Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

In Vivo Protein Interactions and Complex Formation in the Pectobacterium atrosepticum Subtype I-F CRISPR/Cas System

  • Corinna Richter,

    Affiliation Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand

    ⨯
  • Tamzin Gristwood,

    Current address: Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom

    Affiliation Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand

    ⨯
  • James S. Clulow,

    Current address: Department of Fundamental Microbiology, University of Lausanne, Lausanne, Switzerland

    Affiliation Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand

    ⨯
  • Peter C. Fineran

    peter.fineran@otago.ac.nz

    Affiliation Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand

    ⨯

Abstract

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and their associated proteins (Cas; CRISPR associated) are a bacterial defense mechanism against extra-chromosomal elements. CRISPR/Cas systems are distinct from other known defense mechanisms insofar as they provide acquired and heritable immunity. Resistance is accomplished in multiple stages in which the Cas proteins provide the enzymatic machinery. Importantly, subtype-specific proteins have been shown to form complexes in combination with small RNAs, which enable sequence-specific targeting of foreign nucleic acids. We used Pectobacterium atrosepticum, a plant pathogen that causes soft-rot and blackleg disease in potato, to investigate protein-protein interactions and complex formation in the subtype I-F CRISPR/Cas system. The P. atrosepticum CRISPR/Cas system encodes six proteins: Cas1, Cas3, and the four subtype specific proteins Csy1, Csy2, Csy3 and Cas6f (Csy4). Using co-purification followed by mass spectrometry as well as directed co-immunoprecipitation we have demonstrated complex formation by the Csy1-3 and Cas6f proteins, and determined details about the architecture of that complex. Cas3 was also shown to co-purify all four subtype-specific proteins, consistent with its role in targeting. Furthermore, our results show that the subtype I-F Cas1 and Cas3 (a Cas2-Cas3 hybrid) proteins interact, suggesting a protein complex for adaptation and a role for subtype I-F Cas3 proteins in both the adaptation and interference steps of the CRISPR/Cas mechanism.

Introduction

Despite the ability of bacteriophages and plasmids to positively contribute to the rapid evolution of bacteria, these interactions are not always favourable. For example, infection with lytic phages typically results in the death of host bacteria, whereas plasmids can be a fitness burden when their cost outweighs any adaptive advantage conferred [1]. Therefore, it is not surprising that bacteria have developed multiple mechanisms to resist mobile genetic elements [2], [3]. In recent years particular attention has been focussed on the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems and their CRISPR associated (Cas) genes. CRISPR/Cas systems provide an acquired immunity against both phage and plasmids [4], [5]. These systems are comprised of one or more CRISPR arrays with upstream leader sequences and closely-associated cas genes, which encode the proteins required for resistance [6], [7]. CRISPR arrays contain unique sequences, termed spacers, which are derived from phage or plasmid “protospacer” sequences. It is these spacer sequences that provide the resistance specificity [8], [9]. CRISPR arrays are then transcribed and processed to generate short crRNAs (CRISPR RNAs) that, in combination with Cas proteins, target and degrade invading genetic material [10], [11].

There is significant variation in CRISPR/Cas systems [7], [12], which recently led to their reclassification [13], [14]. The major types, I – III, are distinguished based upon signature proteins, which are Cas3, Cas9, and Cas10 for type I, II, and III, respectively. The major types comprise further subtypes (e.g. I-A to I-F), each characterized by a specific set of proteins [13], [14]. The functional mechanism of CRISPR/Cas consists of three stages: 1) acquisition of resistance, 2) CRISPR RNA biogenesis and 3) interference [15]. During acquisition, new spacers derived from the protospacer sequence of the invading phage or plasmid are incorporated into the CRISPR array. Incorporation typically occurs at the end proximal to the leader [16], [17] and, as such, forms a chronological record of past invasions. The leader contains the promoter for CRISPR expression [18]–[20]. In contrast, a recent study in Sulfolobus solfataricus showed that some CRISPR arrays utilise an internal spacer incorporation mechanism [21]. Acquisition requires Cas1 and Cas2 [17], [22], which are the only two proteins conserved across all subtypes [14]. Sequences adjacent to the protospacers (termed protospacer adjacent motifs (PAMs)) [8] are important for incorporation of new spacers [17].

During CRISPR RNA biogenesis and interference, the CRISPR array is transcribed into one long pre-crRNA, which is cleaved into small mature crRNAs that consist of remnants of the repeat and an entire or truncated spacer also referred to as guide sequence [11], [23]–[25]. Cas6, Cas6e (CasE/Cse3) and Cas6f (also known as Csy4) have been identified as the endoribonucleases in Pyrococcus furiosus (subtype III-B), Staphylococcus epidermidis (subtype III-A), Escherichia coli (subtype I-E) and Pseudomonas aeruginosa and Pectobacterium atrosepticum (both subtype I-F) [10], [20], [24], [26], [27]. The mature crRNAs guide a complex of subtype-specific Cas proteins to the invading nucleic acid, which is subsequently degraded. Formation of such protein-RNA complexes has been shown for E. coli (subtype I-E) [10], [28]–[30], P. furiosus and Sulfolobus solfataricus (both subtype III-B) [11], [25], [31], Streptococcus pyogenes (subtype II-A) [32], S. solfataricus (subtype I-A) [33], Bacillus halodurans (subtype I-C) [34] and recently P. aeruginosa (subtype I-F) [35]. The CRISPR-associated complex for antiviral defense (Cascade) from E. coli is the most well characterised system [28], [29]. The E. coli Cascade complex that contains mature crRNA recognises target DNA and recruits Cas3, a protein with both nuclease and helicase activity [36]–[38] that is required for interference [10] by degrading invader DNA [38].

Pectobacterium atrosepticum (formerly Erwinia carotovora subsp. atroseptica) is an economically important γ-proteobacterial plant pathogen that causes soft-rot and blackleg disease in potato [39]. Previously, we demonstrated that P. atrosepticum strain SCRI1043 contains a subtype I-F CRISPR/Cas system with cas1, cas3, csy1-3 and cas6f and three CRISPR arrays (Fig. 1A) [20]. These arrays and the cas genes are transcribed under laboratory conditions, and the CRISPR RNAs are processed both in vivo and in vitro by the endoribonuclease Cas6f [20]. The CRISPR repeats in all three arrays are 28 nt long with a consensus sequence of GTTCACTGCCGTACAGGCAGCTTAGAAA and are interspersed with 32 nt spacers. CRISPR1-3 possess 28, 10 and 3 spacers, respectively with no homology to known phages or plasmid sequences, yet spacer 6 in CRISPR2 shows 100% identity to a region in eca0560 within its own genome [20]. CRISPR2 and 3 are separated by a hypothetical toxin-antitoxin system (eca3686-7).

thumbnail
Figure 1. The Csy1-3 and Cas6f proteins of P. atrosepticum form a complex in vivo.

(A) Scale schematic representation of the CRISPR/Cas system in P. atrosepticum strain SCRI1043. The 3 CRISPR loci are denoted CRISPR1-3 in order of decreasing length and the direction of transcription indicated by the directionality of the arrows. The universal and type-specific genes, cas1 and cas2-cas3 are shown in blue and the subtype I-F-specific genes are depicted in light blue (csy1-3) and orange (cas6f). Between CRISPR2 and CRISPR3 is a putative toxin-antitoxin system (eca3686-7). (B) Co-purification of Csy1-3 and Cas6f proteins using Ni-NTA agarose. Coomassie stained SDS-PAGE gel of elution fractions from the P. atrosepticum Δcas mutants expressing untagged Csy1-3 and Cas6f (pJSC11) and either one of the four different His-tagged bait Csy and Cas6f proteins (plasmids pJSC3-6 encode His-tagged Csy1-3 and Cas6f, respectively) or an His-tagged SdhE control (pMAT4). Proteins were identified by MS as indicated and results also shown in Table 3.

https://doi.org/10.1371/journal.pone.0049549.g001

Here, we investigated complex formation and pairwise protein interactions in the CRISPR/Cas subtype I-F system. We report formation of a P. atrosepticum Csy1-3 and Cas6f complex (referred to as the Csy complex for simplicity), complementing the results published for a related system in P. aeruginosa [35]. We have further probed the in vivo architecture of the complex by analysing individual protein-protein interactions in wild-type and cas deletion backgrounds. In addition, we provide the first evidence that subtype I-F Cas3 interacts with Cas1 and the Csy complex, which may have implications for both the integration of new spacers and the interference mechanism.

Materials and Methods

Bacterial Strains and Growth Conditions

Pectobacterium atrosepticum strain SCRI1043 [39] wild type (WT) and PCF80 (Δcas::cat) [20] strains were grown at 25°C and E. coli DH5α at 37°C in Luria Broth (LB) at 200 rpm or on LB-agar plates containing 1.5% (w/v) agar. Bacterial growth (OD600) and absorbance were measured in a Jenway 6300 spectrophotometer. When required, medium was supplemented with the following antibiotics: ampicillin (100 µg/ml), and kanamycin (50 µg/ml).

Oligonucleotides, Cloning, Plasmids and Sequencing

Molecular biology methods were performed using standard techniques. PCR was performed using Phusion DNA polymerase (Finnzymes) for cloning, or Taq polymerase (Roche) for colony screening. PCR products and digested plasmid DNA were purified using the Illustra™ GFX™ PCR DNA and gel band purification kit. Ligations were performed using NEB or Roche T4 ligase. Plasmid DNA was purified using Qiagen™ DNA purification kit and Zippy™ DNA purification kits following the manufacturers’ instructions. All plasmids used in this study were confirmed by sequencing and are listed in Table 1 and oligonucleotides are listed in Table 2. DNA sequencing was performed at the DNA sequencing facility, Allan Wilson Centre, Massey University, New Zealand. Nucleotide sequence data was analysed using Chromas Lite.

thumbnail
Table 2. Oligonucleotides used in this study.

https://doi.org/10.1371/journal.pone.0049549.t002

Construction of His-tagged Cas and Csy Expression Vectors

Expression vectors, encoding the P. atrosepticum Cas1, Cas3, Csy1-3 and Cas6f proteins carrying N-terminal hexahistidine extensions (MRGSHHHHHHGS), were constructed previously [20]. A construct for the expression of N-terminally His-tagged Cas1 and native Cas3 (pJSC10) was generated by amplifying the cas1-cas3 region with primers TGO34 and TGO37. The resulting 4.3 kb PCR product was digested with BamHI and PstI and ligated into pTRB30, previously cut with the same enzymes. Primers PF209 and PF210 flank the pTRB30 MCS and were used for sequencing all pTRB30 derivatives, in combination with internal gene-specific primers.

Construction of FLAG-tagged Csy and Cas6f Expression Vectors

FLAG-tagged Csy vectors were generated as follows: the csy1 gene (1332 bp) was amplified by PCR using primers TGO58 and TGO59, for generation of an N-terminal FLAG-tag, or TGO60 and TGO61, for generation of a C-terminal FLAG-tag. The csy2 gene (933 bp) was amplified by PCR using primer pairs CR28 and CR21, for generation of an N-terminal FLAG-tag, or CR29 and CR23, for generation of a C-terminal FLAG-tag. The csy3 gene (1014 bp) was amplified by PCR using primer pairs CR30 and CR25, for generation of an N-terminal FLAG-tag, or CR31 and CR27, for generation of a C-terminal FLAG-tag. The csy1 products were digested with XmaI and HindIII, the csy2 and csy3 products digested with SacI and XbaI and all were cloned into pBAD30, previously cut with the same enzymes. N- and C-terminally FLAG-tagged Cas6f vectors were constructed previously [20]. Primers PF138 and PF139 flank the pBAD30 MCS and were used for sequencing all pBAD30 derivatives, in combination with internal gene-specific primers.

Construction of Native Expression Vectors

A construct for the expression of Csy1-3 and Cas6f (pJSC11) was generated by amplifying csy1-3, cas6f with primers TGO60 and JCO5. The resulting 3.8 kb PCR product was digested with XmaI and SphI and ligated into pBAD30, previously cut with the same enzymes. A plasmid that expressed native Cas3 (pJSC9) was constructed by amplifying the cas3 gene with primers PF281 and JCO2, digesting the product with EcoRI and HindIII and ligating into EcoRI/HindIII-digested pTRB30.

Co-affinity Purification

P. atrosepticum Δcas (PCF80) cell cultures (500 ml) carrying the csy1-3 and cas6f genes (pJSC11) and one other cas or csy gene (on pTRB30-derived plasmids) were induced with 1 mM IPTG and 0.1% arabinose at an OD600 of 0.5 and grown for further 20 hours. As a control, an unrelated protein (His-SdhE [40]) was expressed from pTRB30 (pMAT4) with Csy1-3 and Cas6f co-expressed from pJSC11. Co-purification experiments of His-Cas1 and Cas3 were performed identically except plasmid pJSC10 (His-Cas1, Cas3) was used in the presence or absence of pJSC11 (Csy1-3, Cas6f). Cells were pelleted by centrifugation at 3030×g for 15 min, the supernatant removed and the cell pellet frozen at −20°C overnight. To enable cell lysis, pellets were resuspended in 5 ml of 50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 0.2 mg/ml lysozyme (Roche) and protease inhibitor cocktail (Sigma) and incubated for 30 min on ice. Following sonication, insoluble material was removed by centrifugation for 30 min at 12100×g at 4°C and the supernatant containing the soluble proteins was loaded on Ni-NTA (Qiagen). Unbound protein was removed by washing with 20–30 column volumes of 50 mM NaH2PO4, 300 mM NaCl, 40 mM imidazole. Proteins that had specifically bound were eluted with 50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole. Where applicable protein was dialyzed into 20 mM HEPES, 300 mM KCl, 5% Glycerol, 1 mM DTT and further purified by size exclusion using a Superose 12 (10/300) GL column (GE Healthcare). Fractions were analysed by SDS-PAGE and Coomassie staining. For SDS-PAGE, proteins were separated on 12% or 15% polyacrylamide gels using the Mini-PROTEAN Tetra Cell (Biorad) and a pre-stained protein ladder (Invitrogen). For Coomassie staining, gels were fixed in 40% (v/v) 2-propanol and 10% (v/v) acetic acid and stained with 0.01% (w/v) Coomassie Brilliant Blue G-250 (Merck).

Protein Identification by Mass Spectrometry

Excised protein bands were subjected to in-gel digestion with trypsin following previously described protocols [41]. Eluted peptides were dried using a centrifugal concentrator. Samples were re-solubilised in 5% [v/v] acetonitrile, 0.2% [v/v] formic acid in water and injected onto an Ultimate 3000 nano-flow uHPLC-System (Dionex Thermo Scientific, Co,CA) that was in-line coupled to the nanospray source of a LTQ-Orbitrap XL hybrid mass spectrometer (Thermo Scientific, San Jose, CA). Peptides were separated on an in-house packed emitter-tip column (75 um ID PicoTip fused silica tubing (New Objectives, Woburn, MA) packed with C-18 material on a length of 8–9 cm) by a gradient developed from 5% [v/v] acetonitrile, 0.2% [v/v] formic acid to 80% [v/v] acetonitrile, 0.2% [v/v] formic acid in water over 35 min at a flow rate of 400 nl/min. Full MS in a mass range between m/z 300–2000 was performed in the Orbitrap mass analyser with a resolution of 60,000 at m/z 400. The strongest 5 signals were selected for CID (collision induced dissociation)-MS/MS in the LTQ ion trap at a normalized collision energy of 35%. For protein identification, MS/MS data were searched against an in-house Mascot server (http://www.matrixscience.com). The search was set up for full tryptic peptides with a maximum of three missed cleavage sites. Carboxyamidomethyl cysteine, oxidized methionine, and pyroglutamate (E, Q) were included as variable modifications where appropriate. The precursor mass tolerance threshold was 10 ppm and the max fragment mass error was 0.8 Da. The significance of the predicted protein matches was calculated using the probability based scoring, termed the Mascot score (matrix science). The scores are calculated based on the peptide matches and the probability of these matches occurring at random. Stated simply, the higher the score, the greater the confidence of a significant match.

Co-Immunoprecipitation and Western Blotting

In P. atrosepticum WT or Δcas strains, either N- or C-terminally FLAG-tagged Csy or Cas6f proteins served as bait and were co-expressed with an N-terminally His-tagged Csy of Cas6f protein as prey. Co-expression of the His-Csy or His-Cas6f constructs with pBAD30 was performed as a negative control. Cell cultures (50 ml) were induced with 1 mM IPTG and 0.1% arabinose at an OD600 of 0.5, incubated for a further 4 h and pelleted for 15 min at 4°C and 3030×g. Co-IP was carried out using the FLAG® Tagged Protein Immunoprecipitation Kit (Sigma) according to the manufacturer’s instructions and as described previously [20]. Analysis of total cell extracts, wash fractions and eluted protein was performed by Western blotting as described previously [20]. Mouse monoclonal anti-His (Sigma) or anti-FLAG M2 (Sigma) were used as primary antibodies and as a secondary antibody, goat anti-mouse IgG-HRP (Santa Cruz) was used. Bands were visualized on X-Ray film (AGFA) using the SuperSignal® West Pico Chemiluminescent Substrate Kit (Pierce).

Results and Discussion

The Csy1-3 and Cas6f Proteins Co-purify

The formation of a complex of subtype-specific proteins has been observed across different types of CRISPR/Cas systems and plays a key role in interference [10], [11], [28], [29], [33]. We hypothesised that the P. atrosepticum subtype I-F specific proteins also formed a complex. To test this, an affinity co-purification and mass spectrometry approach was utilised. These experiments were performed in a Δcas strain with an entire deletion of the cas1, cas3, csy1-3, cas6f operon. This strain still expresses the WT CRISPR1-3 arrays and generates mature crRNAs when Cas6f is complemented, while there is no interference from chromosomally expressed Cas proteins [20]. P. atrosepticum Δcas strains were generated that each contained two plasmids, one expressing native Csy1-3 and Cas6f (pJSC11) and a second expression vector encoding a single N-terminally His-tagged Csy (Csy1-3) or Cas6f protein (pJSC3-6; all plasmids are listed in Table 1). Csy and Cas6f protein expression was induced in all four P. atrosepticum strains and the His-tagged Csy or Cas6f proteins were purified on Ni-NTA agarose under native conditions. Elution fractions were separated by SDS-PAGE to visualise co-purified proteins, which demonstrated proteins of the predicted masses of Csy1-3 and Cas6f (Fig. 1B). The predominant individual protein bands, and the protein content in entire lanes, were identified following trypsin digestion and mass spectrometry using an LTQ Orbitrap hybrid mass spectrometer, which enables high accuracy peptide determination in complex protein samples.

The co-purification of all Csy proteins was enriched following purification of each His-tagged Csy protein when compared with purification of an unrelated bait protein, His-SdhE (Fig. 1B and Table 3). Purification of either Csy1 or Csy2 resulted in a clear co-purification of the other (Fig. 1B and Table 3). Furthermore, Cas6f appears weakly associated with the complex when co-purified with His-tagged Csy1, Csy2 or Csy3. Indeed, the His-Csy1 or His-Csy2 baits gave only very faint bands of co-purified Cas6f on SDS-PAGE, but Cas6f was detected by MS. In contrast, when His-tagged Cas6f is used as the bait, there is a clear co-purification of the other Csy proteins (Fig. 1B and Table 3). In agreement, a study published during the preparation of our manuscript showed that in Pseudomonas, mature crRNAs generated by Cas6f were required for complex assembly [42]. In Pectobacterium, overexpression of Cas6f increased crRNA generation [20], which could explain the increased complex co-purification with higher Cas6f concentrations when also expressed from the bait plasmid. Surprisingly, in the band at ∼26 kDa, which is present in all four pulldowns, Cas6f and to a lesser extent Csy3 were identified. At this point we are unable to explain this alternative migration pattern. Overall, our results are in agreement with a recent report, which showed that the homologous Csy1-3 and Cas6f proteins from P. aeruginosa co-purified along with crRNA [35]. Wiedenheft et al. co-purified Csy1-3 and Cas6f using a heterologous E. coli system with over-expression of the pre-crRNA. In our study we have performed the analysis in the cognate host and utilised the physiological levels of pre-crRNA expression [35]. Taken together, these data demonstrate that the Csy1-3 and Cas6f proteins from different subtype I-F systems interact and form a complex.

thumbnail
Table 3. Co-purification of Csy1-3 and Cas6f proteins as detected by MS.

https://doi.org/10.1371/journal.pone.0049549.t003

Protein-protein Architecture of the Csy1-3, Cas6f Complex

The co-purification and MS approach described above indicated the formation of a complex composed of Csy1-3 and Cas6f. However, it was important to verify the formation of this complex using an alternative approach and to probe in more detail the individual protein-protein interactions. To achieve this, each Csy protein and Cas6f were FLAG-tagged separately at both the N- or C-terminus and each construct was used as the bait in co-immunoprecipitation (Co-IP) experiments with each prey Csy or Cas6f protein containing an N-terminal His-tag. Every possible combination of Co-IP experiments (32 in total) were performed in the WT background to determine which protein-protein interactions could be detected in vivo in the presence of both native crRNA production and other chromosomally-encoded Cas and Csy proteins (Fig. 2). In addition, a further complete set of 32 Co-IPs were performed in the Δcas strain lacking the entire cas1, cas3, csy1-3, cas6f operon. As mentioned above, this strain still contains the WT CRISPR1-3 arrays, but cannot generate mature crRNAs due to the lack of Cas6f [20]. Therefore, this strain enabled an assessment of interactions which still occur in vivo in the absence of mature crRNAs and other native Cas/Csy proteins (Fig. 2). A summary of the results for all Co-IPs performed is presented in Table 4.

thumbnail
Figure 2. Csy1-3 and Cas6f protein-protein interactions in WT and Δcas

strains. N- or C-terminally FLAG-tagged Csy proteins were expressed in the presence of N-terminally His-tagged Csy and Cas6f proteins. Proteins were expressed, cells were lysed, proteins purified on anti-FLAG agarose, washed and eluted. Fractions were separated by SDS-PAGE and proteins were detected by Western blotting. Lanes indicate protein expression (Total), the final wash (Wash) and the elution fraction (Elution). (A) Csy1 and Csy2 interact in the absence of other Cas or Csy proteins. (B) Csy3 and Csy1 interact in the WT but not in the Δcas mutant background. (C) Cas6f and Csy3 interact in the WT but not in the Δcas mutant background. (D) Csy3 self-assembles.

https://doi.org/10.1371/journal.pone.0049549.g002

thumbnail
Table 4. Summary of Cas and Csy protein Co-IP results.

https://doi.org/10.1371/journal.pone.0049549.t004

Csy1 and Csy2 co-purified in both the WT and somewhat weaker in the Δcas strain, suggesting this interaction does not require other Cas or Csy proteins nor does it require crRNAs (Fig. 2A). The stronger interaction in the WT indicates that the presence of the other proteins and/or the crRNA helps to stabilize the interaction without being essential. Indeed, His-Csy1 and native Csy2 can be co-purified from the Δcas mutant, the two co-elute on a size exclusion column and the stability of purified Csy2 is increased in the presence of Csy1 (J. T. Chang, C. Richter and P. C. Fineran, unpublished data). Likewise, Csy1 and Csy2 from P. aeruginosa could be co-purified from E. coli independently of the other Csy proteins [35]. When we expressed C-terminally tagged Csy2 (either FLAG- or His-tagged), this resulted in a truncated version of the protein of about 26 kDa, which did not interact with Csy1.

Csy1 and Csy3 co-purified weakly in the WT but not in the Δcas background (Fig. 2B). The requirement of the WT background for the Csy1-Csy3 interaction indicated an involvement of one or all of crRNA, Csy2 or Cas6f, albeit indirectly, since no interactions between Csy1 and Cas6f or Csy3 and Csy2 were detected (Table 4). It is probable, given the coupling of Csy1 to Csy2, that a heterodimer of these proteins is required to interact with Csy3 but the crRNA is also likely to play a role.

Csy3 and Cas6f interacted very weakly in the WT background, but not in the Δcas strain (Fig. 2C). As shown previously, Cas6f is sufficient to generate crRNAs [20]. Hence, we predict that Csy1 and Csy2 are also required to mediate the Csy3-Cas6f interaction. A requirement for Csy1 and Csy2 could also explain the low yield of co-purified Cas6f as the Csy3-Cas6f interaction shown in Figure 2C would depend on the lower native chromosomal expression of Csy1 and Csy2.

Finally, a strong interaction between Csy3 and itself was detected in both the WT and Δcas strains, consistent with it forming a dimer or higher order multimer (Fig. 2D). In support of a multimeric Csy3, purification of His-Csy3 results in purified protein that has a tendency to aggregate and could not be resolved by size-exclusion chromatography (C. Richter and P. C. Fineran, unpublished data).

Previously, we demonstrated that Cas6f self-interacts in both WT and Δcas Pectobacterium backgrounds, [20], but a Cas6f dimer was not observed in the Pseudomonas complex [35]. The role of the Cas6f self-interaction is unknown, but could be due to multiple Cas6f proteins bound to one pre-crRNA or a consequence of an increase in Cas6f relative to the Csy1-3 proteins due to overexpression.

This exhaustive Co-IP approach demonstrated that the organisation of the Csy complex follows the arrangement of Csy2-Csy1-Csy3(n)-Cas6f (summarised in Figure 3), which is consistent with the observations from the complex pulldown assays (Table 3). Csy1 and Csy2 appear to form one end of the complex while a Csy3 multimer interacts with Csy1 and Cas6f, bridging the two and forming the backbone of the complex. The recent study of a similar complex from P. aeruginosa used native MS and size exclusion chromatography to predict that the stoichiometry was Csy11:Csy21:Csy36:Cas6f1:cRNA1 with a MW of ∼350 kDa [35]. The same authors used TEM and small-angle X-ray scattering to identify a 120×150 Å crescent-like structure with a regular repeating feature, suggesting Csy3 forms the backbone. Our Co-IP interaction data showing that Csy3 self-interacts and forms protein-protein interactions with Csy1 and Cas6f corroborates this model and provides alternative and additional evidence for this arrangement of the subtype I-F complexes. Furthermore, our data shows for the first time that Csy3-Csy3 and Csy1-Csy2 interact in vivo without the requirement for other Cas or Csy proteins or mature crRNAs. In Pseudomonas, the Csy1-3 and Cas6f arch is 200 Å in length, consistent with a crRNA lying along the length of the complex [35]. We have demonstrated that Pectobacterium Cas6f processes the pre-crRNA [20] and, in Pseudomonas, Cas6f retains bound crRNA at the stem-loop of the repeat [26], [43]. Recently, crRNA maturation by Cas6f was shown to be necessary for Csy1-3, Cas6f-crRNA complex assembly in Pseudomonas [42]. Taken together with our data, we propose that following crRNA generation by Cas6f, Csy1 and Csy2 bind the 5′ 8 nt handle (hence the Csy1-Csy2 interaction does not require Csy3 or Cas6f). Next, Csy3 binds Csy1, oligomerizes and binds non-specifically to the variable crRNA spacer sequence to complete the complex via interaction with Cas6f. In this model, the location of Csy1 and Csy2 on the 5′ 8 nt handle, suggests Csy1, Csy2 and the handle would be important in distinguishing target from non-target during interference [44].

thumbnail
Figure 3. Summary of protein interactions in the CRISPR/Cas subtype I-F system.

Protein interactions detected by Co-IP are shown as dashed lines (interact only in WT) or solid lines (interact in WT and Δcas). The Csy3-Csy3 interaction is denoted (n) as multiple Csy3 proteins could interact. Cas3 (Cas2-Cas3 hybrid) was shown to co-purify the Csy1-3 and Cas6f proteins and also co-purify with Cas1. In the subtype I-F systems, Cas6f is involved in crRNA generation [20], [26] and Csy1-3, Cas6f bound to a crRNA can bind complementary DNA targets [35] and requires Cas3 for interference [46]. Cas3 (Cas2-Cas3) and Cas1 are predicted to be involved in spacer acquisition.

https://doi.org/10.1371/journal.pone.0049549.g003

Cas3 but not Cas1 Interacts with the Csy1-3, Cas6f Complex

Subtype-specific complex formation has been detected for the E. coli subtype I-E system. Cascade contains a single crRNA [28], [29] and is able to bind to target DNA in a sequence-specific manner [28] but requires the presence of Cas3 to mediate the inhibition of phage infection via cleavage of the target DNA [10], [38]. Cas3 is the signature protein of type I CRISPR/Cas systems, containing nuclease and helicase domains [14] and aids interference by unwinding and cleaving the target DNA [36]–[38], [45].

We hypothesised that the subtype I-F Cas3 would interact with the Csy complex. Co-IPs were performed with each of N- or C- terminal FLAG-tagged Csy1-3 and Cas6f as bait and N-terminal His-Cas3 as the prey in WT and Δcas P. atrosepticum but no interactions were detected (data not shown). In a complementary and non-directed approach, His-Cas3 was expressed in the presence of the Csy1-3 and Cas6f proteins in the Δcas strain and purified under native conditions. The elution fractions were analysed by SDS-PAGE and co-purifying proteins identified using a highly-sensitive LTQ Orbitrap hybrid MS. Csy1, Csy2, Csy3 and to a lesser extent Cas6f, were all enriched upon co-purification with Cas3 compared with an unrelated control protein (Table 3). This result suggested that Cas3 can interact with the Csy complex. Interestingly, Westra et al. recently showed that the E. coli subtype I-E Cascade binds the complementary target DNA and then recruits Cas3 [38]. Therefore, it is likely that the Cas3-Csy complex interaction also requires the presence of a target DNA sequence. In our experiments target DNA was not supplied exogenously, which might explain the lower protein coverage and score for co-purification of Csy1-3 and Cas6f with Cas3 when compared with the other Csy protein baits (Table 3). However, a crRNA generated from CRISPR2 contains a spacer that deviates from the consensus PAM, but has 100% identity to eca0560 in a genomic island of P. atrosepticum [20]. The presence of this native crRNA:target combination might be sufficient to detect co-purification in the larger scale pull-down assays, but not for small scale Co-IP experiments. It is also possible that the PAM deviation might still allow recruitment of Cas3 but result in a lower affinity interaction with the Csy complex [22].

An identical experiment was performed using His-Cas1 as bait. However, when compared with the controls His-Cas1 did not co-purify Csy1-3 and Cas6f proteins when assessed by SDS-PAGE or LTQ Orbitrap hybrid MS analysis (Table 3), consistent with evidence that Cas1 is not required for interference by subtype I-F [46] and I-E [10] CRISPR/Cas systems. In summary, Csy1-3 and Cas6f co-purified with Cas3 but Cas1 alone did not interact with the Csy complex.

Cas1 and Cas3 Interact

The least well characterised phase of CRISPR/Cas immunity is the acquisition of new spacer DNA from foreign genetic elements. This adaptation stage, which has been considered the highly conserved ‘information processing subsystem’ [14], involves the Cas1 and Cas2 proteins [17], [22]. In agreement, Cas1 and Cas2 are not required for interference [10]. Cas1 possesses metal-dependent endonuclease activity against dsDNA and generates ∼80 bp fragments [47], whereas different Cas2 proteins were shown to cleave single stranded RNA at U-rich regions [48] or double stranded DNA [49].

Subtype I-F CRISPR/Cas systems do not have a cas2 gene, but their Cas3 proteins are proposed to have an N-terminal domain with homology to Cas2 (COG1343). Hence, this gene has recently been termed cas2-cas3 [7], [14]. However, this is controversial as other groups have failed to detect a Cas2 domain in the N-terminus of the subtype I-F Cas3 from Pseudomonas aeruginosa [46]. We performed an analysis using a structural homology search using Phyre2 (Fig. 4A) [50].

thumbnail
Figure 4. Cas1 and Cas3 interact.

(A) Predicted Cas2, HD nuclease and helicase domains present in P. atrosepticum Cas3 based on structural homology using Phyre2 [50]. (B) Secondary structure of Desulfovibrio vulgaris (DvuCas2) and multiple sequence alignment of the N-terminal 110 aa of Cas3 with Cas2 homologues for which there is structural data. Blue arrows indicate β–sheets and orange barrels α–helices. Residues identified to be involved in protein function are marked with asterisks. Conserved residues are depicted in red, functionally similar residues in yellow. (C) Co-purification of His-Cas1 and Cas3 following expression in the Δcas mutant (PCF80, pJSC10). Proteins in the soluble fraction (lane 1) were loaded onto Ni-NTA-agarose and washed with 40 mM imidazole. Proteins bound specifically were eluted with an imidazole gradient: 62.5 mM (lane 2), 125 mM (lane 3), 187.5 mM (lane 4) and 250 mM (lanes 5 and 6). (D) Co-purification of His-Cas1 and Cas3 in the presence of Csy1-3 and Cas6f following expression in the Δcas mutant with pJSC10 (Cas1,3) and pJSC11 (Csy1-3, Cas6f). (E) Gel filtration fraction of His-Cas1 and Cas3 following an initial Ni-NTA purification. All samples were separated by SDS-PAGE and proteins visualized by Coomassie staining.

https://doi.org/10.1371/journal.pone.0049549.g004

First we searched with the full-length P. atrosepticum Cas3 sequence (1098 aa), which demonstrated that Cas3 matched the HD nuclease domain of both THB187 (Cas3) from Thermus thermophilus (24% id for amino acids 110–344) [45] and MJ0384 (Cas3) from Methanocaldococcus jannaschii (24% id for amino acids 110–225) [36]. The P. atrosepticum sequence from ∼380–890 aa matched many ATP-dependent DNA helicases. Next, we used the N-terminal 110 aa and searched again using the intensive mode, which resulted in the 4 top hits matching to Cas2 homologues from Pyrococcus furiosus (Pfu1117) with 16% identity and 77.6% confidence for amino acids 1–73, Bacillus halodurans (Bh0342) [49] with 11% identity and 55.1% confidence for amino acids 1–72, Desulfovibrio vulgaris (DvuCas2) [51] with 10% identity and 49.8% confidence for amino acids 1–67 and Thermus thermophilus (Tth1823) with 13% identity and 44% confidence for amino acids 1–67.

To further investigate the degree of homology we performed a multiple sequence alignment of the N-terminal 110 aa of Cas3 with the four Cas2 homologues obtained in the Phyre2 search and two additional proteins from Sulfolobus, Sso1404 [48] and Sso8090, using T-Coffee (Fig. 4B) [52]. Previously identified conserved residues with implications for protein function are D8 or D10, which coordinate a divalent metal ion in Bh0342 or Sso1404 homodimers, respectively [48], [49], and Y9, R17, R18, R31 and F37 in Sso1404 [48]. Furthermore, Q33 is highly conserved. All of these amino acids are located in the N-terminal half of Cas2, while the C-terminus is less conserved [51]. In the P. atrosepticum Cas2 domain, Y9 is replaced by a serine, which is shorter, but also contains an OH group on the side chain. D8/D10 is conservatively substituted by glutamic acid, which has the same charge. Residues R17 and Q33 are conserved in the P. atrosepticum Cas2-Cas3 and R31 is present in a slightly altered position. R19 is not present but does not seem to be highly conserved amongst the Cas2 homologues. In P. atrosepticum, F37 is substituted by threonine, but it is possible that a cluster of hydrophobic amino acids (A35, I36, L38) in the vicinity compensate. In summary, residues that are conserved across Cas2 proteins are also present or replaced by functionally similar amino acids in P. atrosepticum Cas2-Cas3. Taken together, subtype I-F Cas3 proteins contain, in addition to the nuclease and helicase domains, a Cas2-like domain at the N-terminus of the protein, which might be required for spacer acquisition (Fig. 4A and B) [7], [14].

We hypothesised that if Cas1 and Cas2 are involved in acquisition via the ‘information processing subsystem’ that these proteins might interact as an additional Cas protein complex. Hence we would also expect interaction of Cas1 with the Cas2-Cas3 fusion in the subtype I-F CRISPR/Cas system in P. atrosepticum. Purification of His-Cas1 under native conditions in the presence of untagged Cas3 in the Δcas background led to a clear co-purification of both proteins that was confirmed by MS (Fig. 4C). Native Cas3 did not bind non-specifically to the Ni-NTA in the absence of His-Cas1 (data not shown). Furthermore, the presence or absence of the Csy1–3 or Cas6f proteins had no discernible effect on this interaction (compare Fig. 4C and 4D). The His-Cas1 and Cas3 that were co-purified were analysed by size exclusion chromatography, which demonstrated a stable His-Cas1-Cas3 complex (Fig. 4E). Taken together, these results demonstrated that Cas1 and Cas3 interact, without a requirement for crRNA or Csy1-3 and Cas6f proteins (summarised in Fig. 3). We propose that the Cas1-Cas3 complex is involved in the acquisition of new spacers in the subtype I-F system. Since in E. coli (type I-E) Cas1 and Cas2 are required for the integration of new spacers [17], [22], we predict that Cas2-like domain in the P. atrosepticum Cas3 mediates the interaction with Cas1. In agreement, an N-terminal His-tag on Cas3 interferes with the Cas1-Cas3 interaction in Co-IP experiments (data not shown).

Furthermore, a very recent report of a subtype I-A system provides an example of a Cas1-Cas2 fusion protein in Thermoproteus tenax [53]. The Cas1-Cas2 fusion protein interacts with Cas4 and Csa1 in a complex the authors’ term Cascis (CRISPR associated complex for the integration of spacers), but its role in adaptation is not clear [53]. We envisage that the Cas1-Cas3 complex is a similar Cascis-type complex that is likely to be involved in the adaptation stage of the CRISPR/Cas mechanism.

A remaining question is why are subtype I-F Cas3 proteins fused to Cas2 domains rather than having a separate Cas2? Although the reason for the Cas2-Cas3 fusion is unclear, recent studies in the subtype I-E system of E. coli have implicated Cas3 in addition to Cascade in spacer acquisition in a process termed ‘priming’ [16], [22]. In priming, the presence of an initial spacer ‘primes’ the CRISPR/Cas system for the acquisition of multiple spacers from the invading phage or plasmid that are derived from the same DNA strand as the initial spacer [16], [22]. In the subtype I-E system, Cas1, Cas2, Cas3 and Cascade are required for multiple acquisition events, which are proposed to enable the rapid adaptation to invading elements that have mutated to escape the initial spacers [22]. Therefore, it is plausible that the interaction of Cas1 with the fusion of Cas2-Cas3, not only aids initial acquisition (requiring Cas1 and Cas2), but also assists in the Cas3-dependent acquisition of multiple spacers.

Conclusions

In summary, our study provides insight into the architecture of the Cascade-like Csy1-3, Cas6f complex based on in vivo protein-protein interaction experiments and demonstrates which protein interactions can occur in vivo in the native host background in the absence of crRNA and/or other Cas proteins. We also provide the first experimental evidence for a potential role of subtype I-F Cas3 as a double agent, being able to interact with both the Csy complex and Cas1 and thus, likely to be involved in both stages of CRISPR immunity: spacer acquisition and interference.

Acknowledgments

The authors thank Torsten Kleffmann and Simone Schönleben at the Centre for Protein Research at the University of Otago for MS assistance, Kurt Krause and Helen Opel-Reading for use of and help with size exclusion equipment, Matthew McNeil for plasmid pMAT4, members of the Cook and Fineran laboratories for helpful discussions and Edze Westra for critically reading the manuscript.

Author Contributions

Conceived and designed the experiments: CR TG PCF. Performed the experiments: CR TG JSC PCF. Analyzed the data: CR PCF. Wrote the paper: CR PCF.

References

  1. 1. Platt TG, Bever JD, Fuqua C (2012) A cooperative virulence plasmid imposes a high fitness cost under conditions that induce pathogenesis. Proc Biol Sci 279: 1691–1699.
  2. 2. Labrie SJ, Samson JE, Moineau S (2010) Bacteriophage resistance mechanisms. Nat Rev Microbiol 8: 317–327.
  3. 3. Petty NK, Evans TJ, Fineran PC, Salmond GP (2007) Biotechnological exploitation of bacteriophage research. Trends Biotechnol 25: 7–15.
  4. 4. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, et al. (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315: 1709–1712.
  5. 5. Marraffini LA, Sontheimer EJ (2008) CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322: 1843–1845.
  6. 6. Grissa I, Vergnaud G, Pourcel C (2007) The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics 8: 172.
  7. 7. Makarova KS, Grishin NV, Shabalina SA, Wolf YI, Koonin EV (2006) A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol Direct 1: 7.
  8. 8. Mojica FJ, Diez-Villasenor C, Garcia-Martinez J, Almendros C (2009) Short motif sequences determine the targets of the prokaryotic CRISPR defence system. Microbiology 155: 733–740.
  9. 9. Bolotin A, Quinquis B, Sorokin A, Ehrlich SD (2005) Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 151: 2551–2561.
  10. 10. Brouns SJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJ, et al. (2008) Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321: 960–964.
  11. 11. Hale CR, Zhao P, Olson S, Duff MO, Graveley BR, et al. (2009) RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex. Cell 139: 945–956.
  12. 12. Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS Comput Biol 1: e60.
  13. 13. Makarova KS, Aravind L, Wolf YI, Koonin EV (2011) Unification of Cas protein families and a simple scenario for the origin and evolution of CRISPR-Cas systems. Biol Direct 6: 38.
  14. 14. Makarova KS, Haft DH, Barrangou R, Brouns SJ, Charpentier E, et al. (2011) Evolution and classification of the CRISPR-Cas systems. Nat Rev Microbiol 9: 467–477.
  15. 15. Wiedenheft B, Sternberg SH, Doudna JA (2012) RNA-guided genetic silencing systems in bacteria and archaea. Nature 482: 331–338.
  16. 16. Swarts DC, Mosterd C, van Passel MW, Brouns SJ (2012) CRISPR Interference Directs Strand Specific Spacer Acquisition. PLoS One 7: e35888.
  17. 17. Yosef I, Goren MG, Qimron U (2012) Proteins and DNA elements essential for the CRISPR adaptation process in Escherichia coli. Nucleic Acids Res. 40: 5569–5576.
  18. 18. Deveau H, Barrangou R, Garneau JE, Labonte J, Fremaux C, et al. (2008) Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J Bacteriol 190: 1390–1400.
  19. 19. Pougach K, Semenova E, Bogdanova E, Datsenko KA, Djordjevic M, et al. (2010) Transcription, processing and function of CRISPR cassettes in Escherichia coli. Mol Microbiol 77: 1367–1379.
  20. 20. Przybilski R, Richter C, Gristwood T, Clulow JS, Vercoe RB, et al. (2011) Csy4 is responsible for CRISPR RNA processing in Pectobacterium atrosepticum. RNA Biol 8: 517–528.
  21. 21. Erdmann S, Garrett RA (2012) Selective and hyperactive uptake of foreign DNA by adaptive immune systems of an archaeon via two distinct mechanisms. Mol Microbiol 85: 1044–1056.
  22. 22. Datsenko KA, Pougach K, Tikhonov A, Wanner BL, Severinov K, et al. (2012) Molecular memory of prior infections activates the CRISPR/Cas adaptive bacterial immunity system. Nat Commun 3: 945 .
  23. 23. Lillestol RK, Redder P, Garrett RA, Brugger K (2006) A putative viral defence mechanism in archaeal cells. Archaea 2: 59–72.
  24. 24. Carte J, Wang R, Li H, Terns RM, Terns MP (2008) Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes. Genes Dev 22: 3489–3496.
  25. 25. Hale C, Kleppe K, Terns RM, Terns MP (2008) Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus. RNA 14: 2572–2579.
  26. 26. Haurwitz RE, Jinek M, Wiedenheft B, Zhou K, Doudna JA (2010) Sequence- and structure-specific RNA processing by a CRISPR endonuclease. Science 329: 1355–1358.
  27. 27. Hatoum-Aslan A, Maniv I, Marraffini LA (2011) Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site. Proc Natl Acad Sci U S A 108: 21218–21222.
  28. 28. Jore MM, Lundgren M, van Duijn E, Bultema JB, Westra ER, et al. (2011) Structural basis for CRISPR RNA-guided DNA recognition by Cascade. Nat Struct Mol Biol. 8: 529–536.
  29. 29. Wiedenheft B, Lander GC, Zhou K, Jore MM, Brouns SJ, et al. (2011) Structures of the RNA-guided surveillance complex from a bacterial immune system. Nature 477: 486–489.
  30. 30. Babu M, Beloglazova N, Flick R, Graham C, Skarina T, et al. (2011) A dual function of the CRISPR-Cas system in bacterial antivirus immunity and DNA repair. Mol Microbiol 79: 484–502.
  31. 31. Zhang J, Rouillon C, Kerou M, Reeks J, Brugger K, et al. (2012) Structure and Mechanism of the CMR Complex for CRISPR-Mediated Antiviral Immunity. Mol Cell 45: 303–313.
  32. 32. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, et al. (2012) A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science 337: 816–821.
  33. 33. Lintner NG, Kerou M, Brumfield SK, Graham S, Liu H, et al. (2011) Structural and functional characterization of an archaeal clustered regularly interspaced short palindromic repeat (CRISPR)-associated complex for antiviral defense (CASCADE). J Biol Chem 286: 21643–21656.
  34. 34. Nam KH, Haitjema C, Liu X, Ding F, Wang H, et al. (2012) Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System. Structure 20: 1574–1584.
  35. 35. Wiedenheft B, van Duijn E, Bultema J, Waghmare S, Zhou K, et al. (2011) RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions. Proc Natl Acad Sci U S A. 108: 10092–10097.
  36. 36. Beloglazova N, Petit P, Flick R, Brown G, Savchenko A, et al. (2011) Structure and activity of the Cas3 HD nuclease MJ0384, an effector enzyme of the CRISPR interference. EMBO J 30: 4616–4627.
  37. 37. Sinkunas T, Gasiunas G, Fremaux C, Barrangou R, Horvath P, et al. (2011) Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system. EMBO J 30: 1335–1342.
  38. 38. Westra ER, van Erp PB, Kunne T, Wong SP, Staals RH, et al. (2012) CRISPR Immunity Relies on the Consecutive Binding and Degradation of Negatively Supercoiled Invader DNA by Cascade and Cas3. Mol Cell 46: 595–605.
  39. 39. Bell KS, Sebaihia M, Pritchard L, Holden MT, Hyman LJ, et al. (2004) Genome sequence of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica and characterization of virulence factors. Proc Natl Acad Sci U S A 101: 11105–11110.
  40. 40. McNeil MB, Clulow JS, Wilf NM, Salmond GP, Fineran PC (2012) SdhE is a conserved protein required for the flavinylation of succinate dehydrogenase in bacteria. J Biol Chem 287: 18418–18428.
  41. 41. Shevchenko A, Jensen ON, Podtelejnikov AV, Sagliocco F, Wilm M, et al. (1996) Linking genome and proteome by mass spectrometry: large-scale identification of yeast proteins from two dimensional gels. Proc Natl Acad Sci U S A 93: 14440–14445.
  42. 42. Haurwitz RE, Sternberg SH, Doudna JA (2012) Csy4 relies on an unusual catalytic dyad to position and cleave CRISPR RNA. EMBO J 31: 2824–2832.
  43. 43. Sternberg SH, Haurwitz RE, Doudna JA (2012) Mechanism of substrate selection by a highly specific CRISPR endoribonuclease. RNA 18: 661–672.
  44. 44. Marraffini LA, Sontheimer EJ (2010) Self versus non-self discrimination during CRISPR RNA-directed immunity. Nature 463: 568–571.
  45. 45. Mulepati S, Bailey S (2011) Structural and biochemical analysis of nuclease domain of clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 3 (Cas3). J Biol Chem 286: 31896–31903.
  46. 46. Cady KC, O’Toole GA (2011) Non-identity-mediated CRISPR-bacteriophage interaction mediated via the Csy and Cas3 proteins. J Bacteriol 193: 3433–3445.
  47. 47. Wiedenheft B, Zhou K, Jinek M, Coyle SM, Ma W, et al. (2009) Structural basis for DNase activity of a conserved protein implicated in CRISPR-mediated genome defense. Structure 17: 904–912.
  48. 48. Beloglazova N, Brown G, Zimmerman MD, Proudfoot M, Makarova KS, et al. (2008) A novel family of sequence-specific endoribonucleases associated with the clustered regularly interspaced short palindromic repeats. J Biol Chem 283: 20361–20371.
  49. 49. Nam KH, Ding F, Haitjema C, Huang Q, Delisa MP, et al.. (2012) Double-stranded Endonuclease Activity in B. halodurans Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Cas2 Protein. J Biol Chem. doi:10.1074/jbc.M112.382598.
  50. 50. Kelley LA, Sternberg MJ (2009) Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc 4: 363–371.
  51. 51. Samai P, Smith P, Shuman S (2010) Structure of a CRISPR-associated protein Cas2 from Desulfovibrio vulgaris. Acta Crystallogr Sect F Struct Biol Cryst Commun 66: 1552–1556.
  52. 52. Notredame C, Higgins DG, Heringa J (2000) T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol 302: 205–217.
  53. 53. Plagens A, Tjaden B, Hagemann A, Randau L, Hensel R (2012) Characterization of the CRISPR/Cas subtype I-A system of the hyperthermophilic crenarchaeon Thermoproteus tenax. J Bacteriol 194: 2491–2500.
  54. 54. Guzman LM, Belin D, Carson MJ, Beckwith J (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol 177: 4121–4130.