels were measured by qRT PCR. These lacZ mRNA levels represent the levels of transcription from each promoter. We assumed that if YbeY is involved in transcription antitermination, then the ybeY deletion would not affect transcription from the short promoter region (S) but would alter transcription from the promoter regions which involve the transcription antitermination sequences, i.e., M and L.

Indeed, the results presented in Figure 1B indicate that transcription from the “S” promoter is not affected by the ΔybeY mutation. In contrast, this mutation results in a significant reduction (100 fold) of transcription from the “M promoter” which contains the transcription antitermination sequences (“nut -like sequences”). The presence of the tL region relieves some of the reduction: transcription from the “L promoter” is reduced only by 50% in the mutant (Figure 1B).

The reduced levels of transcription from regions containing the transcription antitermination sequence presumably reflect the effect of the ybeY deletion on transcription antitermination. Alternatively, this reduction could also result from a reduced stability of transcripts produced from the “M promoter” region and the “L promoter” region in the ΔybeY deletion strain. However, this latter possibility was excluded by experiments in which transcript stability was determined following the addition of the transcription inhibitor Rifampicin (Figure 2A). The results demonstrate that the deletion of ybeY does not result in decrease transcript stability, indicating that differential stability of transcripts is not the cause of the YbeY effect on transcription antitermination.

thumbnail
Figure 2. Stability and levels of RNA expressed from various rrn promoter regions in ybeY deletion mutant.

(A) Stability of lacZ gene transcripts was determined by measuring its residual levels following addition of Rifampicin (200 µg/ml). Cultures and growth conditions were as described in Figure 1. All the bacteria were deleted for the chromosomal lacZ gene and transformed with pACYC plasmids carrying various rrn promoter sequences fused upstream to a promoterless lacZ. The plasmids carried the “S” region, “M” region, or “L” region. Rifampicin was added at time 0 and the cultures were harvested at 0, 3, 6 min. RNA was extracted and analyzed by qRTPCR. Bacteria with wild type ybeY gene and plasmid with “S” region (filled circles), with “M” region (open circles) and with “L” region (filled triangles). ΔybeY mutant carrying a plasmid with “S” region (open triangles), with “M” region (filled squares) and with “L” region (opened squares). (B) Levels of RNA encoded from the region prior to the antitermination sequences. Cultures of wild type and ΔybeY mutant were grown in LB at 37°C and harvested at O.D600 = 0.45. RNA was extracted from these samples and the levels of the transcripts encoded by the region before the antitermination sequences were quantified by qRTPCR from the primers described above.

https://doi.org/10.1371/journal.pone.0062297.g002

The reduction of lacZ transcripts from the “M” and “L” promoters correlates with the accumulation of short transcripts in the ybeY mutant as detected by qRT-PCR (Figure 2B) further supporting the role of YbeY in transcription antitermination. .

Factors Participating in the Transcription Antitermination Process Compensate for the ybeY Deletion

The results showing that YbeY is involved in the transcriptional antitermination process suggest the possibility that over-expression of factors participating in the transcription antitermination process could compensate for the effect of a ybeY deletion. Thus, we examined the effect of over-expression of several Nus factors on growth rate of the ybeY mutant. The experiment was carried out at 42°C, when the mutant has its most severe phenotype. The results indicate that, indeed, high cellular concentrations of NusA, NusB, NusE and NusG partially compensated for the ybeY mutation (Figure 3A and 3C), while they had virtually no effect in the wild type (Figure 3B).

thumbnail
Figure 3. Effect of plasmids expressing transcriptional antitermination factors on growth of ybeY deletion mutant.

Over-expression of NusA, NusB, NusG and NusE, was obtained by introducing multi-copy plasmids containing these genes cloned downstream to a lacZ promoter. These plasmids were transformed into the ybeY deletion mutant (A) and into the wild type strain (B). Cultures were grown overnight in LB medium at 30°C. They were then diluted to A600 of 0.04 in 2 ml wells (in a 24 well plate) containing 1 ml of LB medium supplemented with 0.1 mM IPTG for inducing the lacZ promoter. The cultures were transferred to 42°C and turbidity was measured at 600 nm for 12 hours. (A) wild type (filled circles), ybeY deletion mutant (open circles), ΔybeY mutant carrying pCA24N nusA (filled triangles), ΔybeY mutant carrying pCA24N nusB (open triangles), ΔybeY mutant carrying pCA24N nusE (filled squares), ΔybeY mutant carrying pCA24N nusG (opened squares) and ΔybeY mutant carrying pCA24N empty vector (filled diamonds). (B) wild type (filled circles), wild type carrying pCA24N nusA (open circles), wild type carrying pCA24N nusB (filled triangles), wild type carrying pCA24N nusE (open triangles) and wild type carrying pCA24N nusG (filled squares). (C) Growth of ΔybeY mutant carrying pCA24N encoding Nus genes on LB agar plates, supplemented with 0.1 mM IPTG, overnight at 42°C.

https://doi.org/10.1371/journal.pone.0062297.g003

Discussion

YbeY is involved in ribosome biogenesis - in its absence ribosomes are defective and translation is reduced [26], [28], especially at elevated temperatures [27]. Here we show the involvement of YbeY in the transcriptional antitermination process of rRNA synthesis, which is critical for ribosome biogenesis. Thus, we show that YbeY is essential for rrn transcription of regions that contain the antitermination sequences (Figure 1). Transcription from the P1 promoter of rrn (S promoter) is unaffected by the absence of YbeY, but the transcription is almost abolished if the promoter region also contains the P2 and nut -like sequences which constitute the antitermination region (M).

The presence of tL - the Rho-independent pause site [30] in the promoter region which contains the transcriptional antitermination site elevated the level of transcription - compare the effect of the deletion on transcription from the “M” promoter and the “L” promoter. The tL is a conserved sequence in the leader region of rRNA and various deletions of the tL results in rRNA transcription polarity [31]. It appears that tL may assist a correct transcription antitermination process, and its presence enables the complex to be fully organized and stabilized prior to the transcription of the 16S rRNA. The lack of tL may lead to premature termination during transcription. The effect of tL on transcription can be seen in Fig. 1, as its presence stimualtes transcription in the wild type bacteria. Interestingly, the effect of tL remains even in deletion mutants of ybeY where its presence increases the transcription level as well. Yet even in the presence of tL there is still a 50% decrease in transcription of rrn. Such a decrease is probably sufficient to cause the phenotypes seen in the ybeY deletion mutants, as its effect may escalate into the major effect on ribosome biogenesis.

We assume that the reduced level of transcripts overlapping the transcriptional antitermination region in ybeY mutants results from the involvement of YbeY in the transcriptional antitermination process. However, it is also possible that this reduced level results from a lower stability of transcripts in the ybeY mutant. This possibility is ruled out by the experiment presented in Fig. 2, which shows that the stability of the M-transcripts (that contain the transcriptional antitermination sequence) is not affect by the ybeY deletion. In contranst, it should be mentioned that the stability of the short transcripts (from promoter S, that do not contain the transcriptional antitermination sequences) is affected by the ybeY mutation, but in the opposite directions. Thus, in the absence of YbeY the short transcripts are more stable. This result could be explained by the recent findings of Jacob et al [29] that attributed RNase activity to YbeY. This RNase may be more active on short transcripts, as these are not yet covered by the binding of various protein factors.

Further support for the effect of YbeY on the transcription antitermination of rRNA transcripts is obtained by the findings that the ybeY deletion mutation can be partially complemented by over-expression of the NUS factors involved in transcription antitermination (Figure 3). The overexpression of these NUS factors has virtually no effect on the wild type. Although there is no trivial explanation for these findings - that are highly significant and reproducible - we assume that these transcriptional factors affect the rate of transcription in the mutant by supporting the correct folding of the rRNA and thus improving rRNA maturation even in the absence of YbeY.

The results presented here show the importance of YbeY for ongoing rRNA transcription elongation. They are also compatible with the findings that immature 16S RNA accumulates in ybeY deletion mutants [28], as a correct transcription antitermination process is required for accurate maturation of rRNA. The maintenance of an optimal transcription elongation rate which allows the proper maturation and folding of the rRNA becomes difficult when the temperature is increased, as at the higher temperatures the rate of transcription increases. Therefore, the suggested involvement of YbeY in the transcription antitermination process and in assuring proper RNA maturation implies that its importance may increase with temperature. This assumption is compatible with the finding that the ybeY deletion has a stronger phenotype at high temperatures - the deletion mutant is temperature sensitive [27]. Moreover, YbeY is a conserved heat shock protein which is induced upon temperature shift-up, probably ensuring sufficient levels of this protein to satisfy the increased requirement upon shift to higher temperatures.

Materials and Methods

Bacterial Strains and Plasmids

E. coli MG1655 (ATCC 47076), a wild-type K-12 strain, was used in all experiments. The ΔybeY deletion mutation was obtained as described [27]. The lacZ deletion [32] was introduced by the λRed system [33] to create wild type ΔlacZ or double mutants ΔybeY, ΔlacZ. Plasmid pAC24N encoding Nus factors were transformed from the E. coli ASKA library [34] into E. coli MG1655 and its ybeY deletion strain.

Growth Conditions

Unless otherwise stated, cultures were grown exponentially in LB broth (Difco) with aeration at 37°C to OD600 = 0.45. The turbidity readings were performed using the Biotek Synergy EONTM reader, with 1 ml volume in 24 well plates.

Construction of Plasmids

Plasmids (pACYC 184) encoding rrn promoter regions and fused upstream to a promoterless lacZ gene were constructed so that they contained three types of rrn operon promoter regions. The coding sequence of lacZ was PCR amplified using primers containing restriction sites for BamHI and HindIII. The digested PCR product was ligated into pACYC digested with the same restriction enzymes. Next, the promoter region of rrnB was PCR amplified using primers containing restriction sites for XbaI and HindIII. The digested PCR product was ligated into pACYC containing the lacZ product, digested with the same restriction enzymes. The pACYC plasmids encoding the rrnB promoter reign and lacZ were transformed into the lacZ and ybeY lacZ deletion strains. The primers used for plasmids construction are listed in Table 1.

thumbnail
Table 1. Primers used for plasmids construction.

https://doi.org/10.1371/journal.pone.0062297.t001

RNA isolation

Total RNA was isolated using the RNA Protect and RNeasy kits (Qiagen) as described by the manufacturer and DNase I (Promega) was used to remove genomic DNA contamination.

Quantification of Transcript Levels

Reverse transcription was carried out with one microgram of the DNase-treated total RNA using random hexamers (Promega) with ImPromII reverse transcriptase (Promega). Quantitative PCRs were performed using 250 nM of each gene-specific pair of primers in a 20 µl volume with 1 Sybr green PCR master mix (Applied Biosystems). Reactions were run on an ABI 7700 instrument (Applied Biosystems) using the following cycling parameters: 95°C for 10 min, 40 cycles of denaturation at 94°C for 15 second and extension at 60°C for 1 min.

For determining lacZ transcript levels the results were normalized to the cat levels in each sample, to account for possible deviations in lacZ levels due to changes in plasmid copy number. The primers used for quantifying the levels of lacZ and cat are listed in Table 2.

thumbnail
Table 2. Primers used for quantifying the level of transcripts in Quantitative PCR.

https://doi.org/10.1371/journal.pone.0062297.t002

For determining the levels of the short transcripts (before the antitermination region) we used the following primers:

F: 5-_ TGACACGGAACAACGGCAAACACG_-3 and

R: 5-_ TGCATAATACGCCTTCCCGCTACA-_3.

Acknowledgments

We thank Dr. Dvora Biran and Nadav Segev for their assistance, Dr. Udi Qimron and Dr. Lea Reshef for supplying plasmids. Out thanks to Ifat Cohen-Or for fruitful discussions and critical reading of the manuscript.

Author Contributions

Conceived and designed the experiments: MG EZR. Performed the experiments: MG. Analyzed the data: MG EZR. Contributed reagents/materials/analysis tools: EZR. Wrote the paper: MG EZR.

References

  1. 1. Kaczanowska M, Ryden-Aulin M (2007) Ribosome biogenesis and the translation process in Escherichia coli. Microbiol Mol Biol Rev 71: 477–494.
  2. 2. Wilson DN, Nierhaus KH (2007) The weird and wonderful world of bacterial ribosome regulation. Crit Rev Biochem Mol Biol 42: 187–219.
  3. 3. Deutscher MP (2009) Maturation and degradation of ribosomal RNA in bacteria. Prog Mol Biol Transl Sci 85: 369–391.
  4. 4. Ceccarelli A, Dotto GP, Altruda F, Perlo C, Silengo L, et al. (1978) Immature 50 S subunits in Escherichia coli polyribosomes. FEBS Lett 93: 348–350.
  5. 5. Hayes F, Vasseur M (1976) Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle. Eur J Biochem 61: 433–442.
  6. 6. Condon C, Squires C, Squires CL (1995) Control of rRNA transcription in Escherichia coli. Microbiol Rev 59: 623–645.
  7. 7. Gourse RL, Gaal T, Bartlett MS, Appleman JA, Ross W (1996) rRNA transcription and growth rate-dependent regulation of ribosome synthesis in Escherichia coli. Annu Rev Microbiol 50: 645–677.
  8. 8. Aksoy S, Squires CL, Squires C (1984) Evidence for antitermination in Escherichia coli rRNA transcription. J Bacteriol 159: 260–264.
  9. 9. Li SC, Squires CL, Squires C (1984) Antitermination of E. coli rRNA transcription is caused by a control region segment containing lambda nut-like sequences. Cell 38: 851–860.
  10. 10. Berg KL, Squires C, Squires CL (1989) Ribosomal RNA operon anti-termination. Function of leader and spacer region box B-box A sequences and their conservation in diverse micro-organisms. J Mol Biol 209: 345–358.
  11. 11. Das A (1992) How the phage lambda N gene product suppresses transcription termination: communication of RNA polymerase with regulatory proteins mediated by signals in nascent RNA. J Bacteriol 174: 6711–6716.
  12. 12. Torres M, Condon C, Balada JM, Squires C, Squires CL (2001) Ribosomal protein S4 is a transcription factor with properties remarkably similar to NusA, a protein involved in both non-ribosomal and ribosomal RNA antitermination. EMBO J 20: 3811–3820.
  13. 13. Greive SJ, Lins AF, von Hippel PH (2005) Assembly of an RNA-protein complex. Binding of NusB and NusE (S10) proteins to boxA RNA nucleates the formation of the antitermination complex involved in controlling rRNA transcription in Escherichia coli. J Biol Chem 280: 36397–36408.
  14. 14. Quan S, Zhang N, French S, Squires CL (2005) Transcriptional polarity in rRNA operons of Escherichia coli nusA and nusB mutant strains. J Bacteriol 187: 1632–1638.
  15. 15. Burmann BM, Schweimer K, Luo X, Wahl MC, Stitt BL, et al. (2010) A NusE:NusG complex links transcription and translation. Science 328: 501–504.
  16. 16. Squires CL, Greenblatt J, Li J, Condon C (1993) Ribosomal RNA antitermination in vitro: requirement for Nus factors and one or more unidentified cellular components. Proc Natl Acad Sci U S A 90: 970–974.
  17. 17. Mooney RA, Schweimer K, Rosch P, Gottesman M, Landick R (2009) Two structurally independent domains of E. coli NusG create regulatory plasticity via distinct interactions with RNA polymerase and regulators. J Mol Biol 391: 341–358.
  18. 18. Morgan EA (1986) Antitermination mechanisms in rRNA operons of Escherichia coli. J Bacteriol 168: 1–5.
  19. 19. Schaferkordt J, Wagner R (2001) Effects of base change mutations within an Escherichia coli ribosomal RNA leader region on rRNA maturation and ribosome formation. Nucleic Acids Res 29: 3394–3403.
  20. 20. Theissen G, Behrens SE, Wagner R (1990) Functional importance of the Escherichia coli ribosomal RNA leader box A sequence for post-transcriptional events. Mol Microbiol 4: 1667–1678.
  21. 21. Pardon B, Wagner R (1995) The Escherichia coli ribosomal RNA leader nut region interacts specifically with mature 16S RNA. Nucleic Acids Res 23: 932–941.
  22. 22. Lewicki BT, Margus T, Remme J, Nierhaus KH (1993) Coupling of rRNA transcription and ribosomal assembly in vivo. Formation of active ribosomal subunits in Escherichia coli requires transcription of rRNA genes by host RNA polymerase which cannot be replaced by bacteriophage T7 RNA polymerase. J Mol Biol 231: 581–593.
  23. 23. Yeh DC, Parsons LM, Parsons JF, Liu F, Eisenstein E, et al. (2005) NMR structure of HI0004, a putative essential gene product from Haemophilus influenzae, and comparison with the X-ray structure of an Aquifex aeolicus homolog. Protein Sci 14: 424–430.
  24. 24. Oganesyan V, Busso D, Brandsen J, Chen S, Jancarik J, et al. (2003) Structure of the hypothetical protein AQ_1354 from Aquifex aeolicus. Acta Crystallogr D Biol Crystallogr 59: 1219–1223.
  25. 25. Zhan C, Fedorov EV, Shi W, Ramagopal UA, Thirumuruhan R, et al. (2005) The ybeY protein from Escherichia coli is a metalloprotein. Acta Crystallogr Sect F Struct Biol Cryst Commun 61: 959–963.
  26. 26. Rasouly A, Davidovich C, Ron EZ (2010) The heat shock protein YbeY is required for optimal activity of the 30S ribosomal subunit. J Bacteriol 192: 4592–4596.
  27. 27. Rasouly A, Schonbrun M, Shenhar Y, Ron EZ (2009) YbeY, a heat shock protein involved in translation in Escherichia coli. J Bacteriol 191: 2649–2655.
  28. 28. Davies BW, Kohrer C, Jacob AI, Simmons LA, Zhu J, et al. (2010) Role of Escherichia coli YbeY, a highly conserved protein, in rRNA processing. Mol Microbiol 78: 506–518.
  29. 29. Jacob AI, Kohrer C, Davies BW, Rajbhandary UL, Walker GC (2012) Conserved Bacterial RNase YbeY Plays Key Roles in 70S Ribosome Quality Control and 16S rRNA Maturation. Mol Cell.
  30. 30. Kingston RE, Chamberlin MJ (1981) Pausing and attenuation of in vitro transcription in the rrnB operon of E. coli. Cell 27: 523–531.
  31. 31. Zacharias M, Wagner R (1987) Deletions in the tL structure upstream to the rRNA genes in the E. coli rrnB operon cause transcription polarity. Nucleic Acids Res 15: 8235–8248.
  32. 32. Cohen-Or I, Shenhar Y, Biran D, Ron EZ (2010) CspC regulates rpoS transcript levels and complements hfq deletions. Res Microbiol 161: 694–700.
  33. 33. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97: 6640–6645.
  34. 34. Kitagawa M, Ara T, Arifuzzaman M, Ioka-Nakamichi T, Inamoto E, et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res 12: 291–299.