Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

RETRACTED: Modeling and Experimental Analyses Reveals Signaling Plasticity in a Bi-Modular Assembly of CD40 Receptor Activated Kinases

Retraction

After this article [1] was published, concerns were raised about Figs 8, S6, and S7.

Specifically:

  • In Fig 8B, lanes 2 and 3 of both the IM – GAPDH and IM – Lyn panels appear more similar than would be expected from independent results.
  • The Fig S6A p-syk (1 µg/ml) and Fig S6D p38 (αCD40 -1 µg/ml) panels appear similar.
  • The Fig S7B p38 and Fig S7F Syk panels appear similar.

The Corresponding Author did not agree with the above concerns and stated that the original image data underlying the figures of concern are no longer available. In the absence of the original image data, the concerns remain unresolved.

In light of the above unresolved concerns, which question the integrity and reliability of the reported results and conclusions, the PLOS One Editors retract this article.

BS did not respond to the final editorial decision. US, AS, MM, VK, RS, SP, NS, SR, SS, IG, AGC, and RM either did not respond directly or could not be reached.

21 Apr 2026: The PLOS One Editors (2026) Retraction: Modeling and Experimental Analyses Reveals Signaling Plasticity in a Bi-Modular Assembly of CD40 Receptor Activated Kinases. PLOS ONE 21(4): e0347622. https://doi.org/10.1371/journal.pone.0347622 View retraction

Abstract

Depending on the strength of signal dose, CD40 receptor (CD40) controls ERK-1/2 and p38MAPK activation. At low signal dose, ERK-1/2 is maximally phosphorylated but p38MAPK is minimally phosphorylated; as the signal dose increases, ERK-1/2 phosphorylation is reduced whereas p38MAPK phosphorylation is reciprocally enhanced. The mechanism of reciprocal activation of these two MAPKs remains un-elucidated. Here, our computational model, coupled to experimental perturbations, shows that the observed reciprocity is a system-level behavior of an assembly of kinases arranged in two modules. Experimental perturbations with kinase inhibitors suggest that a minimum of two trans-modular negative feedback loops are required to reproduce the experimentally observed reciprocity. The bi-modular architecture of the signaling pathways endows the system with an inherent plasticity which is further expressed in the skewing of the CD40-induced productions of IL-10 and IL-12, the respective anti-inflammatory and pro-inflammatory cytokines. Targeting the plasticity of CD40 signaling significantly reduces Leishmania major infection in a susceptible mouse strain. Thus, for the first time, using CD40 signaling as a model, we show how a bi-modular assembly of kinases imposes reciprocity to a receptor signaling. The findings unravel that the signalling plasticity is inherent to a reciprocal system and that the principle can be used for designing a therapy.

Introduction

A membrane receptor binds its ligand through its extracellular domain and processes the message through intracellular signaling molecules to trigger the effector functions. A receptor can trigger physiologically distinct cellular fates in response to different strengths of an identical stimulus. For example, in T cells, accumulation of cytotoxic T lymphocyte antigen-4 (CTLA-4) at the immunological synapse is proportional to the strength of the T cell receptor (TCR) signal [1]. Likewise, in human and mouse CD4+ and CD8+ T cells, weaker stimulation of TCR results in death whereas stronger stimulation promote overall cell fitness [2]. Similarly, CD40, a transmembrane receptor expressed on various cell types such as macrophages, B cells, dendritic cells, fibroblasts and endothelial cells [3], [4], binds to its ligand CD154/CD40L/gp39 [3]. In macrophages, CD40 induces the phosphorylation of MAPKs, ERK1/2 and p38MAPK, reciprocally depending on the strength of its stimulation [5]. At low doses of the agonistic anti-CD40 antibody, ERK-1/2 is maximally phosphorylated but p38MAPK is minimally phosphorylated; as the dose increases, p38MAPK phosphorylation increases with reciprocal decrease in ERK-1/2 phosphorylation [5]. Biological functions triggered by different doses of the anti-CD40 antibody are also functionally opposing: ERK-1/2 and p38MAPK activations are associated with the induction of Interleukin-10 (IL-10; an anti-inflammatory cytokine) or IL-12 (a pro-inflammatory cytokine) expression, respectively [5]. But, a quantitative approach to unravel the fundamental requirement for emergence of such reciprocal regulation or the regulatory design of CD40 triggered reciprocal signaling network remains elusive.

Logically, as the signal flows from the receptor to the nuclear targets [6][8], a cascade of upstream kinases must relay the information from the cell membrane located receptor to ERK-1/2 and p38MAPK, which are the terminal layer cytoplasmic kinases. In line with this argument, CD40 activates two membrane kinases, Syk and Lyn, that are the initial upstream activators of ERK-1/2 and p38MAPK, respectively [9]. The kinases PI3-K, Raf-1, MEK-1/2 and MKK-3/6 are also implicated in CD40 signaling [9][11], but the responses of these kinases to various strengths of CD40 stimulus (anti-CD40 antibody) remain to be elucidated.

Here, our CD40 signal dose-response experiments with macrophages show that based on their phosphorylation profiles, the kinases can be clustered into two modules: the kinases in the 1st module (M1) were maximally phosphorylated at lower doses of the stimulus whereas the kinases in the 2nd module (M2) were maximally phosphorylated at higher doses of the stimulus. The experimental perturbation studies revealed the intrinsic plasticity that guides the systems signalling direction: inhibition of any kinase of M1 leads to inhibition of rest of the kinases of M1 and activation of all the kinases in M2, and vice versa. The mathematical model built to reproduce the dose-dependent reciprocal phosphorylation of the bi-modular assembly of kinases suggests that two negative feedback loops are indeed required to reproduce the reciprocal effects observed in the experimental perturbations. For the biological significance of the model, we argued that as the protozoan parasite Leishmania major exploits the plasticity by skewing the CD40 signaling towards ERK-1/2 phosphorylation at all doses, targeting the systems plasticity to redirect the signal in a reverse way to p38MAPK can be an effective immunotherapeutic strategy. We verified our hypothesis with the model-guided experimental perturbations in L. major-infected macrophages and in susceptible BALB/c mice.

Results

Signal Dose-dependent Bi-modular Organization of Kinases

Syk and lyn are the kinases recruited first to the ligand bound CD40 [9], whereas Raf-1, MEK-1/2 and MKK-3/6 are cytoplasmic signaling intermediates downstream to syk and lyn [9], [10]. ERK-1/2 and p38MAPK are the terminal cytoplasmic kinases that capture the information from their upstream cytoplasmic kinases and relay it to the nucleus for triggering various transcription factors [7], [9], [10]. In order to trace a possible modular organization of these kinases, macrophages were stimulated with three different doses of the anti-CD40 antibody [5] - the low dose (L; 1 µg/ml), the medium dose (M; 3 µg/ml) and the high dose (H; 8 µg/ml). We observed that syk, Raf-1, MEK-1/2 and ERK-1/2 phosphorylations were higher at low dose, whereas lyn, PI3-K, MKK-3/6 and p38MAPK phosphorylations were maximum at high dose of CD40 stimulation. Therefore, depending on the profiles of their phosphorylations as functions of the strength of stimulation, these kinases were clustered into two modules: the M1 module is comprised of syk, Raf-1, MEK-1/2 and ERK-1/2 (Figure 1A) whereas the M2 module is comprised of lyn, PI3-K, MKK-3/6 and p38MAPK (Figure 1B). The experiments thus show that CD40 signal strength-dependent reciprocal phosphorylation of the kinases is a system level behaviour, spanning from the cell membrane located syk and lyn (the first layer) to the cytoplasmic ERK-1/2 and p38MAPK (the terminal layer). The observations were made at 15 minutes after stimulation (Figure 1A and 1B) following previously standardized guidelines [5], [9].

thumbnail
Figure 1. Reciprocal bi-modular activation of CD40 activated kinases and their response to external perturbations.

Four kinases: syk, Raf-1, MEK-1/2 and ERK-1/2 exhibit reduced (A), whereas the other four kinases: lyn, PI3-K, MKK-3/6 and p38MAPK exhibited enhanced phosphorylation (B), upon increase in dose strength. The plots in A and B show the mean of three experimentally observed ratio of phosphorylated kinase/total kinase. In the figures, “p-Kinase” represents the phosphorylated kinases. Also, L = 1 µg/ml; M = 3 µg/ml; H = 8 µg/ml of α-CD40 antibody. The representative western blots are in Figure S5 and the densitometric analysis results are in dataset S1.

https://doi.org/10.1371/journal.pone.0039898.g001

Next, to understand the dynamics of phosphorylation in a reciprocal system, we studied phosphorylation kinetics of syk, lyn and the terminal MAPKs, ERK-1/2 and p38MAPK (Figure 2). The dynamic studies suggest that reciprocal nature of the system is not affected due to its different exposure times to the incoming signal, and the system exhibited reciprocal bi-modular phosphorylation for both short and long duration signals (Figure 2). Therefore, in order to find out the mechanism of the emergence of the observed reciprocity, we built a computational model of signal transduction.

thumbnail
Figure 2. Kinetics of reciprocal signal propagation.

The kinetics of phosphorylation of top layer kinases syk, lyn and terminal layer kinases ERK-1/2 and p38MAPK. Ratio of phosphorylation (phosphorylated kinase/Total kinase) of the kinases at 5, 15, 30, 60 minutes is shown for three doses- L, M and H- of αCD40. The representative western bolts are given as figure S6 and the densitometric analysis results are in dataset S2.

https://doi.org/10.1371/journal.pone.0039898.g002

Model of Signal Transduction Identified a Trans-modular Negative Feedback Loop

Upon ligand binding, CD40 recruits syk and lyn in two different membrane domains in macrophages [9]. As the mechanistic details of the activation of syk and lyn by CD40 is yet to be understood clearly, phosphorylation of syk and lyn in the CD40 signalosome complexes was assumed to be captured by the parameters V1 (equation 1, syk phosphorylation) and V13 (equation 2, lyn phosphorylation). Equations for v1 and v13 are the fluxes of syk and lyn phosphorylation, respectively. Km1, Ka1, Km13, Ka13 are the constants associated with the activation process.(1)(2)

Both the equations represent that CD40 is not an enzyme but it acts as an essential activator of syk and lyn. This assumption is empirically driven from our previous observations that CD40 is required for the phosphorylation process of syk and lyn, but it cannot phosphorylate the kinases itself and requires various adaptor molecules (TRAFs) for the assembly of the kinases following which phosphorylation occurs [9]. Derivation of equations (1) and (2) is described in the methods sections. Although lyn is reported to phosphorylate syk in B cells [12], in our experimental system (macrophages) we show that phosphorylation of lyn is reciprocally coupled to the phosphorylation of syk [5], [9], thus lyn is not considered as an activator of syk in our model (In equations (1) and (2) ). As CD40 represents the active/ligand bound receptor, change in the signal strength is assumed to be captured by change in the numerical value of CD40 in the equations (1) and (2).

Experimentally, three different doses of anti-CD40 antibody were used as standardized earlier [5]. In the model, experimental equivalent of signal strength is the numerical value given to CD40 low dose: CD40 = 1; Medium dose CD40 = 4; High dose CD40 = 8. The complete sets of model equations are listed in the methods section and the parameter values and concentrations are listed in text S1. The model was built dimensionless.

As syk concentration is much higher than that of lyn [12], the initial difference in v1 and v13 is due to differences in cellular concentration of syk and lyn (with all the other respective kinetic parameters of v1 and v13 kept identical: V1 = V13; Ka1 = Ka13; Km1 = Km13). Hence, at lower signal doses, amount of syk phosphorylated is sufficient to trigger phosphorylation of its downstream kinases, but lyn phosphorylation was insufficient to trigger its downstream phosphorylation. However, as the signal strength increased, the amplitude of lyn phosphorylation becomes sufficient to trigger its downstream phosphorylation resulting in indiscriminate phosphorylation of M1 and M2 kinases after a certain dose of signal strength (figure S1). In contrast, we found in the experiments that increase in signal strength results in inhibition of all the M1 kinases and concurrent enhancement in phosphorylation of all the M2 kinases (Figure 1 and Figure 2) implying the presence of a negative regulation (feedback) on all the M1 kinases, wherein the strength of negative feedback was directly proportional to the applied signal dose. Therefore, we tested whether a single negative feedback loop emerging from the M2 module and operational in the M1 module could reproduce the experimental observations. A functional negative feedback loop from phosphorylated p38MAPK (p38MAPK-PP) to syk phosphorylation step was implemented in the model as shown in Figure 3A.

thumbnail
Figure 3. Computational reconstruction of dose dependent reciprocal signal processing.

(A) Proposed schematic representation of the bi-modular signalling network, M1 = module 1; M2 = module 2. (B) The kinetics of phosphorylation of top layer kinases syk, lyn and bottom layer kinases ERK-1/2 and p38MAPK are shown from the model simulations with one trans-modular negative feedback loop. Ratio of phosphorylation (phosphorylated kinase/Total kinase) of the kinases at 5, 15, 30, 60 minutes is shown for the three doses L, M and H of CD40 signal strength, in the model.

https://doi.org/10.1371/journal.pone.0039898.g003

The proposed feedback loop is based on the observation (Figure 1 and 2) that all the kinases of M1 undergo inhibition with increasing signal dose. The feedback loop was considered functional on the top layer (syk) of M1, such that it inhibits syk which, in turn, can lead to inhibition of all the downstream kinases of M1. Strength of the feedback loop depended on the dose of the applied signal: at lower doses p38MAPK-PP is less due to low amplitude of lyn-P and hence, the negative feedback strength is less, but as p38MAPK-PP increases with increase in signal dose it gradually imparts stronger inhibition effect on the M1 kinases due to enhancement of strength of the negative feedback. In presence of the negative feedback loop equation 1 is modified as(3)

The negative feedback was considered as a hyperbolic modification where n1 is Hill coefficient and KI1 is the kinetic parameter associated with the negative feedback. The Hill coefficient in the negative feedback considers the effect of plausible intermediates whose overall effect is the observed feedback between M1 and M2 kinases. The bi-modular system with one negative feedback responded to signals of different strengths in a fashion similar to that observed in the experiments. Figure 3B shows the dynamics of phosphorylation of the top (syk and lyn) and bottom most (ERK-1/2 and p38MAPK) kinases at L, M and H, at time scales similar to experimental time scales. But few discrepancies between the predictions from the model and observations from the experiments such as ERK-1/2 phosphorylation at 5 minutes or lyn phosphorylation at 15 minutes (Figure 3B) suggest that the computational model is a minimal representation of the reciprocity in the CD40 signaling system.

Bidirectionality in the Reciprocal Inhibition of Kinases Suggests Presence of Two Transmodular Negative Feedback Loops

Although we largely reproduced the signal dose-dependent reciprocity in the CD40 signaling with the model with one negative feedback loop, the proposed architecture called for further experimental verification to tightly establish such a regulatory design. According to the systems design with M2→M1 feedback loop (Figure 3A), inhibition of the M1 kinases should not affect the signal flow in the M2 kinases. However, due to the M2→M1 negative feedback loop, perturbed phosphorylation amplitudes of the M2 kinases should affect the M1 module. Rephrased, the bi-modular architecture with one feedback loop (Figure 3A) suggests that perturbation of the phosphorylation of any kinase in M1 shouldn’t alter the phosphorylation of M2 kinases as there is no direct link/interaction from M1 to M2. We tested this hypothesis by inhibiting the kinases of both the modules.

In the experimental inhibition of these kinases, we chose to use only the intermediate signal dose (3 µg/ml), as both M1 and M2 kinases had intermediate phosphorylation amplitudes at this dose (Figure 1 and 2); at lower or higher doses, the signaling was skewed towards M1 or M2 module, respectively. Hence, perturbations carried out at intermediate doses would trigger observably most significant effect on kinases of both the modules, compared to perturbations at high or low dose. We observed that the experimental perturbation studies with kinase inhibitors only partially corroborate with the models prediction. Inhibition of lyn (Figure 4A), PI3-K (Figure 4B) and p38MAPK (Figure 4C) phosphorylation led to enhanced phosphorylation of the M1, which implies that origin of the proposed negative feedback loop (of Figure 3A) is the M2 module. However, the model failed to explain the effect of syk, Raf-1 and ERK-1/2 inhibition, as it was observed that inhibition of M1 kinases leads to enhancement of phosphorylation of the M2 kinases (Figure 4D–F). This immediately suggested the existence of a negative feedback from M1→M2. Subsequently, the model was updated with another functional negative feedback loop: from ERK-1/2 of M1 to phosphorylation of lyn in M2 (Figure 5A). Flux of phosphorylation of lyn in presence of the negative feedback is given as:(4)

thumbnail
Figure 4. Experimental perturbation studies by the inhibition of kinases.

(A–F) Mean of three in vivo inhibition studies on the peritoneal macrophages after treatment with anti- CD40 antibody of medium strength (3 µg/ml). Inhibitors of (A) lyn (PP1; 170 nM), (B) PI3-K (Ly294002; 15 µM), (C) p38MAPK (SB203580; 10 µg/ml), (D) Syk (Piceatannol (PC); 20 µM), (E) Raf-1 (Radicicol (Rad); 18 nM), (F)ERK-1/2 (PD098059; 100 µM). The representative western blots are in figure S7 and the densitometric analysis results are in dataset S1. In the figures, “p-Kinase” represents the phosphorylated kinase. Here “U-In” and “–In” means un-inhibited and inhibited, respectively.

https://doi.org/10.1371/journal.pone.0039898.g004

thumbnail
Figure 5. Kinetics of lyn and syk phosphorylation in ERK-1/2 and p38MAPK inhibition conditions.

(A) Schematic representation of the bi-modular reciprocal system with two negative feedback loops. Dynamics of relative phosphorylation (phosphorylated kinase/total kinase) for syk (B) and lyn (C) during inhibition of ERK-1/2 and p38MAPK phosphorylation using pharmaceutical inhibitor is shown. The representative western blots are provided as figure S8 densitometric analysis results are in dataset S3.

https://doi.org/10.1371/journal.pone.0039898.g005

The negative feedback was similar to the feedback loop from M2 to M1 and was considered as a hyperbolic modifier (n13 is Hill coefficient and KI13 is the kinetic parameter associated to the negative feedback). Simulation of the updated model captured the signal strength mediated reciprocal phosphorylation of the bi-modular kinases (figure S2).

To understand how the inhibitions affect the dynamics of the reciprocal system, we experimentally stimulated the system for different periods when either ERK-1/2 or p38MAPK phosphorylation was inhibited. To verify the presence of the proposed feedback loops, effect of inhibition of the MAPKs on the phosphorylation amplitude of earliest activated/membrane kinases syk and lyn was measured. The experiments show that inhibition of ERK-1/2 phosphorylation enhances lyn phosphorylation and subsequent suppression of syk phosphorylation. The reverse effect on syk and lyn phosphorylation was observed when p38MAPK phosphorylation was inhibited. Figure 5B shows the dynamics of lyn phosphorylation and Figure 5C compares the dynamics of syk phosphorylation for ERK-1/2 or p38MAPK inhibited conditions.

All the perturbation studies taken together, an inherent plasticity in the reciprocal system is discovered, owing to which the system can skew the direction of signal flow from M1 to M2 or vice versa. The plasticity emerges as a global property of the system due to its structural requirements for exhibiting the observed reciprocal behavior. To understand the significance of the systems plasticity, we used the updated model to make further predictions that could be compared to the experiments.

Kinase-specific siRNA Inhibitions Corroborate the Model Simulations Re-emphasizing the System’s Plasticity

Effect of experimental depletion of total concentration of three kinases Raf-1, PI3-K and p38MAPK is shown through siRNA inhibition studies. Figures 6A–C shows the change in phosphorylation of input (syk and lyn) and output (ERK-1/2 and p38MAPK) layers (for 15 minutes stimulation for signal strength “M”), when the system was subjected to siRNA mediated inhibitions. Depletion of PI3-K and Raf-1 concentration led to inhibition of phosphorylation of their respective upstream and downstream kinases and enhancement of phosphorylation of kinases of their corresponding reciprocal modules (Figure 6 A and B). Inhibition of p38MAPK concentration resulted in enhancement of syk and ERK-1/2 phosphorylation (compared to their unperturbed counterparts) and subsequent inhibition of lyn phosphorylation (Figure 6C). When the extent of experimentally obtained depletion of the kinase concentrations (Figure 6D) was employed in the model, a similar pattern of change in the phosphorylation of the kinases was obtained (Figure 6 E–G). For example, the extent of depletion of total concentration of p38MAPK was taken from Figure 6D and similar fraction of concentration was reduced from the total concentration of p38MAPK in the model. Figures 6E–G shows the phosphorylation ratios of the kinases for 15 minutes simulation at “M” dose, in both unperturbed and perturbed conditions.

thumbnail
Figure 6. Results of siRNA mediated experimental inhibition and respective in-silico reconstruction of concentration inhibition of kinases.

Effect of experimental depletion of Raf-1 (A), PI-3K (B) and p38MAPK (C) concentrations by siRNA inhibition in P388D1, a macrophage cell line is shown. The figures show the phosphorylation ratio (phosphorylated kinase/total kinase) of the kinases at uninhibited and siRNA mediated inhibition of the kinases (The representative western blots are provided as figure S9 and densitometric analysis results are in dataset S1). (D) The extent of concentration depletion for the kinases subjected to siRNA inhibition obtained through densitometric analysis. Dose response behaviour of the model for 15 minutes stimulation time when Raf-1 (E), PI3-K (F), p38MAPK (G) concentration was depleted in the same fraction as shown in (D). Here “U-In” and “si-” means un-inhibited and siRNA inhibited respectively.

https://doi.org/10.1371/journal.pone.0039898.g006

The Plasticity of the CD40 Signaling Holds the Key to Leishmania Elimination

In Leishmania-infected macrophages, ERK-1/2 phosphorylation is enhanced whereas p38MAPK phosphorylation is inhibited at any doses of anti-CD40 stimulation [5]. During host invasion, the parasite induces more of the pro-parasitic anti-inflammatory cytokine IL-10 as a function of the amount of phosphorylated ERK-1/2. Parallel to this, the parasite abrogates the production of the host protective pro-inflammatory cytokine IL-12 (as a function of phosphorylated p38MAPK) [5], [9]. Guided by the simulation results, we proposed that L. major plausibly targets the plasticity of the system to redirect the signal flow towards ERK-1/2 for ensuring its own survival. But, as our perturbation studies showed, flow of signal could be modulated to either direction due to systems plasticity. We examined whether we could experimentally target the plasticity to restore the ratio of IL-12 to IL-10.

We have shown (Figures 4, 6) that all the molecules in the reciprocal system could potentially alter the direction of signal flow due to the systems plasticity. Therefore, we performed global sensitivity analysis on the model to find out the most potent targets for the experimental perturbation studies. The sensitivity analysis on the model showed that both ERK-1/2 and p38MAPK phosphorylation amplitudes are maximally sensitive to perturbation in syk/lyn phosphorylation rates V1/V13 (Figure 7A). When the concentrations of the model kinases were perturbed in-silico, ERK-1/2-PP and p38MAPK-PP were found to be highly sensitive to variations in concentrations of syk or Raf-1 from the M1 module and lyn or PI3K from the M2 module (Figure 7B). We planned to experimentally investigate the effect of perturbations in the suitable target kinases’ concentration and phosphorylation rates. Effect of such perturbation on the phosphorylation profile of ERK-1/2-PP (p38MAPK-PP) was subsequently captured in the Leishmania infected macrophages. Sensitivity plots (Figure 7A and 7B) suggested lyn and syk as the optimal candidate molecules that could be subjected to both the types of perturbation studies and which can maximally affect the phosphorylation of ERK-1/2 and p38MAPK.

thumbnail
Figure 7. Sensitivity analyses of global perturbations in the phosphorylation rates and total concentrations of the model kinases.

(A) Sensitivity of the kinases of M1 and M2 module to the perturbation in the phosphorylation rates (A) and concentrations (B) of the kinases in the range 0.01–100 times their reference values. In the figures, V1, k3, (k5, k6), (k9, k10), V13, k15, (k17, 18,), (k21, k22) are syk, Raf-1, (MEK-1/2), (ERK-1/2), lyn, PI3-K, (MKK-3/6), (p38MAPK) phosphorylation rates, respectively.

https://doi.org/10.1371/journal.pone.0039898.g007

Experiments with lyn overexpression resulted in increase in p38MAPK phosphorylation and concurrent decrease in ERK-1/2 phosphorylation (Figure 8A). The opposing effect on ERK-1/2 and p38MAPK phosphorylation was observed when lyn concentration was depleted with siRNA mediated inhibition (figure S3). Lyn overexpression also resulted in enhanced production of the IL-12 and less IL-10 production, in both uninfected and Leishmania infected macrophages (Figure 8B). Inhibition of lyn phosphorylation led to reduced IL-12 but enhanced IL-10 expression; inhibition of syk phosphorylation led to reduced IL-10 but enhanced IL-12 expressions (Figure 8C). Results of densitometric analysis of the blots (Figure 8A, 8B and 8C) are shown in the figure S4. Figures S4A, S4B shows the densitometric results of Figure 8A, 8B, respectively, and figures S4C, S4D show the densitometry data of figure 8C.

thumbnail
Figure 8. Manipulation of the reciprocal balance alters cytokine production and parasite elimination.

(A) Lyn overexpression changed syk, p38MAPK and ERK-1/2 phosphorylation and expressions of IL-10 and IL-12 in macrophages. (B) Lyn overexpression led to inhibition of IL-10 and enhancement of IL-12 expressions in both uninfected (UIM) and infected macrophages (IM). (C) Lyn inhibition using PP1 resulted in enhanced IL-10 and reduced IL-12 production and alternately syk inhibition using Piceatannol (PC) enhanced IL-12 production but reduced IL-10 production; in uninfected and infected macrophages. (D) Syk inhibition and lyn overexpression regulated CD40- triggered elimination of L. major parasite from macrophages. Syk inhibition (E) or lentivirally expressed lyn (F) restores anti-leishmanial immunity in BALB/c mice, a susceptible host. PC and anti-CD40 antibody administration (F) or lentivirally expressed lyn with anti-CD40 antibody (G) reduced Leishmania major infection significantly (*, P<0.001; **, P<0.0001), as shown by footpad swelling and parasite load five weeks after the infection. The error bars represent Mean±SD. The in vitro experiments were performed thrice. The in vivo experiments were done twice using eight mice/group. Data from one representative experiment are shown.

https://doi.org/10.1371/journal.pone.0039898.g008

Lyn overexpression or syk inhibition resulted in reduced parasite load in macrophages (Figure 8D). Finally, in susceptible BALB/c mouse, syk inhibition (Figure 8E) or lyn overexpression (Figure 8F) reduced parasite load significantly (*, p<0.001; **, p<0.0001). Altogether, these data indicated that the CD40 in host cells maintains immune homeostasis by finely adjusting the direction and the strength of signal flow utilizing its plasticity, whereas the parasite, as it co-evolved with the host, plausibly designed a strategy to target the plasticity of the reciprocal CD40 signalling for their survival.

Discussion

We reported earlier that depending on the strength of its stimulation, CD40 signals reciprocally through p38MAPK and ERK-1/2 to control two counteracting effector functions [5], [9]. However, how such reciprocity is executed and regulated remained unknown. Here, we addressed this issue and hypothesized that the reciprocity emerges as a collective, co-ordinated activation/inhibition of kinases clustered in two modules that can be regulated by the receptors signal strength differentially. The data obtained from experiments and simulation indicate the following: firstly, CD40 signals are mediated by two modules of cascades of kinases; secondly, inhibition of one kinase in a module inhibits all kinases in the same module but activates kinases in the other module; thirdly, such arrangements of kinase cascades impart plasticity to the direction of the receptors signaling; and finally, based on the simulation-predicted target identification and by use of an experimental model of a parasitic infection, a putative therapeutic principle is demonstrated.

Usually the signaling pathways carry out their assigned task in a robust manner in a given direction, as only a few parameters are extremely sensitive to perturbations and greatly control the system output [13]. Here, we report that signaling plasticity endows the system with the ability to change the direction of the processed signal under the right perturbation condition. Our data suggest that it is this plasticity, which is targeted by a parasite, Leishmania major, to skew the signaling towards ERK-1/2 pathway to ensure its survival.

The signaling plasticity here refers to the systems ability to redirect the CD40 signaling between ERK-1/2 and p38MAPK pathways. Such a modus operandi, as we revealed, requires satisfying a minimum of two criteria: a defined modular assembly of kinases signaling to activate either ERK-1/2 or p38MAPK and second, a system of feedback loops as a provision to check the strength of signal in each of the pathways. In our experiments and simulation, variation of strengths of the input signal results in activation of kinases in two opposing manners: with increasing strengths of input signal, phosphorylations of some kinases increase while that of other kinases decreases, suggesting a modular assortment of kinases. Next, in response to pharmacological inhibitors and suppression of specific kinases by siRNA the kinases recapitulate the previously observed reciprocal phosphorylation behavior, suggesting again towards modular assembly of these kinases. These experiments also reveal that such modular assembly of the kinases helps redirecting CD40 signaling. Our simulation shows that a minimum of two feedback loops can reproduce such reciprocity among the kinases. Predominance of one of the two negative feedback loops redirects the signal through its own module, i.e., if M1 to M2 feedback loop is overriding the M2 to M1 loop, the signal will flow through ERK-1/2 pathway. Because each of these modules associates itself with a given effector function, M1 to IL-10 production and M2 to IL-12 production, this signaling plasticity is required for readjusting the ratio of IL-10 to IL-12 produced in a need based manner. Thus, a series of unique physiological or pathological states could be achieved depending on the extent of production of the functionally opposing cytokines.

Often the pathological states arise due to malfunction or loss of functionality of the associated signaling pathways. In our case, Leishmania skewed CD40 signaling towards ERK-1/2 resulting in high IL-10 levels that help the parasite to grow. We earlier showed that the Leishmania infection results in predominant ERK-1/2 phosphorylation and concurrent inhibition of p38MAPK phosphorylation at all CD40 signal strengths [5]. Our simulation studies imply that Leishmania infection leads to the activation of M1 to M2 feedback loop due to initial skewing towards ERK-1/2. Although it is not exactly known how that may happen, it is possible that Leishmania expresses a protein that activates ERK-1/2 directly or through MEK-1/2. The other possibility is that a Leishmania-derived protein such as EF-1α may activate host cell SHP-1 [13], which we have observed to de-phosphorylate lyn and regulate the threshold of CD40-induced p38MAPK activation (Khan T-H et al., unpublished results). However, based on the principle of the reciprocal system that we have worked out, we successfully formulated a strategy for parasite elimination from the susceptible host by targeted restoration of the host-protective ratio of IL-12 to IL-10. Our data demonstrate that the plasticity of the reciprocal network controlling ERK-1/2 and p38MAPK phosphorylation can be targeted for devising a novel immunotherapeutic strategy.

Materials and Methods

Animals, Cell Lines and Parasite

BALB/c mice from Jackson Laboratories (Bar Harbor, ME) were bred in our experimental facility. All animal experimentations were performed following an approved animal use protocol [IAEC (Institutional Animal Ethics Committee) approved protocol number EAF-110. This is under the central control of the “Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA)” permit no. 7/1999/CPCSEA-09/03/1999]. P388D1, a macrophage-like cell line [9], [14], [15], [16], was used for transfection studies. L. major strain (MHOM/Su73/5ASKH) was used for infection.

Macrophage Lysate Preparation for Western Blot

Thioglycolate-elicited macrophages were treated with an agonistic anti-CD40 antibody [5], [9], as indicated, followed by cell lysate preparation and Western blot for the kinases [5]. Antibodies were procured from Cell Signaling Technology (Beverly, MA) and Santa Cruz Biotech. (Santa Cruz, CA).

siRNA Transfection, Western Blot and PCR

In a 6-well tissue culture plate, 2×105 cells/well were cultured in antibiotic-free RPMI-1640 supplemented with 10% FCS. Following manufacturer’s protocol, the macrophage cell line P388D1 was transfected with the siRNA by using Santa Cruz transfection agent (Sc-29528) and transfection medium (Sc-36868). The cells were lysed after 24 hr, 36 hr and 48 hr to assess the maximum inhibition of the protein expression using Western blot. The time point showing the maximum inhibition was chosen for a particular kinase. The siRNA effect was tested on the CD40-induced phosphorylation of kinases by Western blot and expression of IL-10 and IL-12 by reverse transcription-PCR using the primers: GAPDH sense, 5′GAGCCAAACGGGTCATCATC3′, GAPDH anti-sense, 5′CCTGCTTCACCACCTTCTTG3′; IL-10 sense, 5′CTGCTATGCTGCCTGCTCTT3′, anti-sense IL-10, 5′CTCTTCACCTGCTCCACTGC3′; IL-12p40 sense, 5′CTGGCCAGTACACCTGCCAC3′ and IL-12p40 anti-sense, 5′ GTGCTTCCAACGCCAGTTCA3′. Each sample was first amplified for mouse GAPDH to ensure equal and good quality cDNA input.

Cloning Lyn Tyrosine Kinase Gene in LV-Neo

The tyrosine kinase encoding cDNA was released from pCALyn plasmid by digestion with BamHI/XbaI (polished) and cloned into the BamHI/BglII (polished) sites of pSG5 expression vector (Stratagene, Germany). An expression cassette consisting of the SV40 promoter, an intervening β-globin intron, the lyn coding region and polyA was released from pSG5-Lyn upon SalI digestion. The said cassette was further sub-cloned at SalI site of the lentiviral vector LV-Neo, derived by incorporation of neo gene in the previously described self-inactivating (SIN) vector construct, and virus particles containing the transgene were generated by multi-plasmid transfections in HEK-293 cells [17]. A total of 150 ml virus containing supernatant was generated, filtered through 0.45 µ filter, concentrated 100× by centrifugation at 50,000×g for 1 hr 15 min and re-suspension of viral pellet in 1.5 ml D-PBS and stored at −80°C.

Parasite Load

Peritoneal macrophages were infected with Leishmania promastigotes at a 1∶10 ratio for six hours [5]. The infected macrophages were washed, preloaded with inhibitors for 2 hr and treated with anti-CD40 antibody (3 µg/ml). The macrophages were fixed with chilled methanol and stained with Giemsa. The amastigotes were enumerated under a Nikon Eclipse E600 microscope.

Piceatannol and Lentivirally Over Expressed Lyn Treatment of Leishmania-infected BALB/c Mice

BALB/c mice were infected with 2×106 L. major [5]. After the first week of infection, mice were treated intra-peritoneally with three doses of 10 µg of piceatannol alone or with α-CD40 antibody (50 µg/ml) every alternate day. Mice were treated with a single dose of lentivirally over expressed lyn on 3rd day of infection subcutaneously, with or without intra-peritoneal α-CD40 (50 µg/ml) every alternate day. Weekly footpad measurements and the parasite load upon sacrifice were performed as described earlier [5]. T cells from lymph nodes of naïve and treated mice were isolated and stimulated with Leishmania crude soluble antigen for sixty hours. IL-10 and IL-12 content in the culture supernatants were assessed with Opt-EIA kits.

Statistical Analysis

The experiments were performed three times and the data from a representative experiment are shown. Dataset S1 shows the results densitometric analysis for the three sets of experiments with their respective mean, standard deviations and standard errors. The cultures in vitro were in triplicates and the mice per experimental or control group were eight. The significance of differences between the means was assessed by Student’s t-test.

Quantization of the Signaling Intermediate Activation

Western blot data was subjected to densitometry analysis and phosphorylation ratio (PR)  = (Phosphorylated kinase/Total kinase), for individual kinase was calculated for each of the applied signal doses L, M and H (Figure 1, Figure4, Figure 6). For the kinetic studies, PR for a time point (fro example 30 minutes) was compared from western blots for L, M and H (Figure 2). For the kinetics of inhibition (Figure 5B, C) relative PR at different time points were compared to the control. For the dose response studies (Figure 1), PR of the kinases maximally phosphorylated at L or H was scaled to 1, and further changes in the PR with the dose strength were calculated accordingly. For example ERK-1/2 and p38MAPK phosphorylation were maximum at L and H respectively. So PR for ERK-1/2 and p38MAPK were scaled to 1 at L and H respectively. For the inhibitor studies and siRNA studies (for 15 minutes stimulation) PR before inhibition for all kinases was scaled to 1 and the respective changes (increase or decrease) in the PR after subjecting to inhibitor were plotted subsequently. Hence syk PR in normal condition was scaled to 1 and change in syk PR after inhibition of lyn phosphorylation was calculate and compared in the plot accordingly (Figure 4A). Similarly, PR for lyn at normal condition was scaled to 1 and the respective change in lyn PR after Raf-1 siRNA was shown (Figure 6A). All the experiments were simultaneously performed thrice and mean of the three results were plotted. Dataset S1 shows the densitometric results from three different experiments, and the associated standard deviations. Representative western blots for dose response, inhibitor and siRNA studies could be found in the supporting figure sections.

Computational Model of Reciprocal Signalling

Signal flow through coupled phosphorylation and dephosphorylation in the kinase network were constructed and simulated following standard approaches [18][20]. The model was constructed using COpasi [21] and all the plots were generated using MATLAB sensitivity analysis toolbox SBML-SAT [22]. Details of the model equations are given in methods sections below. Elaboration on model equations can be found in the supporting material section. The values of kinetic parameters and concentrations of kinases used for simulations can also be found under the headings Table 1 and Table 2 in Text S1, respectively.

The method used for sensitivity analysis was partial rank correlation coefficient analysis (PRCCA), a rank transformed linear regression analysis that is routinely used for analysis of systems with a nonlinear and monotonic relationship between the system inputs and outputs [23]. In our study, each of the model parameters/concentrations subjected to sensitivity analysis was varied in the range of 0.01–100 of their current value. N equidistant sampling points for each parameter was assigned (N = 5000 in the range 0.01–100 for each parameter), using an M dimensional (M = number of parameters subjected to variation) Latin hypercube, complete method of which is implemented in the software SBML-SAT and could be found elsewhere [22].

Equations Capturing the Reciprocal Flow of Bi-modular CD40 Signalling

Equations given below captured the reciprocal regulation in the CD40 signaling. Differential equations in the right hand side of the equations capture the time evolution of the system. In the left hand side to the differential equations is the flux equations constructed assuming that a steady state was reached in the enzyme substrate complex during signal propagation.

Thus for the reaction E + S = [ES] → P + E, the flux equations were constructed for the condition when [ES] = constant. Here, E = Kinase, S = substrate, P = phosphorylated kinases.

Activation of lyn, syk, Raf-1 and PI3-K was considered to be activated upon single phosphorylation following the previous guidelines [18], [19], [24]. It could be noted that lyn gets phosphorylated in two functionally opposing tyrosine residues, an autophosphorylation activates lyn upon which lyn subsequently activates its downstream signalling components, whereas, an inhibitory phosphorylation restricts it from passing the receptor mediated signalling information, as observed in the B cells [25]. Subsequently phosphatase such as SHP-1/CD45 dephosphorylates both the tyrosine residues [24], [25]. Following previous guidelines it was however assumed that a single phosphorylation step activates lyn and a single dephosphorylation step deactivates lyn [24]. Such assumptions allow us to capture the information processing as a function of two simple steps: activation (via phosphorylation) and deactivation (dephosphorylation), without compromising the fundamental modus-operandi of phosphorylation mediated information transfer.

Derivation of the flux equations for syk and lyn phosphorylation was empirically driven. Exact mechanistic steps involved in CD40 triggered phosphorylation of syk and lyn are currently unclear, but it is known from our earlier studies that CD40 activates syk and lyn in different signalosome complexes in the cell membrane [9]. CD40 itself doesn’t have enzymatic property and it necessarily requires the signalosome complexes to trigger phosphorylation of its downstream kinases [9]. In our model we assumed the two signalosome complexes as E1 and E2. For the simplicity of model building, we considered CD40 association with E1 as an active signalosome that phosphorylates syk and CD40 complex with E2 as an active signalosome that phosphorylates lyn. Thus CD40 acts as an essential activator in derivation of the flux equations [26], which is required for activating two separate signalosome complexes E1 and E2.

The biochemical steps that were assumed to capture syk phosphorylation in presence of its essential activator CD40 bound to the signalosome complex E1 is given as follows

Under the steady state assumptions of the enzyme-substrate complexes,

Thus the flux equation of syk phosphorylation is given as

In the equation above or as in the equation 1 above, v1 is the flux of syk phosphorylation and V1 is the Vmax associated to signalosome complex E1. The ki, i = 1–5 are the elementary reaction rates for the above reaction schema and in the equations above, and . In the same lines equation 2 could be derived for lyn phosphorylation. We considered that the negative feedback loops from ERK-1/2-PP to syk phosphorylation steps or p38MAPK to lyn phosphorylation steps. These feedback loops inhibited the association of CD40 to E1 or association of CD40 to E2. Thus the negative feedback loops were assumed to be functional at the signalosome complex formation steps. Under such assumption equation 3 and 4 could be derived.

Activation of MEK-1/2, MKK-1/2, ERK-1/2 and p38MAPK requires double phosphorylation [18]. Derivation of flux equations for single phosphorylation condition and double phosphorylation condition are provided in text S1 on model building.

The equations below show the dynamics of phosphorylation and dephosphorylation of all of the model kinases. The mass conservation equations for each kinase were given below the differential equations of the same. For example differential equation capturing Raf-1 phosphorylation is followed by the mass conservation equation for Raf-1.

Since the absolute concentration of each kinase was assumed constant during the simulation time mass conservation equation could be used to determine the time evolution of the dependent variable. So, any phosphorylated kinase K1 at time t: K1_P (t), and its total concentration: K1T is related to the amount of unphosphorylated kinase: K1-1(t) at any time t as K1-1(t) = K1T - K1_P (t).

Model Assumptions

Flux equations were constructed assuming steady state in the enzyme substrate complexes during the signal propagation [18], [26], [27]. The model parameter and concentration values were assumed to be in the range reported in various literatures (text S1 for details). The negative feedback loops were modeled as hyperbolic modifiers [27], as exact biochemical details among the kinases of the two modules which results in the observed negative feedback effects are currently unknown. Thus we constructed the feedback loops based on the empirically data from western bolts for various experimental perturbation conditions.

Supporting Information

Figure S1.

Phosphorylation profile of model kinases for different doses of CD40 stimuli, without any feedback loop. (A) Steady sate ERK-1/2-PP and p38MAPK phosphorylation profiles as a function of CD40 stimuli. (B) Steady state ERK-1/2-PP and p38MAPK phosphorylation profiles plotted against the steady state phosphorylation profile of syk-P and lyn-P, simulated for different strengths of CD40 stimuli. (C) Steady state phosphorylation profiles of syk-P and lyn-P as functions of CD40 signal strengths

https://doi.org/10.1371/journal.pone.0039898.s001

(BMP)

Figure S2.

The kinetics of phosphorylation of top layer kinases syk, lyn and bottom layer kinases ERK-1/2 and p38MAPK are shown from the model simulations with two trans-modular negative feedback loops. Ratio of phosphorylation (phosphorylated kinase/Total kinase) of the kinases at 5, 15, 30, 60 minutes is shown for the three doses L, M and H of CD40 signal strength.

https://doi.org/10.1371/journal.pone.0039898.s002

(BMP)

Figure S3.

Effect of experimental depletion of lyn concentrations by siRNA inhibition in P388D1, a macrophage cell line is shown. (A) The western blots show the phosphorylation ratio (phosphorylated kinase/total kinase) of the kinases at uninhibited and siRNA mediated inhibition of the kinases. In the experiments, BALB/c-derived thioglycolate-elicited peritoneal macrophages were treated with the anti-CD40 antibody (3 µg/ml). (B) Densitometric analysis of the western blot results are shown to compare the relative phosphorylation of syk, lyn, ERK-1/2 and p38MAPK in unperturbed condition (CD40 stimuli; C1) and for the lyn siRNA condition (CD40 stimuli + Lyn siRNA; C2).

https://doi.org/10.1371/journal.pone.0039898.s003

(BMP)

Figure S4.

Densitometric analysis of kinases overexpression and inhibition and cytokines production in uninfected and Leishmania infected macrophages. (A) Lyn overexpression changed syk, p38MAPK and ERK-1/2 phosphorylation in macrophages. (B) Lyn overexpression led to inhibition of IL-10 and enhancement of IL-12 productions in both uninfected (UIM) and infected macrophages (IM). (C) Syk inhibition using Piceatannol (PC) enhanced IL-12 production but reduced IL-10 production; in uninfected and infected macrophages. (D) Lyn inhibition using PP1 resulted in enhanced IL-10 and reduced IL-12 production.

https://doi.org/10.1371/journal.pone.0039898.s004

(BMP)

Figure S5.

CD40 signaling in macrophages phosphorylates different kinases reciprocally clustering them into two modules. Thioglycolate-elicited BALB/c-derived peritoneal macrophages, was stimulated with the indicated doses of agonistic anti-CD40 antibody (clone 3/23) for 15 minutes, followed by the indicated Western blots with the cell lysates for eight different phosphorylated and total kinases. Based on their dose-response behaviour they are categorized in to the two modules M1 and M2. The experiments were repeated thrice and one representative dataset are shown below. Dataset S1 shows the densitometric analysis values for the three studies performed.

https://doi.org/10.1371/journal.pone.0039898.s005

(TIF)

Figure S6.

The kinetics of phosphorylation of top layer kinases syk, lyn and bottom layer kinases ERK-1/2 and p38MAPK. Figures show that reciprocity is a dynamically conserved property during signal processing by the CD40 receptor. Dataset S2 shows the densitometric analysis values for the three studies performed.

https://doi.org/10.1371/journal.pone.0039898.s006

(TIF)

Figure S7.

Pharmacological inhibitor-mediated inhibition of the kinases recapitulates the role of reciprocity in skewing CD40 signaling. (A). CD40-induced phosphorylation profiles of the kinases in peritoneal macrophages after treatment with anti-CD40 antibody (3 µg/ml) and inhibitors of lyn (PP1), Syk (Piceatannol (PC)), PI3-K (Ly294002), Raf-1 (Radicicol (Rad)), ERK-1/2 (PD098059) or p38MAPK (SB203580) were assessed. Densitometry units from the western blots are summarized showing the reciprocal relationship between the kinases in two modules. The figures show the extent of inhibition achieved in one representative dataset. Dataset S1 shows the densitometric analysis values for the three studies performed.

https://doi.org/10.1371/journal.pone.0039898.s007

(TIF)

Figure S8.

Kinetics of syk and lyn phosphorylation during ERK-1/2 and p38MAPK inhibition. The blots clearly show that due to its inherent plasticity the reciprocal system enhances syk phosphorylation and inhibits lyn phosphorylation during p38MAPK inhibition, whereas, during ERK-1/2 inhibition the reverse effect was observed. Inhibitor doses used for the study were SB = 5 µg/ml and PD = 50 µg. SD–S3 shows the densitometric analysis values for the three studies performed.

https://doi.org/10.1371/journal.pone.0039898.s008

(TIF)

Figure S9.

siRNA-mediated inhibition of expression of the kinases recapitulates plasticity of the reciprocal system. Inhibition of kinase expression by siRNA reemphasizes the reciprocity in activation of kinases in the two modules. Inhibition of (A) Raf-1, (B) PI-3K, (C) p38MAPK by siRNA regulates the CD40-induced phosphorylation of the indicated kinases reciprocally in two modules in P388D1, a macrophage cell line. (D) Expression of the respective kinases subjected to siRNA inhibition. In the experiments, BALB/c-derived thioglycolate-elicited peritoneal macrophages were treated with the anti-CD40 antibody (3 µg/ml). (E) The extent of inhibition achieved for the three kinases during the siRNA studies is shown. Dataset S1 shows the densitometric analysis values for the three studies performed. The studies were performed thrice and the figures below shows the extent of depletion achieved for one representative dataset.

https://doi.org/10.1371/journal.pone.0039898.s009

(TIF)

Text S1.

Model building, parameters and concentrations of kinases used for the simulations of the reciprocal system.

https://doi.org/10.1371/journal.pone.0039898.s010

(DOC)

Dataset S1.

Results of Densitometric analysis is shown for 1] Dose-response studies 2] Pharmaceutical inhibitor mediated studies for 15 minutes stimulation 3] siRNA mediated kinase inhibition studies 15 minutes stimulation. The excel sheet shows the densitometric values of the “phosphorylated” and “total kinase” obtained from the western blots and the respective ratios for dose-response/inhibitor/siRNA treatment. Subsequently, mean of three studies is shown in sheet no.2. Results from sheet no. 2 are plotted. For the pharmaceutical inhibitors studies, the dose of inhibitor for which best results were observed was plotted, as highlighted with red colour. The table can be found as a separate excel datasheet attached with this manuscript.

https://doi.org/10.1371/journal.pone.0039898.s011

(XLS)

Dataset S2.

Results of Densitometric analysis for kinetics of phosphorylation at L, M and H of the applied strengths of CD40 stimulation are shown with their mean of three experiments and the corresponding standard deviations.

https://doi.org/10.1371/journal.pone.0039898.s012

(XLS)

Dataset S3.

Results of Densitometric analysis for kinetics of phosphorylation of syk and lyn when either ERK-1/2 or p38MAPK is inhibited. The inhibitor doses used were SB = 5 µg/ml, PD = 50 µM. Experiments carried out at strength M of CD40 stimulation are shown with their mean of three experiments, and their corresponding standard deviations.

https://doi.org/10.1371/journal.pone.0039898.s013

(XLS)

Author Contributions

Performed the experiments: AS RS SP NS VK MM AGC. Analyzed the data: SR SS IG RM BS. Wrote the paper: SR SS IG RM BS. Modeling: US. For experiments: AS RS SP NS VK MM AGC. Designed experiments modeling and prepared manuscript: SR SS IG RM BS.

References

  1. 1. Egen JG, Allison JP (2002) Cytotoxic T lymphocyte antigen-4 accumulation in the immunological synapse is regulated by TCR signal strength. Immunity 16: 23–35.
  2. 2. Gett AV, Sallusto F, Lanzavecchia A, Geginat J (2003) T cell fitness determined by signal strength. Nat Immunol 4: 355–360.
  3. 3. Grewal IS, Flavell RA (1998) CD40 and CD154 in cell-mediated immunity. Annu Rev Immunol 16: 111–135.
  4. 4. Eliopoulos AG, Davies C, Knox PG, Gallagher NJ, Afford SC, et al. (2000) CD40 induces apoptosis in carcinoma cells through activation of cytotoxic ligands of the tumor necrosis factor superfamily. Mol Cell Biol 20: 5503–5515.
  5. 5. Mathur RK, Awasthi A, Wadhone P, Ramanamurthy B, Saha B (2004) Reciprocal CD40 signals through p38MAPK and ERK-1/2 induce counteracting immune responses. Nat Med 10: 540–544.
  6. 6. Widemann C, Gibson S, Jarpe BM, Lohson LG (1999) Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev 79: 143–180.
  7. 7. Davis JR (1993) The Mitogen-activated Protein Kinase Signal Transduction Pathway 268: 14553–14556.
  8. 8. Marshall CJ (1994) MAP kinase kinase kinase, MAP kinase kinase and MAP kinase. Curr Opin Genet Dev 4: 82–89.
  9. 9. Rub A, Dey R, Jadhav M, Kamat R, Chakkaramakkil S, et al. (2009) Cholesterol depletion associated with Leishmania major infection alters macrophage CD40 signalosome composition and effector function. Nat. Immunol. 10: 273–280.
  10. 10. Foey AD, Feldmann M, Brennan FM (2001) CD40 ligation induces macrophage IL-10 and TNF-α production: differential use of PI3-K AND p42/44 MAPK-pathways. Cytokine 16: 131–142.
  11. 11. Purkerson JM, Parker DC (1998) Differential coupling of membrane Ig and CD40 to the extracellularly regulated kinase signaling pathway. J Immunol 160: 2121–2129.
  12. 12. Goldstein B, Faeder JR, Hlavacek WS, Blinov ML, Redondo A, et al. (2002) Modeling the early signaling events mediated by FcεRI. Molecular Immunology 1137: 17.
  13. 13. Nandan D, Yi T, Lopez M, Lai C, Reiner NE (2002) Leishmania EF-1alpha activates the Src homology 2 domain containing tyrosine phosphatase SHP-1 leading to macrophage deactivation. J Biol Chem 277: 50190–50197.
  14. 14. Gutenkunst RN, Waterfall JJ, Casey FP, Brown KS, Myers CR, et al. (2007) Universally sloppy parameter sensitivities in systems biology models. PLoS Comput Biol 3: 1871–1878.
  15. 15. Sudan R, Srivastava N, Pandey SP, Majumdar S, Saha B (2012) Reciprocal regulation of protein kinase C isoforms results in differential cellular responsiveness. J Immunol 188: 2328–2337.
  16. 16. Srivastava N, Sudan R, Saha B (2011) CD40-Modulated Dual-Specificity Phosphatases MAPK Phosphatase (MKP)-1 and MKP-3 Reciprocally Regulate Leishmania major Infection. J Immunol 186: 5863–5872.
  17. 17. Santhosh C V, Tamhane MC, Kamat RH, Patel VV, Mukhopadhyaya R (2008) A lentiviral vector with novel multiple cloning sites: stable transgene expression in vitro and in vivo. Biochem Biophys Res Commun 371: 546–550.
  18. 18. Hatakeyama M, Kimura S, Naka T, Kawasaki T, Yumoto N, et al. (2003) A computational model on the modulation of mitogen-activated protein kinase (MAPK) and Akt pathways in heregulin-induced ErbB signalling. Biochem J. 373: 451–463.
  19. 19. Shankaran H, Ippolito DL, Chrisler WB, Resat H, Bollinger N, et al. (2009) Rapid and sustained nuclear-cytoplasmic ERK oscillations induced by epidermal growth factor. Mol Syst Biol 5: 332.
  20. 20. Shin SY, Rath O, Choo SM, Fee F, McFerran B, et al. (2009) Positive- and negative-feedback regulations coordinate the dynamic behavior of the Ras-Raf-MEK-ERK signal transduction pathway. J Cell Sci 122: 425–35.
  21. 21. Hoops S, Sahle S, Gauges R, Lee C, Pahle J, et al. (2006) COPASI–a COmplex PAthway SImulator. Bioinformatics 22: 3067–3074.
  22. 22. Zi Z, Zheng Y, Rundell AE, Klipp E (2008) SBML-SAT: a systems biology markup language (SBML) based sensitivity analysis tool. BMC Bioinformatics 9: 342.
  23. 23. Zhang Y, Rundell A (2006) Comparative study of parameter sensitivity analyses of the TCR activated Erk-MAPK signalling pathway. Syst Biol (Stevenage) 153: 201–211.
  24. 24. Chaudhri VK, Kumar D, Misra M, Dua R, Rao KV (2010) Integration of a phosphatase cascade with the mitogen-activated protein kinase pathway provides for a novel signal processing function. J Biol Chem 285: 1296–310.
  25. 25. Yanagi S, Sugawara H, Kurosaki M, Sabe H, Yamamura H, et al. (1996) CD45 modulates phosphorylation of both autophosphorylation and negative regulatory tyrosines of Lyn in B cells. J Biol Chem 271: 30487–30492.
  26. 26. Segel HI (1993) Enzyme kinetics: behavior and analysis of rapid equilibrium and steady state: Willy Press.
  27. 27. Kholodenko BN (2000) Negative feedback and ultrasensitivity can bring about oscillations in the mitogen-activated protein kinase cascades. Eur J Biochem 267: 1583–88.