Figures
Abstract
The genus Neisseria contains at least eight commensal and two pathogenic species. According to the Neisseria phylogenetic tree, commensals are basal to the pathogens. N. elongata, which is at the opposite end of the tree from N. gonorrhoeae, has been observed to be fimbriated, and these fimbriae are correlated with genetic competence in this organism. We tested the hypothesis that the fimbriae of N. elongata are Type IV pili (Tfp), and that Tfp functions in genetic competence. We provide evidence that the N. elongata fimbriae are indeed Tfp. Tfp, as well as the DNA Uptake Sequence (DUS), greatly enhance N. elongata DNA transformation. Tfp allows N. elongata to make intimate contact with N. gonorrhoeae and to mediate the transfer of antibiotic resistance markers between these two species. We conclude that Tfp functional for genetic competence is a trait of a commensal member of the Neisseria genus. Our findings provide a mechanism for the horizontal gene transfer that has been observed among Neisseria species.
Citation: Higashi DL, Biais N, Weyand NJ, Agellon A, Sisko JL, Brown LM, et al. (2011) N. elongata Produces Type IV Pili That Mediate Interspecies Gene Transfer with N. gonorrhoeae. PLoS ONE 6(6): e21373. https://doi.org/10.1371/journal.pone.0021373
Editor: Ben Adler, Monash University, Australia
Received: March 31, 2011; Accepted: May 26, 2011; Published: June 22, 2011
Copyright: © 2011 Higashi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported in part by NIH grant AI068033 and funds from the BIO5 Institute and the College of Medicine, University of Arizona awarded to M. So. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Acquisition of novel genetic traits can increase fitness of an organism and augment its chances of survival in changing environments. Transfer of genetic material between bacteria occurs mainly through conjugation, transduction and transformation (uptake of exogenous DNA) [1], [2], [3], [4], [5]. Interspecies gene transfer is less well understood. Bacteria belonging to the genus Neisseria provide a good opportunity to examine the role of the Type IV pilus in interspecies horizontal gene transfer.
The Type IV pilus (Tfp) mediates DNA uptake and transformation in many bacteria, including the pathogenic Neisseria, N. gonorrhoeae and N. meningitidis [6], [7], [8]. N. gonorrhoeae Tfp are peritrichous fibers measuring ∼6 nm in diameter and several microns in length. These fibers are composed primarily of pilin subunits arranged in a structured helix [9], [10]. Among the approximately 20 genes involved in the biogenesis of Tfp, four are absolutely essential for its assembly: pilE, encoding pilin; pilD, encoding the prepilin peptidase; pilF, encoding an ATPase that assembles processed pilins into the Tfp fiber; and pilQ, encoding subunits of the outermembrane pore through which the growing fiber extends [11].
Over eight species of commensal Neisseria commonly colonize human mucosal epithelia [12], [13], [14]. Despite their prevalence, little is known about the biology of these organisms. A recent genomics study revealed that commensals are basal members of the Neisseria genus; the two pathogens, N. gonorrhoeae and N. meningitidis, evolved from a common ancestor of the commensals, with N. lactamica being their closest relative [15]. All Neisseria species harbor genes for Tfp biogenesis [15], [16] as well as multiple copies of the 10 base pair DNA Uptake Sequence (DUS; GCCGTCTGAA). Both have been shown to function in genetic competence in the pathogenic Neisseria [17], [18]. A number of commensals are naturally competent for genetic transformation [19], [20]. N. elongata, a basal member of the Neisseria genus, is observed to be fimbriated, and the fimbriae are correlated with genetic competence [19], [21].
We tested the hypothesis that commensal Neisseria express Tfp, and that the structure functions in genetic competence. We focused our studies on N. elongata as it represents a basal member of the human Neisseria genus [15]. We report that N. elongata produces Tfp. Genetic competence in N. elongata is greatly enhanced by Tfp and the presence of DUS. Tfp also allows N. elongata to make intimate contact with N. gonorrhoeae and mediates the bi-directional transfer of antibiotic resistance markers between them. Our findings provide one mechanism for the widespread horizontal gene transfer that has been observed among Neisseria species [15], [19], [22].
Results
N. elongata cells are competent for DNA transformation to rifampicin resistance
N. elongata can be genetically transformed to streptomycin resistance [19], [21]. We first determined the frequency at which N. elongata subspecies glycolytica acquires rifampicin resistance when incubated with DNA from a variant of the same strain that had spontaneously developed resistance to rifampicin (Rif; N. elongata rifR). When incubated with rifR DNA, N. elongata acquired rifampicin resistance at a >3,400-fold higher frequency than when incubated with medium or with DNA in the presence of DNaseI (Table 1). Similar results were obtained with N. elongata subspecies elongata (data not shown). This study confirms that our strain of N. elongata is genetically transformable and establishes the frequency of rifR transformation.
Key Tfp biogenesis genes are transcribed in N. elongata
Tfp biogenesis and functionality are dependent on the expression of multiple genes. The above result led us to determine whether Tfp biogenesis genes in N. elongata are transcriptionally active. We focused on four genes essential for Tfp assembly: pilE, pilD, pilF, and pilQ [11]. To detect their transcripts, N. elongata RNA was reverse transcribed into cDNA and the products were probed by PCR using primers specific for each gene. Amplicons of the sizes expected for all four genes were obtained (Figure 1). Amplicons could not be generated when reverse transcriptase was omitted from the cDNA reactions. Sequencing of these amplicons confirmed the identity of these genes (data not shown). Thus, pilE, pilD, pilF, and pilQ are transcribed in N. elongata.
Migration of PCR amplicons generated from N. elongata cDNA using primers specific for pilE, pilD, pilF, and pilQ. (+) and (−) indicate the presence or absence of reverse transcriptase (RT) in the cDNA reaction.
N. elongata produces Tfp
Fimbriae have been observed in N. elongata cells [21]. We examined N. elongata for evidence of Tfp by Scanning Electron Microscopy (SEM) (Figure 2A). N. elongata cells are slender rods [19] that typically measure 0.5 µm by ∼2 microns. Tfp-like fibers were present on N. elongata, though they were not as abundant as Tfp on N. gonorrhoeae [23] (see also Figure 3). Consistent with a previous report [21], these Tfp-like fibers appear to originate from one end of the long axis of the cell (Figure 2B and 2C). Quantitative experimentation will be required to determine the exact location of the N. elongata fibers. It should be noted that Tfp fibers in other gram negative rods are polar [5], [24], [25]; the polar nature of these fibers may be linked to the motility and detachment behavior of these organisms [26].
Scanning Electron Microscopy (SEM) of Wt N. elongata, (A), (B) and (C) and N. elongataΔpilE (D). (C) is an enlarged image of the upper left hand section in (B). Arrowheads indicate Tfp-like fibers. Scale bars: 2 µm. (E) SDS PAGE of fibers isolated from wt N. elongata and N. elongataΔpilE using a protocol for isolating N. gonorrhoeae Tfp. Arrow indicates the 17 kDa protein. (F) Top panel: Amino acid sequence deduced from the N. elongata pilE gene. Bottom panel: Sequences of peptides from the N. elongata 17 kD protein determined by tryptic digestion and MALDI-TOF mass spectroscopy. Deduced amino acid sequences that match the peptide sequences are in red.
SEM of N. elongata (rods) and N. gonorrhoeae (cocci) co-cultured 3 hours on (A) glass coverslips, and (B) human epithelial cells. (C) A higher magnification image of a region in (B). Scale bars: 5 µm.
Fibers from N. elongata were isolated using a protocol developed for obtaining N. gonorrhoeae Tfp [27]. The predominant protein in these preparations had an electrophoretic mass of ∼17 kD (Figure 2E), the approximate size of N. gonorrhoeae pilin. Data from tryptic digestion and MALDI/TOF spectroscopy of the 17 kD protein agreed with the theoretical mass and deduced amino acid sequence of N. elongata pilE [15] (Figure 2F). PilE is therefore the major constituent of N. elongata fibers.
The N. elongata pilE null mutant does not produce Tfp and is significantly less transformable
To obtain conclusive proof that N. elongata fibers are Tfp, we determined whether a pilE null mutant produced fibers. The pilE gene in N. elongata was replaced with a kanamycin (Km) resistance cassette (see Materials and Methods). This mutant, N. elongataΔpilE::Km, grew at the same rate as the wt parent strain (data not shown). Mutant cells were devoid of fibers, as judged by SEM (Figure 2D). Neither fibers nor the 17 kD protein could be purified from N. elongataΔpilE::Km cells (Figure 2E). Taken together, these findings demonstrate that the N. elongata fibers are Tfp.
To test the DNA transformation function of N. elongata Tfp, we incubated wt and N. elongataΔpilE::Km with DNA purified from the rifR strain. N. elongataΔpilE::Km transformed to rifampicin resistance at a ∼340-fold lower frequency than the wt parent (Table 1). The low frequency of DNA transformation of N. elongataΔpilE::Km is consistent with that observed for non-piliated N. gonorrhoeae [28]. Tfp therefore plays an important role in N. elongata DNA transformation.
N. elongata DNA transformation is enhanced by a DNA uptake sequence
DNA uptake and transformation by pathogenic Neisseria is significantly enhanced by the canonical DNA Uptake Sequence (DUS; GCCGTCTGAA) [17], [18], [29]. We determined whether transformation of N. elongata is also enhanced by this DUS (Table 2). Cells incubated with a DNA fragment encoding a segment of rpoB from N. elongata rifR and DUS (rpoBrifR + DUS) transformed to rifampicin resistance at an ∼9000-fold higher frequency than cells incubated with medium or with the amplicon in the presence of DNaseI.
DUS1, a variant DUS with a thymine at the second position (GtCGTCTGAA), also functions in DNA transformation of the pathogenic Neisseria, but at a lower frequency than the canonical sequence [30]. N. elongata was transformed by the rpoBrifR + DUS1 amplicon, but at an 8-fold lower frequency than the rpoBrifR + DUS amplicon (Table 2).
The rpoBrifR amplicon alone also transformed N. elongata to rifampicin resistance, but at a low frequency compared to the rpoBrifR + DUS amplicon (Table 2). One possible explanation for this event is that the amplicon entered cells through a DUS- and DUS1-independent mechanism. DUS-independent transformation is known to occur at low levels in N. gonorrhoeae [31], [32]. Regardless, our results demonstrate that transformation of N. elongata is most efficient when the DNA contains the canonical DUS. At least one DUS variant, DUS1, also functions in transformation at a low frequency.
N. elongata physically interact with N. gonorrhoeae on synthetic surfaces and epithelial cells
Commensal and pathogenic Neisseria inhabit similar niches on mucosal epithelia, raising the possibility of interspecies interactions and transfer of genetic material. We first determined whether N. elongata and N. gonorrhoeae could physically interact with each other. After 3 hours of co-culture, N. elongata and N. gonorrhoeae formed microcolonies that were largely monospecific (Figure 3A). However, many N. elongata and N. gonorrhoeae microcolonies were observed abutted to each other. Moreover, a number of N. elongata cells were observed within N. gonorrhoeae microcolonies and vice versa. N. gonorrhoeae Tfp, which formed a network over microcolonies, also attached to neighboring N. elongata cells (Figure 3A). This intimate association of commensal and pathogen also occurred in mixed infections of human epithelial cells (Figure 3B and 3C). N. elongata and N. gonorrhoeae microcolonies frequently interacted with each other on glass surfaces and epithelial cells: 80% of randomly selected N. elongata microcolonies were physically associated with a N. gonorrhoeae microcolony on glass and 81% on cells (±3% and ±5%, respectively; n ≥50 for each type of surface; see Methods). Very few N. elongata and N. gonorrhoeaeΔpilE mutants adhered to glass surfaces or epithelial cells when cultured alone or together. The few ΔpilE mutants of each species that adhered did not aggregate into microcolonies and did not interact with each other when co-cultured (data not shown). Together, these data indicate that Tfp promotes physical interactions between N. elongata and N. gonorrhoeae.
N. elongata and N. gonorrhoeae engage in bi-directional horizontal gene transfer
The above findings led us to determine whether N. gonorrhoeae could transfer genetic material to N. elongata. N. gonorrhoeae rifR and N. elongata sensitive to rifampicin (rifS) cells were co-cultured, and transfer of rifR from pathogen to commensal was measured (Table 3). N. elongata acquired rifR at a >21-fold higher frequency when co-cultured with N. gonorrhoeae rifR than when co-cultured with N. gonorrhoeae rifS. Acquisition of resistance is enhanced by Tfp, as N. elongataΔpilE::Km acquired rifR from N. gonorrhoeae rifR at a ∼38-fold lower frequency than the wt N. elongata parent.
Finally, we determined whether commensal could transfer genetic material to pathogen, using the same approach. N. gonorrhoeae acquired rifR at a >15-fold higher frequency when co-cultured with N. elongata rifR than when co-cultured with N. elongata rifS (Table 3). As expected, transfer of rifR is enhanced by Tfp, as N. gonorrhoeaeΔpilE acquired rifR from N. elongata rifR at a 47-fold lower frequency than the wt N. gonorrhoeae parent. The lower transformation frequencies observed in co-culture assays compared to assays with purified DNA have been reported for N. gonorrhoeae [33]. These results demonstrate that N. elongata and N. gonorrhoeae can engage in bi-directional transfer of genetic information during co-culture.
Discussion
According to the Neisseria phylogenetic tree, commensals species are basal to the two pathogenic species, N. gonorrhoeae and N. meningitidis [15]. We presented evidence that the most basal Neisseria species, N. elongata, expresses Tfp that is functional for genetic transformation. These results, together with the observation that all commensal species harbor Tfp biogenesis genes and DUS elements [15], suggest that Tfp is an ancestral trait of the Neisseria genus, and that this trait has been inherited by the two pathogens as they evolved from a common ancestor.
N. elongata is efficiently transformed by DNA containing the canonical DUS, GCCGTCTGAA. It is also transformed at a low frequency by DNA containing the DUS1 variant GtCGTCTGAA. This result is consistent with the lower transformation efficiency of DUS1 for pathogenic Neisseria [30]. The DUS is the most highly repeated sequence in Neisseria genomes, occurring >2,000 times in most species [15]. N. elongata has 2,142 copies of the DUS and 117 copies of DUS1 [15]. Interestingly, N. sicca and N. mucosa, which form a distinct clade in the Neisseria phylogenetic tree, have >3,400 copies of DUS1 but many fewer copies of DUS. Whether the relative abundance of these two DNA uptake sequences may influence genetic exchange between the N. sicca/N. mucosa clade and other Neisseria species remains to be determined.
Commensal Neisseria are part of the normal flora of mucosal epithelia. Pathogenic Neisseria can also persist asymptomatically for periods of time in similar niches [12], [34], [35]. Indeed, N. elongata and N. gonorrhoeae are known to inhabit the same mucosal environments [35], [36], [37], [38], [39]. This situation creates opportunities for interspecies interactions. Within 3 hours of co-culture, planktonic N. elongata and N. gonorrhoeae cells form largely monospecific microcolonies that physically contact microcolonies of the other species; a few N. elongata cells are observed within N. gonorrhoeae microcolonies and vice versa. How these interactions develop over time remains to be determined. Nevertheless, our results show that N. elongata and N. gonorrhoeae, representing distantly related species in the Neisseria phylogenetic tree, have the ability to interact with each other.
Tfp also plays an important role in the bi-directional transfer of genetic information between N. elongata and N. gonorrhoeae. Previous studies uncovered evidence of widespread horizontal gene transfer among Neisseria species, including antibiotic resistance alleles and genes known or proposed to play a role in virulence [15], [21], [40]. Our findings provide a mechanism for this observation.
Materials and Methods
Bacterial strains and epithelial cell line
N. elongata subspecies glycolytica (ATCC # 29315) and N. gonorrhoeae strain MS11 (P+, Opa-nonexpressing) were used [15], [20], [41]. Strains spontaneously resistant to Rifampicin were isolated by plating on agar containing Rifampicin (15 or 50 mg/L). The rifampicin resistant mutant of N. elongata (N. elongata rifR) contains a T to C transition that resulted in a change of serine to proline at residue 540 of RpoB. The rifampicin resistant mutant of MS11 (N. gonorrhoeae rifR) contains a C to T transition that resulted in a change from histidine to tyrosine at residue 553 of RpoB. To construct N. elongataΔpilE::Km, a Kanamycin (Km) cassette flanked by 250 base pairs of DNA immediately upstream and downstream of the pilE ORF was transformed into wt N. elongata. Km resistant transformants were screened by PCR and sequencing. One mutant, N. elongataΔpilE was selected for phenotypic studies. The MS11ΔpilE mutant is deleted in both pilin expression sites (ΔpilE1, ΔpilE2) [42], [43]. Bacteria were grown on GCB agar (Difco) with Kellogg's supplements at 37°C, 5% CO2. Infections were carried out on the 16HBE14o− human bronchial epithelial cell line, which supports Neisseria infection [44], [45]. 16HBE14o− cells were maintained in Eagle's Minimal Essential Medium (MEM, Invitrogen, San Diego, CA) with 10% heat-inactivated fetal bovine serum (FBS, Gibco) at 37°C and 5% CO2 and grown in tissue culture flasks pre-coated with LHC (Laboratory of Human Carcinogenesis) basal medium (Invitrogen) supplemented with 0.01 mg/ml human fibronectin (BD Laboratories, New York City, NY), 0.029 mg/ml bovine collagen (BD Laboratories), and 0.1 mg/ml BSA (Invitrogen).
RNA extraction, cDNA, and PCR, and sequence analysis
Bacterial RNA was extracted from N. elongata using the RNAeasy kit (QIAGEN) per manufacturer's instructions. DNA was removed using DNA-free (Ambion) and samples were quantified by spectrophotometry (NanoDrop, Thermo Scientific). Complementary DNA was generated using iScript cDNA Synthesis Kit (BioRad) per manufacturer's protocol. Oligonucleotides complementary to pilE (pilE.f.85, 5′CCGGCTTACCAAGACTACACT3′; pilE.r.497, 5′GCCAGAACCAGTACCGAAAC3′), pilD (pilD.f.203, 5′TAACTAAACCGGCATCACGA3′; pilD.r.780, 5′TAGCTAAGCTGGGACCGAAT3′), pilF (pilF.f.105, 5′AATGTTGTTTGCTGACGGAA3′; pilF.r.1244, 5′ACGAGACAATGTTGCAGGAG3′), pilQ (pilQ.f.547, 5′CAAGCTCAGCGTAATTTGGA3′; pilQ.r.1651, 5′TCAATTATCGCTTCTTTGCG3′) were purchased from Sigma-Aldrich. PCR was performed using GoTaq Green Master Mix (Promega) using manufacturer's recommendations for annealing temperatures for each primer pair. PCR products were sequenced on a 3730XL DNA Analyzer (Applied Biosystems). Sequence Alignments were done using BLAST (National Center for Biotechnology Information).
Electron Microscopy, Microcolony Quantitation and Proteomics
For co-culture studies, N. elongata and N. gonorrhoeae were suspended as single cells in GCB containing Kellogg's supplements, each at a density of 5×107 CFUs/ml. For co-culture on epithelial cells, 16HBE14o− human bronchial epithelial [44], [45] cells were grown to 90% confluence on glass coverslips then co-infected for 3 hours with N. elongata and N. gonorrhoeae, each at an MOI of 50. For co-culture on abiotic surfaces, two mls of each bacterial suspension were inoculated onto a glass coverslip and incubated for 3 hours. For SEM studies of N. elongata Tfp, bacteria were suspended as described above and incubated for 3 hours on glass (for polarity studies) or spotted on 0.2 µm polycarbonate membrane filters (Whatman). Samples were washed in PBS, fixed successively in PBS containing glutaraldehyde (2.5% wt/vol) and OsO4 (1% wt/vol), and stained with uranyl acetate (2% wt/vol). Samples were washed in PBS and dehydrated by successive immersions in ethanol at the following concentrations: 15%, 30%, 50%, 70%, 80%, 90%, 95% (vol/vol, in water), and 100%. Samples were critical point dried and sputter coated with platinum, and imaged using the Hitachi S-4800 Field-Emission Scanning Electron Microscope. For quantitation of physical interaction between N. elongata and N. gonorrhoeae microcolonies, SEM images of microcolonies (see above) of co-cultures on glass (n≥50) and epithelial cells (n≥50) were selected for further analysis. In each case, N. elongata microcolonies were identified, then scored for the presence of a N. gonorrhoeae microcolony in physical contact. The number of N. elongata microcolonies physically contacting a N. gonorrhoeae microcolony is then divided by the total number of N. elongata microcolonies counted. The averages of three independent experiments and Standard Error of the Mean were calculated. Tfp preparations from N. elongata were isolated as described [10], [27]. Briefly, N. elongata grown for 16 hours on GCB plates were resuspended in 50 mM CHES (2-(Cyclohexylamino)ethanesulfonic acid from Sigma-Aldrich) pH 9.5. The suspension was vortexed for 2 minutes and the bacteria bodies were spun down at 18,000× g for 10 minutes. The supernatant was then collected and spun down at 100,000× g for 1.5 hours. The pellet was resuspended in 50 mM CHES. Preparations were separated by SDS PAGE; the region of the gel containing the 17 kDa protein was excised and subjected to in-gel trypsin digestion. Digests were analyzed by peptide mass fingerprinting on a Voyager DE-Pro mass spectrometer (Applied Biosystems) in reflectron mode, and with internal calibration on trypsin autolysis products. Peak lists generated by Mascot Wizard (Ver. 1.2.0.0) were submitted to a Mascot database server (Ver. 2.3) (Matrix Science Ltd.), and searched against the NCBI non-redundant database of 03/26/10 with 10,688,764 sequences and 3,647,636,407 residues. The search, using the following settings: maximum 1 missed cleavage, no modifications, and no taxonomic restriction, yielded matches for 10 mass values out of 67 submitted with a protein score of 126 for gi accession number 291308345 with 71% sequence coverage with 11 ppm RMS error (expectation = 2.7e-06). The highest-ranking non-homologous hit had a Mascot score of 61 (expectation = 8.5).
Co-culture Transformation Assay
Donor and recipient bacteria were each adjusted to a concentration of 5×107 CFU/mL in a total volume of 2 ml, in GCB medium with Kellogg's supplements and 5 mM MgS04. The cultures were incubated together in 50 mm dishes at 37°C, 5% CO2 for 8 hours. To select for N. gonorrhoeae, cultures were plated on GCB agar with Kellogg's supplements and Vancomycin, Colistin and Nystatin (VCN) +/− Rifampicin (15 mg/mL). To select for N. elongata, cultures were plated on LB Lennox agar +/− Rifampicin (15 mg/mL). These selective media allowed the quantitation of rifR bacteria of each species without background from the donor species. Transformation frequency is defined as the number of rifR recipient bacteria divided by the total number of recipient bacteria.
PCR amplification of rpoB rifR gene segment and chromosomal DNA preparation
A segment of the rpoB gene (position 1492 to 2183) was amplified from N. elongata rifR (described above) using oligonucleotide primers (Sigma-Aldrich) complementary to rpoB, with or without DUS sequences. The primer are: L1492 (5′CGTGTVGAACGTGC3′), R2183 (5′CCTTACCATCGGTTTTTCAG3′), R2183DUS (5′CCTTTTCAGACGGCACCATCGGTTTTTCAG3′), and R2183DUS1 (5′CCTTTTCAGACGACACCATCGGTTTTTCAG3′). DUS sequences are underlined. Amplification products were purified using QIAquick PCR Purification Kit (QIAGEN, Valencia, CA). Products were quantitated by spectrophotometry (NanoDrop, Thermo Scientific). For chromosomal DNA preparations, bacteria from one agar plate were resuspended in 0.5 ml of GC Lysis Buffer containing 1% SDS followed by RNAse A treatment (Qiagen RNAse). 0.9 ml of phenol/chloroform/isoamyl alcohol (at a 25∶24∶1 ratio) was added to the lysate and the solution was vortexed for 1 minute. DNA was extracted from the mixture using Phase Lock Gel system (5 Prime) per manufacturer's instructions. DNA was precipitated by the addition of 1 ml isopropanol, followed by 5 minutes centrifugation at 16,000× g. Isopropanol was removed and the DNA pellet air dried. The DNA pellet was dissolved in 0.3 ml of TE (10 mM Tris-HCl; 1 mM EDTA, pH 8.0), and reprecipitated by the addition of 150 µl 7.5 M NH4OAc and 1 ml of 100% EtOH. The DNA was pelleted by centrifugation for 10 minutes at 16,000× g, and the pellet was washed with ice cold 70% EtOH (vol/vol). The DNA was dried and resuspended in water, and the concentration determined by spectrophotometry as described above.
DNA transformation experiments
Transformation assays were performed as described [46], [47]. Briefly, N. elongata or N. elongataΔpilE were grown on supplemented GCB agar for 16 hours. A DNA mixture was made by the addition of chromosomal (2.0 µg) or PCR-generated DNA (0.5 µg) to 200 µl of pre-warmed GCB medium supplemented with 5 mM MgSO4. Bacteria were suspended in GCB liquid medium supplemented with 5 mM MgSO4, to an OD600 of ∼2. 20 µl of this bacterial suspension was added to the DNA mixture and incubated for 20 minutes at 37°C. The transformation mix was then added to 2 ml of supplemented GCB medium in a 50 mm tissue culture dish and incubated at 37°C, 5% CO2 for 5 hours. Bacteria were pelleted by centrifugation at 6500× g for 5 minutes. The pellets were suspended in transformation medium and serial dilutions were plated on GCB agar containing Rifampicin (15 mg/L) to enumerate antibiotic resistant bacteria, and on GCB plates without antibiotics to determine total CFUs.
Acknowledgments
We thank David Elliott and Gina Zhang for expert assistance with microscopy; Lindsay D. Gregston and Nyiawung Taku for excellent technical assistance; Dena Yoder from the BIO5 Media Facility for technical support; and Pradeep Marri and members of the So lab for helpful comments on this manuscript.
Author Contributions
Conceived and designed the experiments: DLH NB NJW MS. Performed the experiments: DLH NB NJW AA JLS LMB. Analyzed the data: DLH NB JLS LMB MS. Contributed reagents/materials/analysis tools: LMB MS. Wrote the paper: DLH NB NJW AA LMB MS.
References
- 1. Catlin BW (1960) [Interspecific transformation of Neisseria by culture slime containing deoxyribonucleate.]. Science 131: 608–610.
- 2. Chen I, Christie PJ, Dubnau D (2005) The ins and outs of DNA transfer in bacteria. Science 310: 1456–1460.
- 3. Lennox ES (1955) Transduction of linked genetic characters of the host by bacteriophage P1. Virology 1: 190–206.
- 4. Sparling PF (1966) Genetic transformation of Neisseria gonorrhoeae to streptomycin resistance. J Bacteriol 92: 1364–1371.
- 5. Ottow JC (1975) Ecology, physiology, and genetics of fimbriae and pili. Annu Rev Microbiol 29: 79–108.
- 6. Biswas GD, Sox T, Blackman E, Sparling PF (1977) Factors affecting genetic transformation of Neisseria gonorrhoeae. J Bacteriol 129: 983–992.
- 7. Chen I, Dubnau D (2004) DNA uptake during bacterial transformation. Nat Rev Microbiol 2: 241–249.
- 8. Froholm LO, Jyssum K, Bovre K (1973) Electron microscopical and cultural features of Neisseria meningitidis competence variants. Acta Pathol Microbiol Scand B Microbiol Immunol 81: 525–537.
- 9. Parge HE, McRee DE, Capozza MA, Bernstein SL, Getzoff ED, et al. (1987) Three dimensional structure of bacterial pili. Antonie Van Leeuwenhoek 53: 447–453.
- 10. Craig L, Volkmann N, Arvai AS, Pique ME, Yeager M, et al. (2006) Type IV pilus structure by cryo-electron microscopy and crystallography: implications for pilus assembly and functions. Mol Cell 23: 651–662.
- 11. Wolfgang M, van Putten JP, Hayes SF, Dorward D, Koomey M (2000) Components and dynamics of fiber formation define a ubiquitous biogenesis pathway for bacterial pili. Embo J 19: 6408–6418.
- 12. Knapp JS (1988) Historical perspectives and identification of Neisseria and related species. Clin Microbiol Rev 1: 415–431.
- 13. Contreras M, Costello EK, Hidalgo G, Magris M, Knight R, et al. The bacterial microbiota in the oral mucosa of rural Amerindians. Microbiology 156: 3282–3287.
- 14. Zaura E, Keijser BJ, Huse SM, Crielaard W (2009) Defining the healthy “core microbiome” of oral microbial communities. BMC Microbiol 9: 259.
- 15. Marri PR, Paniscus M, Weyand NJ, Rendon MA, Calton CM, et al. (2010) Genome sequencing reveals widespread virulence gene exchange among human Neisseria species. PLoS One 5: e11835.
- 16. Aho EL, Urwin R, Batcheller AE, Holmgren AM, Havig K, et al. (2005) Neisserial pilin genes display extensive interspecies diversity. FEMS Microbiol Lett 249: 327–334.
- 17. Elkins C, Thomas CE, Seifert HS, Sparling PF (1991) Species-specific uptake of DNA by gonococci is mediated by a 10-base-pair sequence. J Bacteriol 173: 3911–3913.
- 18. Goodman SD, Scocca JJ (1988) Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae. Proc Natl Acad Sci U S A 85: 6982–6986.
- 19. Bovre K, Holten E (1970) Neisseria elongata sp.nov., a rod-shaped member of the genus Neisseria. Re-evaluation of cell shape as a criterion in classification. J Gen Microbiol 60: 67–75.
- 20. Henriksen SD, Holten E (1976) Neisseria elongata subsp. glycolytica subsp. nov. International Journal of Systematic Bacteriology 26: 478–481.
- 21. Bovre K, Froholm LO, Henriksen SD, Holten E (1977) Relationship of Neisseria elongata subsp. Glycolytica to other members of the family Neisseriaceae. Acta Pathol Microbiol Scand B 85B: 18–26.
- 22. Lujan R, Zhang QY, Saez Nieto JA, Jones DM, Spratt BG (1991) Penicillin-resistant isolates of Neisseria lactamica produce altered forms of penicillin-binding protein 2 that arose by interspecies horizontal gene transfer. Antimicrob Agents Chemother 35: 300–304.
- 23. Higashi DL, Zhang GH, Biais N, Myers LR, Weyand NJ, et al. (2009) Influence of type IV pilus retraction on the architecture of the Neisseria gonorrhoeae-infected cell cortex. Microbiology 155: 4084–4092.
- 24. Mattick JS (2002) Type IV pili and twitching motility. Annu Rev Microbiol 56: 289–314.
- 25. Nudleman E, Wall D, Kaiser D (2006) Polar assembly of the type IV pilus secretin in Myxococcus xanthus. Mol Microbiol 60: 16–29.
- 26. Gibiansky ML, Conrad JC, Jin F, Gordon VD, Motto DA, et al. (2010) Bacteria use type IV pili to walk upright and detach from surfaces. Science 330: 197.
- 27. Biais N, Higashi DL, Brujic J, So M, Sheetz MP (2010) Force-dependent polymorphism in type IV pili reveals hidden epitopes. Proc Natl Acad Sci U S A 107: 11358–11363.
- 28. Zhang QY, DeRyckere D, Lauer P, Koomey M (1992) Gene conversion in Neisseria gonorrhoeae: evidence for its role in pilus antigenic variation. Proc Natl Acad Sci U S A 89: 5366–5370.
- 29. Treangen TJ, Ambur OH, Tonjum T, Rocha EP (2008) The impact of the neisserial DNA uptake sequences on genome evolution and stability. Genome Biol 9: R60.
- 30. Qvarnstrom Y, Swedberg G (2006) Variations in gene organization and DNA uptake signal sequence in the folP region between commensal and pathogenic Neisseria species. BMC Microbiol 6: 11.
- 31. Ambur OH, Frye SA, Tonjum T (2007) New functional identity for the DNA uptake sequence in transformation and its presence in transcriptional terminators. J Bacteriol 189: 2077–2085.
- 32. Duffin PM, Seifert HS (2010) DNA Uptake Sequence-Mediated Enhancement of Transformation in Neisseria gonorrhoeae Is Strain Dependent. J Bacteriol 192: 4436–4444.
- 33. Seifert HS, Ajioka RS, Marchal C, Sparling PF, So M (1988) DNA transformation leads to pilin antigenic variation in Neisseria gonorrhoeae. Nature 336: 392–395.
- 34. Caugant DA, Hoiby EA, Magnus P, Scheel O, Hoel T, et al. (1994) Asymptomatic carriage of Neisseria meningitidis in a randomly sampled population. J Clin Microbiol 32: 323–330.
- 35. Janda WM, Bohnoff M, Morello JA, Lerner SA (1980) Prevalence and site-pathogen studies of Neisseria meningitidis and N gonorrhoeae in homosexual men. Jama 244: 2060–2064.
- 36. Kent CK, Chaw JK, Wong W, Liska S, Gibson S, et al. (2005) Prevalence of rectal, urethral, and pharyngeal chlamydia and gonorrhea detected in 2 clinical settings among men who have sex with men: San Francisco, California, 2003. Clin Infect Dis 41: 67–74.
- 37. Miller K, Hansen W, Labbe M, Crokaert F, Yourassowsky E, et al. (1985) Isolation of Neisseria elongata and of Capnocytophaga ochracea from vaginal specimens. J Infect 10: 174–175.
- 38. Osborne NG, Grubin L (1979) Colonization of the pharynx with Neisseria gonorrhoeae: experience in a clinic for sexually transmitted diseases. Sex Transm Dis 6: 253–256.
- 39. Takahashi S, Kurimura Y, Hashimoto J, Takeyama K, Koroku M, et al. (2008) Pharyngeal Neisseria gonorrhoeae detection in oral-throat wash specimens of male patients with urethritis. J Infect Chemother 14: 442–444.
- 40. Wu HM, Harcourt BH, Hatcher CP, Wei SC, Novak RT, et al. (2009) Emergence of ciprofloxacin-resistant Neisseria meningitidis in North America. N Engl J Med 360: 886–892.
- 41. Segal E, Hagblom P, Seifert HS, So M (1986) Antigenic variation of gonococcal pilus involves assembly of separated silent gene segments. Proc Natl Acad Sci U S A 83: 2177–2181.
- 42. Ayala BP, Vasquez B, Clary S, Tainer JA, Rodland K, et al. (2001) The pilus-induced Ca2+ flux triggers lysosome exocytosis and increases the amount of Lamp1 accessible to Neisseria IgA1 protease. Cell Microbiol 3: 265–275.
- 43. Merz AJ, Rifenbery DB, Arvidson CG, So M (1996) Traversal of a polarized epithelium by pathogenic Neisseriae: facilitation by type IV pili and maintenance of epithelial barrier function. Mol Med 2: 745–754.
- 44. Cozens AL, Yezzi MJ, Kunzelmann K, Ohrui T, Chin L, et al. (1994) CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am J Respir Cell Mol Biol 10: 38–47.
- 45. Weyand NJ, Calton CM, Higashi DL, Kanack KJ, So M (2010) Presenilin/gamma-secretase cleaves CD46 in response to Neisseria infection. J Immunol 184: 694–701.
- 46. Dillard JP (2006) Genetic manipulation of Neisseria gonorrhoeae. Curr Protoc Microbiol Chapter 4: Unit 4A 2.
- 47. Sox TE, Mohammed W, Sparling PF (1979) Transformation-derived Neisseria gonorrhoeae plasmids with altered structure and function. J Bacteriol 138: 510–518.