Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Characterization of Major Histocompatibility Complex (MHC) DRB Exon 2 and DRA Exon 3 Fragments in a Primary Terrestrial Rabies Vector (Procyon lotor)

  • Sarrah Castillo ,

    scastillo@nrdpfc.ca

    Affiliations Environmental and Life Sciences Gradate Program, Trent University, Peterborough, Ontario, Canada, Natural Resources DNA Profiling and Forensics Centre, Trent University, Peterborough, Ontario, Canada

  • Vythegi Srithayakumar,

    Affiliations Environmental and Life Sciences Gradate Program, Trent University, Peterborough, Ontario, Canada, Natural Resources DNA Profiling and Forensics Centre, Trent University, Peterborough, Ontario, Canada

  • Vanessa Meunier,

    Affiliation Forensic Science Department, Trent University, Peterborough, Ontario, Canada

  • Christopher J. Kyle

    Affiliations Forensic Science Department, Trent University, Peterborough, Ontario, Canada, Natural Resources DNA Profiling and Forensics Centre, Trent University, Peterborough, Ontario, Canada

Abstract

The major histocompatibility complex (MHC) presents a unique system to explore links between genetic diversity and pathogens, as diversity within MHC is maintained in part by pathogen driven selection. While the majority of wildlife MHC studies have investigated species that are of conservation concern, here we characterize MHC variation in a common and broadly distributed species, the North American raccoon (Procyon lotor). Raccoons host an array of broadly distributed wildlife diseases (e.g., canine distemper, parvovirus and raccoon rabies virus) and present important human health risks as they persist in high densities and in close proximity to humans and livestock. To further explore how genetic variation influences the spread and maintenance of disease in raccoons we characterized a fragment of MHC class II DRA exon 3 (250bp) and DRB exon 2 (228 bp). MHC DRA was found to be functionally monomorphic in the 32 individuals screened; whereas DRB exon 2 revealed 66 unique alleles among the 246 individuals screened. Between two and four alleles were observed in each individual suggesting we were amplifying a duplicated DRB locus. Nucleotide differences between DRB alleles ranged from 1 to 36 bp (0.4–15.8% divergence) and translated into 1 to 21 (1.3–27.6% divergence) amino acid differences. We detected a significant excess of nonsynonymous substitutions at the peptide binding region (P = 0.005), indicating that DRB exon 2 in raccoons has been influenced by positive selection. These data will form the basis of continued analyses into the spatial and temporal relationship of the raccoon rabies virus and the immunogenetic response in its primary host.

Introduction

Genetic variation has been associated with resistance to pathogens; however, studies have primarily screened neutral molecular markers to assess levels of genetic diversity [e.g., [1], –[3]] despite their inability to reveal patterns of adaptive selection [e.g., 4]. Studying functional genetic markers, such as those within the major histocompatibility complex (MHC), provides an opportunity to assess genetic variation directly associated with adaptive selection [2], [3]. MHC is a multi-gene family, consisting of two tightly linked subclasses in birds and mammals, which play a vital role in the initiation of the immune response [5][7]. MHC class I molecules are responsible for recognition of intracellular pathogens such as viruses and cancer cells [2], [8], whereas class II molecules are responsible for recognition of extracellular pathogens such as bacteria and nematodes [8]. Given its immunological capabilities, MHC provides a genetic system to study disease dynamics in vertebrates [9]. MHC is one of the most polymorphic complexes of the vertebrate genome, with the majority of the polymorphism confined to the functionally important peptide binding region (PBR) [5], which bind peptides and presents them to T-cells, thereby activating the necessary immune response [3]. The PBR most often displays higher rates of nonsynonymous substitutions (amino acid change) than synonymous substitutions (same amino acid) as it allows for binding of a greater number of peptides [9], [10]. A number of hypotheses have been proposed to explain how the high levels of diversity at MHC are maintained, including overdominant selection, pathogen driven selection, maternal-fetal interactions and mate choice [8], [11], [12,]. However, a combination of different selection methods may be responsible for the extent of polymorphism observed and maintained within MHC [9].

Generally, investigations of MHC have focused on wildlife species of conservation concern that have experienced recent population reductions due to factors such as emerging infectious disease, and negative anthropogenic influences (e.g., common frog [13] Eurasian beaver [14], lemur [10], chacma baboon [15], sea lion [16], giant panda [17] and European mink [18]). The objective of this study was to characterize the DR region of MHC class II in a common and widespread wildlife species, the North American raccoon (Procyon lotor). Raccoons present a particularly interesting system to study MHC variation in mammals as they are broadly distributed across much of North America and are a host species to a number of pathogens and parasites (e.g., canine distemper virus, canine adenovirus, feline parvovirus, and rabies) [19] that can be transmitted to other wildlife, agricultural animals, and domestic animals [19]. Large bodies of water and large mountain ranges (e.g., Mississippi River and Appalachian Mountains) have been proposed as physiographic barriers to the movement of raccoons [20], [21]; however, raccoons generally lack strong patterns of genetic structure over broad geographic ranges. Bi-parentally inherited neutral markers show limited genetic structure of raccoons across North America, with slight structure found on a small spatial scale across large rivers (e.g., Niagara River) [22]. Maternally inherited neutral markers (mtDNA) show slightly stronger genetic structure in raccoons where there are three main lineages in North America [23], which are closely related to a previously considered separate species, the West-Indies raccoon [24]. The general lack of distinct raccoon populations throughout North America have been attributed to extensive gene flow, high population densities and long distance dispersal, and may have influenced the speed at which diseases are transmitted in this wildlife vector [25]. This study will add an additional dimension to our understanding of raccoon genetics by characterizing the DR region of MHC class II, which allows us to investigate the link between disease and the immune response. We examined two loci within the DR region of MHC class II (DRA and DRB), with focus on the second exon of DRB where the functionally important PBR resides [8] which has been previously studied in numerous wildlife species. This study will provide a baseline from which to expand our exploration of MHC in conjunction with wildlife diseases, demographic processes, and other selective forces.

Materials and Methods

Sample collection, DNA extraction and quantification

Samples were obtained from raccoons along the eastern seaboard of North America and consisted of a subset of those previously used for subspecific designation [23]. We chose four distinct geographic regions to study (Ontario (ON), New York (NY), Alabama/Georgia (AL/GA) and Florida (FL)), which differed in their exposure time to rabies. Samples were provided from a number of agencies including; Canadian Food Inspection Agency (CFIA), Center for Disease Control (CDC), New York Department of Health (NYDOH), Ontario Ministry of Natural Resources (OMNR), and United States Department of Agriculture-Wildlife Services (USDA-WS). Samples consisted of rabies positive and rabies negative individuals. Samples obtained from the CFIA, CDC and NYDOH were brain tissue samples from surveillance and rabies positive samples whereas samples obtained from OMNR and USDA-WS consisted of hair pulls from live trapped animals acquired during control programs, or muscle tissue.

DNA extraction methods were as per Cullingham et al. [23]. Briefly, samples were dissolved in 1× lysis buffer and 600 U/ml proteinase K. DNA extractions were carried out using an automated 96-well plate magnetic bead procedure on an Evolution P3 (Perkin Elmer, Waltham, USA) (May 2005) and quantified using PicoGreen® (Invitrogen, Burlington, Canada).

PCR amplification and cloning procedure

We initially screened a 635bp fragment of MHC II DRA (exon 3–4) in 32 individuals, using the forward primer DRA U1291 (CCCGTGGAACTGGGAGAGC) and reverse primer DRA L1512 (CYRCATTCTCTGTKGTCTCTG) [16]. Polymerase chain reaction (PCR) was performed on a PTC-0220/PTC-0221 Thermocycler (Bio-Rad, Hercules, CA) using 10ng of DNA, 1× PCR buffer (Invitrogen, Carlsbad, CA), 0.45mM MgCl2, 1.5 mM of each dNTP, 0.3uM of each primer, 0.6 mM of bovine serum albumin (Sigma, St. Louis, MO), and 0.2 U/µl Taq DNA polymerase (Invitrogen, Carlsbad, CA), and double distilled water in a 15 µl reaction. PCR conditions started with an initial denaturation of 95°C for 11 min, followed by 35 cycles of the following steps: 94°C for 1 min, 59°C for 1 min and 72°C for 1 min, with a final extension of 45 min at 60°C. Visualization of amplified product was performed on an agarose gel stained with ethidium bromide. Amplified products were ligated into a vector and transformed into cells using pCR®2.1-TOPO vector, and TOP10 chemically competent cells following the procedure outlined in the TOPO TA cloning kit (Invitrogen, Carlsbad, CA) with the following modifications: 0.8µl of vector, and an incubation time (PCR product inserted into vector) of 30 min at room temperature. Following overnight incubation, sterile toothpicks were used to pick clones that were added to 50 µl of 0.1× TE0.1. Clones were boiled (10 min at 100°C) and 5–15 clones were amplified to confirm insertion using the primer set M13F (GTAAAACGACGGCCAG) and M13R (CAGGAAACAGCTATGAC) (Invitrogen, Carlsbad, CA). Amplification consisted of 2 µl of cloned produced, 1× PCR buffer, 0.04 mM of each dNTP, 1.5 mM MgCl2, 0.2 uM of each primer, 0.05 U/µl of Taq DNA polymerase and double distilled water in a 10µL reaction. Cycling conditions consisted of an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec, and a final extension of 2 min at 72°C. Successfully inserted clones were purified for sequencing using ExoSap-IT (New England Biolabs Inc, Ipswich, MA) following the manufacturer's instructions. Sequencing using the M13F primer was carried out using the BigDye® Terminator v3.1 Cycle Sequencing Kit and the resulting fragments were analyzed on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA). Fragments were visually inspected, corrected and aligned manually to other species and to each other, using MEGA version 4 [26]. Nomenclature rules set by Klein et al. [27] were followed for designating DR allele names.

In addition, we amplified a 228 base pair fragment of MHC II DRB exon 2, in 246 individuals, using the forward primer DRB-5c (TCAATGGGACGGAGCGGGTGC) [28] and reverse primer DRB-3c (CCGCTGCACAGTGAAACTCTC) [29]. Polymerase chain reaction (PCR) was performed using 10ng of DNA, 1× PCR buffer (Invitrogen, Carlsbad, CA), Q-Solution (Quiagen, Mississauga, Ontario), 1.5mM MgCl2, 0.2 mM of each dNTP, 0.45uM of each primer, and 0.05 U/µl Taq DNA polymerase (Invitrogen, Carlsbad, CA), and double distilled water in a 12 µl reaction. PCR conditions included an initial denaturation for 5 min at 94°C, followed by 34 cycles of the following steps: 94°C for 30 sec, 56°C for 1 min and 72°C for 1 min, with a final extension of 45 min at 60°C. Visualization and sequencing procedures were as outlined above for DRA. The cloning procedure differed slightly in the number of clones that were picked (20–30 clones/sample) and number of clones amplified (25 clones/sample).

RNA Isolation

The expression of MHC DRB exon 2 was explored through RNA screening for transcription of the gene from fresh blood of a single raccoon from Ontario. RNA was isolated using the total RNA purification kit (Norgen Biotek Corp, Thorold, ON) following the manufacturer's instructions. Extracted RNA was further treated with DNase enzyme (New England Biolabs Inc, Ipswich, MA) according to manufacturer's protocol to remove any residual DNA and was cleaned using an isopropanol precipitation. cDNA was constructed using ThermoScript RT-PCR system (Invitrogen, Carlsbad, CA) following manufacturer's instructions. cDNA was constructed using gene specific primers and the expression of the gene was assumed confirmed by presence of band at ∼200 bp on an agarose gel.

Analysis

A number of molecular techniques have been used to characterize MHC in mammals including DGGE [16], SSCP [30] and RSCA [31] in addition to cloning [32]. Upon initial characterization of MHC DRB exon 2 in raccoons we determined that many of the alleles differed by as little as one nucleotide, which produced different amino acid sequences. In addition, the total number of alleles increased as we augmented the number of individuals and geographic regions screened. Based on the aforementioned, we determined that cloning was the most appropriate method to use for this study in order to directly capture all the variation at MHC. Given the potential for cloning errors, which may result in recombinant alleles, singleton mutations, as well as non-target DNA incorporation during cloning [33], conservative criteria were used to confirm the presence of alleles. Any sequences showing singletons from Taq error and recombinations were immediately discarded. Sequences from clones were confirmed as alleles when they were seen in more than one clone from multiple individuals [34]. Sequences observed in more than one clone, but only from a single individual were confirmed as alleles through a second independent amplification and cloning procedure. Upon visual analysis of sequences it was determined that we were amplifying a duplicated locus, with each individual having between two and four alleles. This led to an increased number of clones that needed to be sequenced. Using a homogeneous discrete time Markov Chain (Tij = P{Xn+1 = j|Xn = i}) [35] we determined that 16 clones needed to be sequenced to visualize all four alleles with a confidence interval of 96%. In the 16 clones per individual we saw evidence of Taq errors and chimers. We excluded all sequences that presented these types of artefacts leading to approximately 13 clones/individual showing redundancy, leaving an 85% chance of visualizing all alleles/individual.

We attempted to separate the alleles into their respective loci by using individuals presumed homozygous at each locus; however, many of the alleles observed in high frequencies appeared to be shared between the loci making it difficult to assign alleles to a specific locus. Further analysis was performed to supertype alleles [reviewed in 4]. Supertyping simplifies data analysis and interpretation of results by reducing sampling error and strengthening statistical relationships. This approach has been used in humans [36], as well as other mammals (e.g., lemurs) [4] by classifying MHC alleles to supertypes based on similar antigen-binding sites, structural similarities, and polarities [4]. We supertyped alleles based on common amino acids at the peptide binding region, however these criteria did not result in fewer types and therefore analyses were performed on all alleles.

Average pairwise nucleotide distances (Kimura 2 parameter model or K2P), Poisson-corrected amino acid distances and average rate of synonymous (dS) and nonsynonymous (dN) substitutions per site were computed in MEGA 4 [26] using the modified Nei-Gojobori method with the Jukes-Cantor correction for multiple substitutions [37]. Standard errors of the preceding calculations were obtained through 1000 bootstrap replicates. To test methods of selection acting on exon 2 of DRB in raccoons, rates of dN and dS were calculated both under models of neutrality and positive selection using a one tailed Z-test performed in MEGA. The rates of dN and dS were calculated separately for all amino acid positions (all sites), only peptide binding regions (PBR) and only non-PBR. The putative PBR was determined in concordance with the human MHC II molecular structure [38], [39].

A phylogenetic tree was constructed with Mr.Bayes, using Bayesian inference [40], [41], with the best-fit model of nucleotide substitution (F81+I+G) indicated by the likelihood ratio test of JModel test [42], [43]. Analyses were run for 80×107 generations, sampling every 5000 generations. Branch support of phylogenies was assessed through Markov Chain Monte Carlo methodology. Outgroups of sea lion, European mink, and giant panda were chosen based on identity to other species MHC DRB exon 2 and similar carnivore species. In addition, a neighbour-joining tree was constructed from K2P nucleotide distance in MEGA with 100000 bootstraps. All trees used the same outgroups (sea lion, European mink and giant panda).

Results

This study characterized two fragments of the MHC class II DR region in a large number of raccoons from different regions of North America. Initially, characterization of MHC DRA was performed on 32 individuals. Both intron and exon were amplified using the DRA primers, but we were only able to align exon 3 (250bp) with other known DRA sequences of sea lions (Zaca-DRA*03) [16], which was chosen based on its high similarity (96%) [44]. One to three alleles were observed per individual indicating that our primers were likely amplifying two loci. We found a total of three alleles (Genbank Accession HM589039–HM589041) in the 32 individuals screened. The nucleotide substitutions between the alleles were synonymous and translated into a single amino acid sequence indicating that DRA exon 3 is functionally monomorphic in raccoons; therefore no further analyses were performed using this marker.

MHC DRB exon 2 was screened in 246 individuals from four geographic regions (Table 1). Between two and four alleles were identified in each individual indicating we were likely amplifying a duplicated locus. A total of 66 unique alleles were detected among the 246 individuals analyzed (GenBank Accession GU388312–GU388377; Table 2). Of the 66 unique alleles, 58 were observed in more than one individual, whereas the remaining 8 were only seen in one individual but were observed in two or more clones. Confirmation of these 8 alleles was further assessed through a separate independent PCR and cloning procedure. Of the 228 nucleotides, 54 (23.7%) were variable as were 27 of the 75 (36.0%) amino acid positions. The number of pairwise nucleotide differences between pairs of alleles ranged from 1(6 pairs of alleles) to 36 (allele Prlo-DRB*31 vs. allele Prlo-DRB*80) and the number of amino acids differences ranged from 1 (19 pairs of alleles) to 21 (Prlo-DRB*31 vs. Prlo-DRB*80). There were no insertion/deletions or premature stop codons detected in DRB exon 2 in raccoons, suggesting it is functional. Functionality was further assessed through screening for transcription of DRB exon 2 in the RNA using RT PCR.

thumbnail
Table 1. Number of individuals and geographic locations of MHC DRB exon 2 alleles.

https://doi.org/10.1371/journal.pone.0012066.t001

thumbnail
Table 2. Amino acid sequences of MHC DRB exon 2 alleles in raccoons.

https://doi.org/10.1371/journal.pone.0012066.t002

Average pairwise K2P nucleotide distances and Poisson corrected amino acid distances were computed for all sites, PBR only and non-PBR only (Table 3). Phylogenetic relationship among raccoon MHC DRB exon 2 alleles were poorly resolved using both methods of phylogenetic analyses (Bayesian inference and K2P nucleotide distance); we therefore chose to only present the Bayesian tree as we concluded that the support for the branches were more accurate and reflective of the true phylogenetic relationships (Figure 1). When examining modes of selection acting on MHC DRB exon 2, there were signs of positive selection acting on this region of the genome with greater rates of nonsynonymous than synonymous substitutions found at the peptide binding regions (Table 4: P = 0.005, Z-test of positive selection).

thumbnail
Figure 1. Bayesian phylogenetic relationship of raccoon MHC DRB exon 2.

This tree was constructed using the best fit model from the JModel test [42], [43]. In addition to the 66 raccoon alleles, three MHC alleles belonging to other mammals were included as outgroups: Zalophus californianus (GenBank Accession AY491456), Ailuropoda melanoleuca (GenBank Accession EF125965), and Mustela lutreola (GenBank Accession EU263550).

https://doi.org/10.1371/journal.pone.0012066.g001

thumbnail
Table 3. Average nucleotide and amino acid distances among raccoon MHC DRB exon 2 alleles.

https://doi.org/10.1371/journal.pone.0012066.t003

thumbnail
Table 4. Average rates of nonsynonymous substitutions per nonsynonymous site (dN) and synonymous substitutions per synonymous site (dS).

https://doi.org/10.1371/journal.pone.0012066.t004

Discussion

This study represents the first comprehensive investigation of MHC variation in the procyonidae family. Investigating MHC variation in raccoons will further our understanding of how the immune systems of this host species responds to invading organisms. Initial characterization was performed on the alpha region of the DR gene in raccoons. We determined that DRA exon 3 in raccoons is functionally monomorphic based on identical amino acid sequences of the three alleles. The finding that DRA exon 3 is monomorphic is similar to what has been observed in other mammalian species [45]. The lack of variation at DRA makes this locus inappropriate for studies of pathogen influence; therefore no further analyses were performed. However it is important to note that other exons in this locus may be polymorphic and may be used for studies of pathogen influence. Additionally, this locus can be utilized in future comparative studies.

We found that MHC DRB exon 2 is duplicated in raccoons, with between two and four alleles present in each individual. Duplication of MHC class II loci is common in mammalian groups, (e.g., sea lions [16], domestic cats [34], and chacma baboons [15]), with the majority of duplicated loci being functional [46]. Duplication of MHC loci also plays an important role in the adaptive evolution of organisms by increasing the number of alleles present in individuals, thereby allowing for the detection of a greater number of invading organisms [47]. We were unable to assign alleles to an individual locus as interlocus exchange is known to occur at MHC loci [48]. Therefore we considered all alleles to be representatives of the DRB locus for the phylogenetic analysis.

Our phylogenetic relationships (Figure 1) were poorly resolved using both Bayesian Inference and K2P nucleotide distance measures. This was expected given the relatively short sequence length and vast amount of polymorphism. Alleles clustered into two main clades, with the majority of alleles belonging to a single unresolved clade. The presence of multiple clades may relate to the different strains of the raccoon rabies virus present in raccoon populations in North America [49] given the strong selective force of rabies in these regions, or may be related to other selective pressures. Four Prlo-DRB alleles moderately cluster (86%) with the mink and giant panda outgroups suggesting possible trans-specific inheritance of some DRB sequences before divergence from a common ancestral sequence [15]. All alleles were also found to identify in the 80 percentile with DRB alleles from other animals, further suggesting that we were amplifying the DRB locus [44].

We found extremely high variation at MHC DRB exon 2 in raccoons with a total of 66 alleles discovered in 246 individuals analyzed (Table 2). The second exon of DRB is known to be highly polymorphic and the polymorphism is present at multiple base sites [50]. This is consistent with our finding of up to 36 nucleotide differences between alleles (Prlo-DRB*31 vs. Prlo-DRB*80). Doherty & Zinkernagel [51] proposed that polymorphism at MHC was related to the function of the peptide binding regions and ability to confer resistance to a wide range of pathogens. This implies that MHC polymorphism must be maintained by pathogen driven selection, [see 9] such as overdominance (heterozygote advantage) [6], [51] or frequency dependent selection (rare allele advantage/Red queen hypothesis) [52]. Either of these forms of pathogen driven selection may be driving polymorphism of MHC in raccoons.

We found evidence of positive selection acting on MHC with rates of nonsynonymous substitutions being 2.6 times greater than synonymous substitutions at the functionally important peptide binding region (PBR) (Table 4). The difference between rates of synonymous and nonsynonymous substitutions was much lower than what has been previously reported in other mammalian species (e.g., dN was 5 times greater than dS in spotted suslik [53]; dN was 8.31 times higher than dS in chacma baboons [15]). The lower difference between nonsynonymous and synonymous substitutions found in this study may be due to the addition of the peptide binding regions (PBRs) described by Stern et al. [39] which were added to include all the probable PBRs. In contrast, there was no significant difference between nonsynonymous and synonymous substitutions at the non-peptide binding regions. Beyond testing for positive selection, we also tested for significant departure from neutral expectations (dN = dS) which has been proposed to be important for inferring the effects of selection acting on MHC diversity [9]. Significant deviation from neutrality was found (Z = 2.098, P =  0.038) at the PBR further supporting the idea that positive selection has been the strongest form of selection acting on MHC in raccoons.

Understanding variation of the immune response in raccoon is necessary as there is an ongoing epizootic of the raccoon variant of rabies in North America. Due to increased density of raccoons in urban areas, there is a higher risk of rabies transmission to humans, domestic animals and livestock [54], [55]. Although rabies was thought to be 100% lethal, thereby having no evolutionary potential, it has been illustrated that immunity may exist in raccoon populations [56]. The data presented here will form the basis of continued analyses into the spatial and temporal relationship of the raccoon rabies virus and the immunogenetic response in its primary host.

Acknowledgments

We would like to thank all the agencies that provided samples for this project: Canadian Food Inspection Agency, Center for Disease Control, New York Department of Health, Ontario Ministry of Natural Resources, and United States Department of Agriculture-Wildlife Services. We would also like to thank Colleen Doyle, Brooke Craft and Sylvia (Smolly) Coulson for technical support.

Author Contributions

Conceived and designed the experiments: SC CJK. Performed the experiments: SC VS VM. Analyzed the data: SC. Contributed reagents/materials/analysis tools: CJK. Wrote the paper: SC. Edited manuscript: VS CJK. Graduate Supervisor: CJK. Funding Source: CJK.

References

  1. 1. Hedrick PW (2002) Pathogen resistance and genetic variation at MHC loci. Evolution 56: 1902–1908.
  2. 2. Sommer S (2005) The importance of immune gene variability (MHC) in evolutionary ecology and conservation. Frontiers in Zoology 2: 16.
  3. 3. Piertney SB, Oliver MK (2006) The evolutionary ecology of the major histocompatibility complex. Heredity 96: 7–21.
  4. 4. Schwensow N, Fietz J, Dausmann KH, Sommer S (2007) Neutral versus adaptive genetic variation in parasite resistance: importance of major histocompatibility complex supertypes in a free-ranging primate. Heredity 99: 265–277.
  5. 5. Klein J (1986) Natural history of the Major Histocompatibility Complex. New York: Wiley..
  6. 6. Hughes AL, Nei M (1989) Nucleotide substitution at major histocompatibility complex class II loci: evidence for overdominant selection. Proceedings of the National Academy of sciences USA 86: 958–962.
  7. 7. Hughes AL, Hughes MK (1995) Natural selection on the peptide-binding regions of major histocompatibility complex molecules. Immunogenetics 42: 233–243.
  8. 8. Hughes AL, Yeager M (1998) Natural selection at major histocompatibility complex loci of vertebrates. Annual Review of Genetics 32: 415–435.
  9. 9. Bernatchez L, Landry C (2003) MHC studies in nonmodel vertebrates: what have we learned about natural selection in 15 years? Journal of Evolutionary Biology 16: 363–377.
  10. 10. Schad J, Sommer S, Ganzhorn JU (2004) MHC variability of a small lemur in the littoral forest fragments of southeastern Madagascar. Conservation Genetics 5: 299–309.
  11. 11. Hughes AL, Nei M (1993) Evolutionary relationships of the classes of major histocompatibility complex genes. Immunogenetics 37: 337–346.
  12. 12. Hughes AL, Hughes MK, Howell CY, Nei M (1994) Natural selection at the class II major histocompatibility complex loci of mammals [and discussion]. Philosophical Transactions: Biological Sciences 346: 359–367.
  13. 13. Zeisset I, Beebee TJC (2009) Molecular characterization of major histocompatibility complex class II alleles in the common frog, Rana temporaria. Molecular Ecology Resources 9: 738–745.
  14. 14. Babik W, Durka W, Radwan J (2005) Sequence diversity of the MHC DRB gene in the Eurasian beaver (Castor fiber). Molecular Ecology 14: 4249–4257.
  15. 15. Huchard E, Cowlishaw G, Raymond Mi, Weill M, Knapp LA (2006) Molecular study of Mhc-DRB in wild chacma baboons reveals high variability and evidence for trans-species inheritance. Immunogenetics 58: 805–816.
  16. 16. Bowen L, Aldridge BM, Gulland F, Van Bonn W, DeLong R, et al. (2004) Class II multiformity generated by variable MHC-DRB region configurations in the California sea lion (Zalophus californianus). Immunogenetics 56: 12–27.
  17. 17. Zeng CJ, Pan HJ, Gong SB, Yu JQ, Wan QH, et al. (2007) Giant panda BAC library construction and assembly of a 650-kb contig spanning major histocompatibility complex class II region. BMC Genomics 8: 315.
  18. 18. Becker L, Nieberg C, Jahreis K, Peters E (2009) MHC class II variation in the endangered European mink Mustela lutreola (L.1761)-consequences for species conservation. Immunogenetics 61: 281–288.
  19. 19. Junge RE, Bauman K, King M, Gompper ME (2007) A serologic assessment of exposure to viral pathogens and Leptospira in an urban raccoon (Procyon lotor) population inhabiting a large zoological park. Journal of Zoo and Wildlife Medicine 38: 18–26.
  20. 20. Real LA, Biek R (2007) Spatial dynamics and genetics of infectious disease on heterogeneous landscapes. Journal of the Royal Society Interface 4: 935–948.
  21. 21. Wheeler DC, Waller LA (2008) Mountains, valleys and rivers: the transmission of raccoon rabies over a heterogeneous landscape. Journal of Agricultural, Biological and Environmental Statistics 13: 388–406.
  22. 22. Cullingham CI, Pond BA, Kyle CJ, Rees EE, Rosatte RC, et al. (2008) Combining direct and indirect genetic methods to estimate dispersal for informing wildlife disease management decisions. Molecular Ecology 17: 4874–4886.
  23. 23. Cullingham CI, Kyle CJ, Pond BA, White BN (2008) Genetic structure of raccoons in eastern North America based on mtDNA: implications for subspecies designation and rabies disease dynamics. Canadian Journal of Zoology 86: 947–958.
  24. 24. Helgen KM, Maldonado JE, Wilson DE, Buckner SD (2008) Molecular Confirmation of the Origin and Invasive Status of West Indian Raccoons. Journal of Mammology 89: 282–291.
  25. 25. Kennedy ML, Lindsay SL (1984) Morphologic Variation in the Raccoon, Procyon lotor, and Its Relationship to Genic and Environmental Variation. American Society of Mammologist 65: 195–205.
  26. 26. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599.
  27. 27. Klein J, Bontrop RE, Dawkins RL, Erlich HA, Gyllensten UB, et al. (1990) Nomenclature for the major histocompatibility complexes of different species: a proposal. Immunogenetics 31: 217–219.
  28. 28. Gillett RM (2009) MHC genotypes and reproductive Success in the Northern Atlantic Right Whale (Eubalanea Glacialis) Ph.D. Biology Thesis, Trent University, Peterborough, ON.
  29. 29. Murray BW, White BN (1998) Sequence variation at the major histocompatibility complex DRB loci in beluga (Delphinapterus leucas) and the narwhal (Monodon monoceros). Immunogenetics 48: 242–252.
  30. 30. Oliver MK, Lambin X, Cornulier T, Piertney SB (2009) Spatio-temporal variation in the strength and mode of selection acting on the major histocompatibility complex diversity in water vole (Arvicola terrestris) metapopulations. Molecular Ecology 18: 80–92.
  31. 31. Babik W (2010) Methods for MHC genotyping in non-model vertebrates. Molecular Ecology Resources 10: 237–251.
  32. 32. Alcaide M, Lemus JA, Blanco G, Tella JL, Serrano D, et al. (2010) MHC diversity and differential exposure to pathogens in kestrels (Aves: Falconida). Molecular Ecology 19: 691–705.
  33. 33. Saitoh K, Chen WJ (2008) Reducing cloning artifacts for recovery of allelic sequences by T7 endonuclease I cleavage and single re-extensions of PCR products-A benchmark. Gene 423: 92–95.
  34. 34. Kennedy LJ, Ryvar R, Gaskell RM, Addie DD, Willoughby K, et al. (2002) Sequence analysis of MHC DRB alleles in domestic cats from the United Kingdom. Immunogenetics 54: 348–352.
  35. 35. Breuer L, Baum D (2005) An Introduction to Queueing Theory and Matrix-Analytic Methods. Springer Netherlands.. 271 p.
  36. 36. MacDonald KS, Fowke KR, Kimani J, Dunand VA, Nagelkerke NJ, et al. (2000) Influence of HLA supertypes on susceptibility and resistance to Human Immunodeficiency Virus Type 1 infection. The Journal of Infectious Diseases 181: 1581–1589.
  37. 37. Nei M, Gojobori T (1986) Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and Evolution 3: 418–426.
  38. 38. Brown JH, Jardetzky TS, Gorga JC, Stern LC, Urban RG, et al. (1993) Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature 364: 33–39.
  39. 39. Stern LJ, Brown JH, Jardetzky TS, Gorga JC, Urban RG, et al. (1994) Crystal structure of the human class II MHC protein HLA-DR1 complexed with an influenza virus peptide. Nature 368: 215–221.
  40. 40. Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17: 754–755.
  41. 41. Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574.
  42. 42. Guindon S, Gascuel O (2003) A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Systematic Biology 52: 696–704.
  43. 43. Posada D (2008) jModelTest: Phylogenetic Model Averaging. Molecular Biology and Evolution 25: 1253–1256.
  44. 44. Altschul SF, Madden TL, Schaffer AA, Zang J, Zang Z, et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389–3402.
  45. 45. Yuki N, O'Brien SJ (1997) Nature and origin of polymorphism in feline MHC class II DRA and DRB genes. The Journal of Immunology 158: 2822–2833.
  46. 46. Hughes AL, Nei M (1990) Evolutionary relationships of class II major histocompatibility complex genes in mammals. Molecular Biology and Evolution 7: 491–514.
  47. 47. Hughes AL (1994) The evolution of functionally novel proteins after gene duplications. Proceedings of the Royal Society, Biological Sciences 256: 119–124.
  48. 48. Andersson A, Sigurdardottir S, Borsch C, Gustafsson K (1991) Evolution of MHC polymorphism: Extensive sharing of polymorphic sequence motifs between human and bovine DRB alleles. Immunogenetics 33: 188–193.
  49. 49. Szanto A (2009) Molecular genetics of the raccoon rabies virus. Ph.D. Biology Thesis, Trent University, Peterborough, ON.
  50. 50. Dongxiao S, Yuan Z (2004) Note: Polymorphism of the second exon of MHC-DRB gene in Chinese local sheep and goat. Biochemical Genetics 42: 385–390.
  51. 51. Doherty PC, Zinkernagel RM (1975) Enhanced immunological surveillance in mice heterozygous at the H-2 gene complex. Nature 256: 50–52.
  52. 52. Clarke BC, Kirby DRS (1966) Maintenance of histocompatibility polymorphism. Nature 211: 999–1000.
  53. 53. Biedrzycka A, Radwan J (2008) Population fragmentation and major histocompatibility complex variation in the spotted suslik, Spermophilus suslicus. Molecular Ecology 17: 4801–4811.
  54. 54. Carey AB, McLean RG (1983) The ecology of rabies: Evidence of co-adaptation. Journal of Applied Ecology 20: 777–800.
  55. 55. Jenkins SR, Perry BD, Winkler WG (1988) Ecology and epidemiology of raccoon rabies. Review of Infections Diseases 10: S620–S625.
  56. 56. Childs JE, Curns AT, Dey ME, Real LA, Feinstein L, et al. (2000) Predicting the local dynamics of epizootic rabies among raccoons in the United States. Proceeding of the National Academy of Science USA 97: 13666–13671.