Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Variants in the FFAR1 Gene Are Associated with Beta Cell Function

  • Martins Kalis,

    Affiliation Department of Clinical Sciences, Cellular Autoimmunity Unit, Lund University, Malmö University Hospital, Malmö, Sweden

  • Per Levéen,

    Affiliation Department of Clinical Sciences, Cellular Autoimmunity Unit, Lund University, Malmö University Hospital, Malmö, Sweden

  • Valeriya Lyssenko,

    Affiliation Department of Clinical Sciences, Diabetes and Endocrinology, Lund University, Malmö University Hospital, Malmö, Sweden

  • Peter Almgren,

    Affiliation Department of Clinical Sciences, Diabetes and Endocrinology, Lund University, Malmö University Hospital, Malmö, Sweden

  • Leif Groop,

    Affiliation Department of Clinical Sciences, Diabetes and Endocrinology, Lund University, Malmö University Hospital, Malmö, Sweden

  • Corrado M. Cilio

    To whom correspondence should be addressed. E-mail: corrado.cilio@med.lu.se

    Affiliation Department of Clinical Sciences, Cellular Autoimmunity Unit, Lund University, Malmö University Hospital, Malmö, Sweden

Abstract

Background

The FFAR1 receptor is expressed mainly in pancreatic beta cells and is activated by medium to long chain free fatty acids (FFAs), as well as by thiazolidinediones, resulting in elevated Ca2+ concentrations and promotion of insulin secretion. These properties suggest that FFAR1 could be a mediator of lipotoxicity and a potential candidate gene for Type 2 diabetes (T2D). We therefore investigated whether variations at the FFAR1 locus are associated with T2D and beta cell function.

Methodology/Principal Findings

We re-sequenced the FFAR1 region in 96 subjects (48 healthy and 48 T2D individuals) and found 13 single nucleotide polymorphisms (SNPs) 8 of which were not previously described. Two SNPs located in the upstream region of the FFAR1 gene (rs1978013 and rs1978014) were chosen and genotyped in 1929 patients with T2D and 1405 healthy control subjects. We observed an association of rs1978013 and rs1978014 with insulinogenic index in males (p = 0.024) and females (p = 0.032), respectively. After Bonferroni corrections, no association with T2D was found in the case-control material, however a haplotype consisting of the T-G alleles conferred protection against T2D (p = 0.0010).

Conclusions/Significance

Variation in the FFAR1 gene may contribute to impaired beta cell function in T2D.

Introduction

Deterioration of beta cell function is a hallmark of Type 2 diabetes (T2D) and is considered to contribute to worsening of glucose tolerance with time [1][4]. While the underlying causes are not fully understood, chronic exposure of beta cells to high concentrations of glucose (glucotoxicity) and free fatty acids (FFAs) (lipotoxicicity) have been suggested to induce irreversible changes in islet function [5][7]. The pathways by which glucose enters into beta cells are well described but less is known by which mechanisms elevated FFAs might affect beta cells and their function.

The free fatty acid receptor FFAR1 (GPR40–G protein-coupled receptor 40) is the first gene product identified to act as an extracellular membrane receptor for FFAs. It was recently shown to be activated in pancreatic beta cells in vitro by medium to long chain free fatty acids (FFAs) [8][10] as well as by thiazolidinediones (Rosiglitazone and MCC-555) [9], causing elevated Ca2+ concentrations and subsequent promotion of insulin secretion. FFAR1 is located in the 19q13.1 chromosomal region, which has been linked to T2D [11], [12] and T2D-related phenotypes [4], [13] in several genome wide scans. The open reading frame of the gene encompasses a single exon of 903 bp encoding seven transmembrane domains, characteristic of G protein-coupled receptors (GPCRs) [14]. Studies in rodents and humans have shown that the FFAR1 is expressed mainly in pancreatic beta cells, but also in the brain [8][10]. Mice with overexpression of FFAR1 show impaired beta cell function and develop diabetes, whereas disruption of the gene reduces FFA-stimulated insulin release [15] and, according to Steneberg et al., protects from diabetes [16]. These properties make FFAR1 an interesting candidate for mediating lipotoxicity in beta cells although its role in this process is not fully unravelled. To investigate whether variation in the FFAR1 locus is associated with human T2D, we re-sequenced the FFAR1 gene and tested two of the identified SNPs for association with T2D and beta cell function.

Materials and Methods

Study subjects

To identify SNPs in the FFAR1 region, 48 T2D patients (31 male, 17 females, age 51±6, BMI 25.4±1.7) and 48 healthy glucose-tolerant control subjects (20 males, 28 females, age 62±7, BMI 23.2±2.1) from the Botnia study [17] were selected for initial sequence analysis.

The case-control material genotyped consisted of 1929 patients with T2D and 1405 control subjects from Finland and Sweden (Table 1). In addition, we studied whether SNPs in the FFAR1 gene influenced insulin secretion and FFA levels measured during oral glucose tolerance test (OGTT) in 1011 non-diabetic individuals participating in the Botnia study (Table 1) [17]. Study subjects were unrelated except 354 sibling pairs (each pair from different family) included in the cohort of 1011 healthy individuals.

thumbnail
Table 1. Clinical characteristics of patient samples

https://doi.org/10.1371/journal.pone.0001090.t001

Diagnosis of T2D was based according to WHO criteria [18], GADA negative status and age at onset >35 years (except for three individuals which were below 35 years). Weight, height, plasma glucose, plasma insulin, triglicerides, total cholesterol, HDL cholesterol and blood pressure were measured and oral glucose tolerance test (OGTT) performed as described by Groop et al. [17]; plasma FFA levels were determined using an enzymatic colorimetric method (NEFAC ACS-ACOD Method, Wako Chemicals, Richmond, VA). Haemoglobin A1c (HbA1c) was measured by high-pressure liquid chromatography with a normal range of 4–6% (Diamat Analyzer, Biorad Laboratories, Germany). Body mass index (BMI) was calculated as weight (in kilograms) divided by height (in meters) squared. Insulinogenic index (Δ Insulin 30 min-fasting/Glucose 30 min) and homeostasis model assessment index (HOMA) [19] was used to describe insulin secretion and insulin resistance, respectively. All subjects gave their informed consent at the time of entering to the study, which was approved by local ethics committees at Helsinki and Lund Universities.

Sequencing of FFAR1

A 2379 bp long DNA including the 903 bp of the coding region in the FFAR1 gene was re-sequenced. Reference sequence was taken from the NCBI database (http://www.ncbi.nlm.nih.gov)[20]. In order to sequence the FFAR1 region, four primer pairs of overlapping PCR products were designed using program Primer Premier 5.0 (Premier Biosoft International). Standard protocols for PCR were as follows (5′-3′ sequences of forward and reverse primers, product size, annealing temperature): 1) CTCCCCTTCCGGCTCACT, CTCTCCACCATGTCACCTCTTA, 566 bp, 50°C; 2) CAGGAGTCAAACTCCCATTCC, AGGTGTTGCTGTGGTCCAG, 901 bp, 62°C (designed by MRC Geneservice, Cambridge, UK); 3) TTGGGCTACCAAGCCTTC, CTGCAGTTCCTCCGAAGC, 658 bp, 60°C; 4) GTGACCGGTTACTTGGGAAG, CTTTGGGGGAGTCAAAGTCAT, 752 bp, 62°C. PCR reactions were performed on GeneAmp PCR System 9700 (Perkin Elmer).

Sequencing reactions were performed using BigDye v3.1 kit (Applied Biosystems) on GeneAmp PCR System 9700 according to manufacturers protocol. Sequencing products were purified with DyeEx 96 kit (QIAGEN) and run on ABI Prism 3730 Genetic Analyzer (Applied Biosystems). Sequencing data were analyzed with program Sequencher 3.1.2 (Gene Codes Corporation, Ann Arbor, MI, USA).

Selected SNPs were genotyped using the SNaPshot assay on an ABI 3100 DNA sequencer (Applied Biosystems) according to the manufacturer′s protocol.

Genotyping

PCR fragment for the multiplex SNP genotyping of FFAR1 polymorphisms rs1978013 and rs1978014 with SNaPshot assay was amplified in 20 µl reaction volume at an annealing temperature of 55°C, primers (5′-3′): CTCCCCTTCCGGCTCACT and CTCTCCACCATGTCACCTCTTA. PCR products were treated with Shrimp Alkaline Phosphatase (SAP) (USB Corporation) and Exonuclease I (New England Biolabs). Extension primer sequence (5′-3′) for rs1978013 was ACCGTGACATGGATGGGGCC and for rs1978014–AACTGGGGAGAGCCCAAGGGTCAGC, where the underlined nucleotides indicate an unspecific primer tail included in order to produce differently sized products. The minisequencing reaction was performed on GeneAmp PCR System 9700 according to manufacturer's protocol. After SAP/Exonuclease I treatment, samples where run on ABI Prism 3100 Genetic Analyzer and data analyzed using the GeneMapper 3.1 software (Applied Biosystems).

Statistical and bioinformatic analysis

Linkage disequilibrium (LD) calculations and haplotype analysis were carried out using Haploview 3.32 software (http://www.broad.mit.edu/mpg/haploview/)[21], [22]. For haplotype reconstruction and subsequent analysis of metabolic parameters, we used HAP haplotype analysis system available online at http://research.calit2.net/hap [23], [24]. Power calculations were performed online using Genetic Power Calculator (http://ibgwww.colorado.edu/pshaun/gpc)[25], [26]. Chi-squared test was used to compare the general genotype frequency distribution among T2D and control groups. Odds ratios were calculated using logistic regression analysis with age, BMI and sex as covariates. Mantel-Haenszel test was used to test for heterogeneity between the Swedish and Finnish samples. Differences in insulinogenic index and FFA levels between different genotype carriers were assessed using either ANOVA (for equal weight of genotypes) or linear regression analysis with age, BMI and sex as covariates. A robust variance estimator was used to adjust for the possible non-independence due to family clustering. Correlation between insulin secretion and FFA levels was analysed using multivariate regression correlation matrix (NCSS software). The standard errors were adjusted for repeated measurements made on the same individual by methods of GEE methodology. A p value of <0.05 was considered statistically significant. Bonferroni adjustments for multiple measurements were done were appropriate: p-values were corrected by four in the case-control study (two SNPs tested, stratified by sex), by eight in the phenotype analysis (two SNPs tested for insulinogenic index and post-OGTT FFA levels, stratified by sex) and by eight in the phenotype analysis in haplotypes (four haplotypes tested for insulinogenic index and post-OGTT FFA levels). We chose the additive model as the main hypothesis because it is the model that corresponds better to the putative biological function of FFAR1 receptor [27][29]. Therefore p values were not corrected for other genetic models explored (equal weight, recessive and dominant). To correct for multiple testing in the haplotype analysis, 10000 permutations were done using the Haploview software. The 5′ upstream region of the FFAR1 gene was analysed for putative regulatory elements using the MatInspector program (http://www.genomatix.de/products/MatInspector/) [30], [31].

Results

We first re-sequenced a 2379 bp fragment of the FFAR1 region in a screening panel of 96 subjects (48 T2D and 48 healthy subjects). We identified 13 SNPs and two of these polymorphisms where located in the coding region of the gene, including one synonymous (Val) and one non-synonymous (Arg/His, rs2301151) polymorphism. Five of the SNPs (rs1978013, rs1978014, rs10418569, rs2301151 and rs1573611) were previously registered in the NCBI database [20], whereas eight SNPs are new (Figure S1).

There was no clear linkage disequilibrium between the 13 SNPs (Figure S2). The minor allele frequencies (MAF) of the eight newly discovered SNPs were less then 0.02, the other five SNPs had MAF 0.10–0.48.

Of them, only the frequencies of the two SNPs at positions 598 and 597 bp upstream of the open reading frame (rs1978013 and rs1978014; Figure S1) differed between the T2D and control subjects in the screening panel (rs1978013: 13 TT, 25 TC and 10 CC in T2D vs. 15 TT, 31 TC and 2 CC in controls, p = 0.047 and for rs1978014: 4 AA, 4 AG and 9 GG in T2D patients with BMI<30 vs. 12 AA, 20 AG and 7 GG in control individuals with BMI<30, p = 0.024). These two SNPs were then further tested for association with T2D in a case-control material from Finland and Sweden consisting of 1929 patients with T2D and 1405 control subjects. All genotypes were in Hardy-Weinberg equilibrium, both in cases and in controls.

The Tagger algorithm [32] of the Haploview software showed that with r2 threshold of 0.3 rs1978013 captures rs10418569 (D' 0.94, r2 0.33) and rs1573611 (D' 0.89, r2 0.31), whereas rs1978014 captures rs10418569 (D' 1, r2 0.28) and rs2301151 (D' 1, r2 0.12) at r2 threshold 0.1 (Figure S2).

The bioinformatic analysis revealed three potential transcription factor-binding sites in the vicinity of rs1978013 and rs1978014–ATF6 (located −16 to −10 bp or −17 to −11 bp upstream of rs1978013 and rs1978014, respectively), INSM1 (−11 to −3 bp/−12 to −4 bp) and NF-kappaB (+24 to +33 bp/+23 to +32 bp downstream).

There was more than 80% power assuming an additive model to detect an OR of 1.32 (p = 0.05) in the case-control material. However, after Bonferroni correction, no odds ratio was significantly associated with T2D. SNP rs1978014 had an OR 1.26 (95% CI 1.00–1.61) for association with T2D (uncorrected p = 0.049, corr. p = 0.196, Table 2), while CC genotype of rs1978013 was more frequent in T2D group only in males (T2D 17.9%, controls 15.5%, OR 1.49, 95% CI 1.07–2.07, uncorr. p = 0.019, corr. p = 0.076; Table S1).

thumbnail
Table 2. Genotype frequencies and odds ratios of the rs1978013 and rs1978014

https://doi.org/10.1371/journal.pone.0001090.t002

Haplotype analysis revealed that a haplotype consisting of the T-G alleles (permutated p = 0.001) of SNPs rs1978013 and rs1978014 conferred protection whereas the C-A haplotype conferred increased risk (permutated p = 0.0486) of T2D (Table 3).

Post-OGTT FFA concentration did not significantly differ between different genotype carriers after Bonferroni corrections (Table 4, Table S2). Post-OGTT FFA concentration was lower in the CC/CT carriers (223±95 mmol/l) vs. the TT genotype (244±148 mmol/l) of rs1978013 (uncorr. p = 0.010, corr. p = 0.08, Table 4). After stratification for sex, post-OGTT FFA levels of rs1978013 were lower in males (TT = 268±189, TC = 239±96, CC = 215±102 mmol/l, uncorr. p = 0.012, corr. p = 0.096, Table S2). In addition, the T-G haplotype showed association with post-OGTT FFA levels which disappeared after Bonferroni correction (T-G 231±120 vs C-A 225±98, T-A 244±139, C-G 210±89 mmol/l, uncorr. p = 0.021, corr. p = 0.168, Table 5).

The rs1978013 was associated with insulinogenic index only in males (TT = 6.2±3.8, TC+CC = 5.3±3.4, uncorr. p = 0.003, corr. p = 0.024) while rs1978014 was associated with insulinogenic index only in females (GG+AG = 6.4±4.7, AA = 5.2±2.9, uncorr. p = 0.004, corr. p = 0.032; Table S2). In the whole sample, insulinogenic index was associated neither with genotypes (Table 4) nor haplotypes (Table 5) after Bonferroni corrections were done. Insulin secretion was lower in C allele carriers of rs1978013 (TT = 6.3±4.3, TC+CC = 5.6±3.8, uncorr. p = 0.010, corr. p = 0.08) and for AA genotype in rs1978014 (GG+AG = 6±4.2, AA = 5.3±3.2, uncorr. p = 0.030, corr. p = 0.24) (Table 4). The C-A haplotype had the lowest insulinogenic index (C-A 5.5±3.7 vs T-G 6.1±4.3, T-A 6±3.9, C-G 5.8±3.8, uncorr. p = 0.008, corr. p = 0.064, Table 5).

thumbnail
Table 4. Insulinogenic index and post-OGTT FFA levels in different genotype carriers

https://doi.org/10.1371/journal.pone.0001090.t004

thumbnail
Table 5. Insulinogenic index and post-OGTT FFA levels in rs1978013-rs1978014 haplotypes

https://doi.org/10.1371/journal.pone.0001090.t005

Discussion

The key finding of the present study was that rs1978013 and rs1978014 polymorphisms located upstream of the coding region of the FFAR1 gene were associated with beta cell function in males and females respectively, however, due to the loss of statistical significance during Bonferroni corrections–not in the whole sample. Carriers of the CC genotype of rs1978013 had the lowest insulinogenic index and highest risk of T2D (although not significant after Bonferroni correction) but rs1978014 associates with T2D according to chi2 test. Increased T2D risk was discovered in the C-A haplotype carriers of SNPs rs1978013 and rs1978014.

The different association between the two polymorphisms in the FFAR1 gene and insulin secretion in males and females might suggest that these polymorphisms may affect insulin sensitivity in a sex-specific manner in accordance with the finding of Hevener et al. showing that female rats are protected from lipid-induced reductions in insulin action [33]. We therefore tested this hypothesis by performing gender-specfic analyses of the putative effect of these SNPs on insulin sensitivity (HOMA). There was no association between HOMA and these polymorphisms, neither in the whole cohort nor after stratification for sex (data not shown). Correlation between HOMA and post-OGTT FFA level was also very weak (males: r2 = 0.17, p = 0.0002, females: r2 = 0.20, p = 0). This indicates that sex-specific differences in insulin sensitivity did not influence our results.

Although close to each other, rs1978013 and rs1978014 did not show any LD. This could possibly be explained by a recombination hot spot in this particular gene region. However, rs1978013 and rs1978014 captured the other common polymorphisms in the sequenced DNA region according to D' (Figure S2) at a low r2 threshold 0.1–0.3. In addition to association with T2D in the initial screening panel, lack of LD between the two neighbouring SNPs made these very close nucleotide positions of particular biological interest. The findings rather suggested that both SNPs, rs1978013 and rs1978014, together formed a haplotype, which increased risk of T2D.

FFAR1 was recently described as a cell-surface bound receptor for FFAs making it a candidate to mediate the negative effects of FFAs on beta cell function (lipotoxicity) [8][10]. However, two recent studies did not find an association between variations in the FFAR1 coding region and the risk of developing T2D [34], [35]. Despite the lack of an association with T2D, Ogawa et al. found that the Arg211His polymorphism (rs2301151) in the coding region of FFAR1 influenced serum insulin levels in 327 healthy Japanese males [34]. Although this polymorphism is in LD with rs1978013 and rs1978014 according to D' = 1, however the r2 is low (0.08 for rs1978013 and 0.12 for rs1978014) (Figure S2) suggesting an independent association of these two SNPs with insulin secretion.

We have also analysed whether any SNPs in the recent whole genome association study [36] would cover the FFAR1 gene. Unfortunately this region was not covered by any informative SNPs on the Affymetrix chip. The 19q13 chromosomal region where FFAR1 is situated has shown linkage with T2D as well as T2D and lipid-related phenotypes [11], [37][40]. However, we can only speculate whether the linkage could be attributed to FFAR1 since the density of markers used in those studies is not high enough (approximate interval 7–13 cM) to pinpoint FFAR1 gene as a strong candidate for the reported linkage.

Little is known about the promoter structure and transcription factor binding sites of the FFAR1 gene. FFAR1 lacks a canonical TATA box, consistent with reports of other TATA-less G protein-coupled receptors [41], [42]. The rs1978013 and rs1978014 polymorphisms apparently do not directly affect any potential transcription factor-binding motif. However, by sequence analysis, we identified three potential binding motifs for transcription factors which could be implicated in T2D development or beta cell function–ATF6 [43], INSM1 [44] and NF-kappaB [45] in close vicinity to rs1978013 and rs1978014. We can therefore not exclude the possibility that polymorphisms in the rs1978013 and rs1978014 might affect FFAR1 expression by altering transcription or they might be in linkage disequilibrium with another polymorphism affecting FFAR1 expression or function. Recently, Tomita et al. reported that insulinogenic index positively correlated with the FFAR1 mRNA level in human pancreatic islets [46], however, whether variations in the FFAR1 gene induce up- or down regulation of gene expression remains unknown. Identification of regulatory region and subsequent functional studies are necessary to understand the hypothetical effect of rs1978013 and rs1978014 variants on FFAR1 expression levels.

In summary, our study suggests an effect of polymorphisms in the FFAR1 gene on insulin secretion during an OGTT thereby making it a potential candidate to mediate lipotoxicicty in T2D.

Supporting Information

Figure S1.

The sequenced region with the detected SNP positions. A 2379 bp long DNA sequence including the 903 bp of the coding region (underlined) in the FFAR1. Five SNPs (framed-rs1978013, rs1978014, rs10418569, rs2301151 and rs1573611) were registered in the NCBI database before, whereas eight (highlited) were not. The rs1978013 and rs1978014 SNPs are located at position 208 and 209, respectively.

https://doi.org/10.1371/journal.pone.0001090.s001

(0.06 MB TIF)

Figure S2.

LD structure of the sequenced FFAR1 region. SNPs are numbered according to their position in the sequenced region, nucleotide position 208 and 209 correspond to rs1978013 and rs1978014, respectively, and positions 592, 1437 and 2059-to rs10418569, rs2301151 (Arg211His) and rs1573611, respectively.

https://doi.org/10.1371/journal.pone.0001090.s002

(0.94 MB TIF)

Table S1.

Sex-specific genotype frequencies and odds ratios of the rs1978013. Logistic regression results are adjusted for age, sex, BMI and family dependence. Both nominal and the Bonferroni-corrected p-values are shown. NS: not significant.

https://doi.org/10.1371/journal.pone.0001090.s003

(0.04 MB DOC)

Table S2.

Insulinogenic index and post-OGTT FFA levels in different genotype carriers stratified for sex. Males: n = 475, females: n = 536. Data are mean±SD. Asterisk (*) indicates results from linear regression analysis, adjusted for age, BMI and family dependence. Both nominal and the Bonferroni-corrected p-values are shown. NS: not significant.

https://doi.org/10.1371/journal.pone.0001090.s004

(0.05 MB DOC)

Acknowledgments

We thank Johan Holmkvist, Marketa Sjögren, Margareta Svensson, Anna Berglund, Nael Shaat and Hemang Parikh for support and technical help, Holger Luthman, Björn Olde and Christer Owman for valuable discussions and suggestions and the SWEGENE Profiling Polygenic Disease facility for the possibility to use the ABI Prism 3730 genetic analyser.

Author Contributions

Conceived and designed the experiments: LG CC MK PL. Performed the experiments: MK PL. Analyzed the data: VL PA MK. Contributed reagents/materials/analysis tools: LG CC. Wrote the paper: LG CC MK PL.

References

  1. 1. Groop L (2000) Pathogenesis of type 2 diabetes: the relative contribution of insulin resistance and impaired insulin secretion. Int J Clin Pract Suppl3–13.
  2. 2. LeRoith D (2002) Beta-cell dysfunction and insulin resistance in type 2 diabetes: role of metabolic and genetic abnormalities. Am J Med 113: Suppl 6A3S–11S.
  3. 3. Del Prato S, Marchetti P (2004) Beta- and alpha-cell dysfunction in type 2 diabetes. Horm Metab Res 36: 775–781.
  4. 4. Ahren B (2005) Type 2 diabetes, insulin secretion and beta-cell mass. Curr Mol Med 5: 275–286.
  5. 5. Manco M, Calvani M, Mingrone G (2004) Effects of dietary fatty acids on insulin sensitivity and secretion. Diabetes Obes Metab 6: 402–413.
  6. 6. Steppel JH, Horton ES (2004) Beta-cell failure in the pathogenesis of type 2 diabetes mellitus. Curr Diab Rep 4: 169–175.
  7. 7. Robertson RP, Harmon J, Tran PO, Poitout V (2004) Beta-cell glucose toxicity, lipotoxicity, and chronic oxidative stress in type 2 diabetes. Diabetes 53: Suppl 1S119–124.
  8. 8. Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, et al. (2003) Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40. Nature 422: 173–176.
  9. 9. Kotarsky K, Nilsson NE, Flodgren E, Owman C, Olde B (2003) A human cell surface receptor activated by free fatty acids and thiazolidinedione drugs. Biochem Biophys Res Commun 301: 406–410.
  10. 10. Briscoe CP, Tadayyon M, Andrews JL, Benson WG, Chambers JK, et al. (2003) The orphan G protein-coupled receptor GPR40 is activated by medium and long chain fatty acids. J Biol Chem 278: 11303–11311.
  11. 11. van Tilburg JH, Sandkuijl LA, Strengman E, van Someren H, Rigters-Aris CA, et al. (2003) A genome-wide scan in type 2 diabetes mellitus provides independent replication of a susceptibility locus on 18p11 and suggests the existence of novel Loci on 2q12 and 19q13. J Clin Endocrinol Metab 88: 2223–2230.
  12. 12. Mori Y, Otabe S, Dina C, Yasuda K, Populaire C, et al. (2002) Genome-wide search for type 2 diabetes in Japanese affected sib-pairs confirms susceptibility genes on 3q, 15q, and 20q and identifies two new candidate Loci on 7p and 11p. Diabetes 51: 1247–1255.
  13. 13. Panhuysen CI, Cupples LA, Wilson PW, Herbert AG, Myers RH, et al. (2003) A genome scan for loci linked to quantitative insulin traits in persons without diabetes: the Framingham Offspring Study. Diabetologia 46: 579–587.
  14. 14. Sawzdargo M, George SR, Nguyen T, Xu S, Kolakowski LF, et al. (1997) A cluster of four novel human G protein-coupled receptor genes occurring in close proximity to CD22 gene on chromosome 19q13.1. Biochem Biophys Res Commun 239: 543–547.
  15. 15. Latour MG, Alquier T, Oseid E, Tremblay C, Jetton TL, et al. (2007) GPR40 is necessary but not sufficient for fatty acid stimulation of insulin secretion in vivo. Diabetes 56: 1087–1094.
  16. 16. Steneberg P, Rubins N, Bartoov-Shifman R, Walker MD, Edlund H (2005) The FFA receptor GPR40 links hyperinsulinemia, hepatic steatosis, and impaired glucose homeostasis in mouse. Cell Metab 1: 245–258.
  17. 17. Groop L, Forsblom C, Lehtovirta M, Tuomi T, Karanko S, et al. (1996) Metabolic consequences of a family history of NIDDM (the Botnia study): evidence for sex-specific parental effects. Diabetes 45: 1585–1593.
  18. 18. Alberti KG, Zimmet PZ (1998) Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 15: 539–553.
  19. 19. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, et al. (1985) Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28: 412–419.
  20. 20. National Center for Biotechnology Information (2007) NCBI. Available from http://www.ncbi.nlm.nih.gov, accessed 19 January, 2007.
  21. 21. Daly Lab at the Whitehead Institute, Cambridge, USA (2007) Haploview. Available from http://www.broad.mit.edu/mpg/haploview/, accessed 15 April, 2007.
  22. 22. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21: 263–265.
  23. 23. Eskin E, Halperin E (2006) HAP haplotype analysis system. Available from http://research.calit2.net/hap, accessed 19 January, 2007.
  24. 24. Halperin E, Eskin E (2004) Haplotype reconstruction from genotype data using Imperfect Phylogeny. Bioinformatics 20: 1842–1849.
  25. 25. Purcell S, Sham P (2003) Genetic Power Calculator. Available from http://ibgwww.colorado.edu/pshaun/gpc, accessed 19 January, 2007.
  26. 26. Purcell S, Cherny SS, Sham PC (2003) Genetic Power Calculator: design of linkage and association genetic mapping studies of complex traits. Bioinformatics 19: 149–150.
  27. 27. Itoh Y, Hinuma S (2005) GPR40, a free fatty acid receptor on pancreatic beta cells, regulates insulin secretion. Hepatol Res 33: 171–173.
  28. 28. Jachez B, Montecino-Rodriguez E, Fonteneau P, Loor F (1988) Partial expression of the lpr locus in the heterozygous state: presence of autoantibodies. Immunology 64: 31–36.
  29. 29. Hawkins RK, Jansen HG, Sanyal S (1985) Development and degeneration of retina in rds mutant mice: photoreceptor abnormalities in the heterozygotes. Exp Eye Res 41: 701–720.
  30. 30. Genomatix, Munich, Germany (2007) MatInspector. Available from http://www.genomatix.de/products/MatInspector/, accessed 15 April, 2007.
  31. 31. Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, et al. (2005) MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21: 2933–2942.
  32. 32. de Bakker PI, Yelensky R, Pe'er I, Gabriel SB, Daly MJ, et al. (2005) Efficiency and power in genetic association studies. Nat Genet 37: 1217–1223.
  33. 33. Hevener A, Reichart D, Janez A, Olefsky J (2002) Female rats do not exhibit free fatty acid-induced insulin resistance. Diabetes 51: 1907–1912.
  34. 34. Ogawa T, Hirose H, Miyashita K, Saito I, Saruta T (2005) GPR40 gene Arg211His polymorphism may contribute to the variation of insulin secretory capacity in Japanese men. Metabolism 54: 296–299.
  35. 35. Hamid YH, Vissing H, Holst B, Urhammer SA, Pyke C, et al. (2005) Studies of relationships between variation of the human G protein-coupled receptor 40 Gene and Type 2 diabetes and insulin release. Diabet Med 22: 74–80.
  36. 36. Saxena R, Voight BF, Lyssenko V, Burtt NP, de Bakker PI, et al. (2007) Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. Science 316: 1331–1336.
  37. 37. Malhotra A, Elbein SC, Ng MC, Duggirala R, Arya R, et al. (2007) Meta-analysis of genome-wide linkage studies of quantitative lipid traits in families ascertained for type 2 diabetes. Diabetes 56: 890–896.
  38. 38. An P, Freedman BI, Hanis CL, Chen YD, Weder AB, et al. (2005) Genome-wide linkage scans for fasting glucose, insulin, and insulin resistance in the National Heart, Lung, and Blood Institute Family Blood Pressure Program: evidence of linkages to chromosome 7q36 and 19q13 from meta-analysis. Diabetes 54: 909–914.
  39. 39. Guo YF, Shen H, Liu YJ, Wang W, Xiong DH, et al. (2006) Assessment of genetic linkage and parent-of-origin effects on obesity. J Clin Endocrinol Metab 91: 4001–4005.
  40. 40. Elbein SC, Hasstedt SJ (2002) Quantitative trait linkage analysis of lipid-related traits in familial type 2 diabetes: evidence for linkage of triglyceride levels to chromosome 19q. Diabetes 51: 528–535.
  41. 41. Lankat-Buttgereit B, Goke B (1997) Cloning and characterization of the 5′ flanking sequences (promoter region) of the human GLP-1 receptor gene. Peptides 18: 617–624.
  42. 42. Svoboda M, Portois L, Malaisse WJ (1999) Glucose regulation of the expression of the glucagon receptor gene. Mol Genet Metab 68: 258–267.
  43. 43. Chu WS, Das SK, Wang H, Chan JC, Deloukas P, et al. (2007) Activating transcription factor 6 (ATF6) sequence polymorphisms in type 2 diabetes and pre-diabetic traits. Diabetes 56: 856–862.
  44. 44. Gierl MS, Karoulias N, Wende H, Strehle M, Birchmeier C (2006) The zinc-finger factor Insm1 (IA-1) is essential for the development of pancreatic beta cells and intestinal endocrine cells. Genes Dev 20: 2465–2478.
  45. 45. Ho E, Bray TM (1999) Antioxidants, NFkappaB activation, and diabetogenesis. Proc Soc Exp Biol Med 222: 205–213.
  46. 46. Tomita T, Masuzaki H, Iwakura H, Fujikura J, Noguchi M, et al. (2006) Expression of the gene for a membrane-bound fatty acid receptor in the pancreas and islet cell tumours in humans: evidence for GPR40 expression in pancreatic beta cells and implications for insulin secretion. Diabetologia.