Therapeutic effects of skin repair plus ointment on molecular and morphological changes in burn wounds: A rat model

Foad Alzoughool; Mohammad Borhan Al-Zghoul; Wael Hananeh; Manar Atoum; Reman Alnemrat; Mohammad Alzghool; Ahmad M. Al-Bashaireh; Yousef Aljawarneh; Mohamad Mayyas

doi:10.1371/journal.pone.0338305

Peer Review History

Original SubmissionJune 28, 2025
10 Aug 2025 Decision Letter - Naveed Ahmed, Editor Dear Dr. Alzoughool, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Sep 21 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols . We look forward to receiving your revised manuscript. Kind regards, Naveed Ahmed, Ph.D Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf . 2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. The American Journal Experts (AJE) (https://www.aje.com/) is one such service that has extensive experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. Please note that having the manuscript copyedited by AJE or any other editing services does not guarantee selection for peer review or acceptance for publication. Upon resubmission, please provide the following: The name of the colleague or the details of the professional service that edited your manuscript A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a supporting information file) A clean copy of the edited manuscript (uploaded as the new manuscript file)” 3. Thank you for stating the following financial disclosure: [Funding was obtained from Hashemite University/Deanship of research, fund No. 29/2020]. Please state what role the funders took in the study. If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."" If this statement is not correct you must amend it as needed. Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf. 4. We note that your Data Availability Statement is currently as follows: [All relevant data are within the manuscript and its Supporting Information files.] Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission. PLOS defines the minimal data set to consist of the data required to replicate all study findings reported in the article, as well as related metadata and methods (https://journals.plos.org/plosone/s/data-availability#loc-minimal-data-set-definition). For example, authors should submit the following data: - The values behind the means, standard deviations and other measures reported; - The values used to build graphs; - The points extracted from images for analysis. Authors do not need to submit their entire data set if only a portion of the data was used in the reported study. If your submission does not contain these data, please either upload them as Supporting Information files or deposit them to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories. If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If data are owned by a third party, please indicate how others may request data access. 5. When completing the data availability statement of the submission form, you indicated that you will make your data available on acceptance. We strongly recommend all authors decide on a data sharing plan before acceptance, as the process can be lengthy and hold up publication timelines. Please note that, though access restrictions are acceptable now, your entire data will need to be made freely accessible if your manuscript is accepted for publication. This policy applies to all data except where public deposition would breach compliance with the protocol approved by your research ethics board. If you are unable to adhere to our open data policy, please kindly revise your statement to explain your reasoning and we will seek the editor's input on an exemption. Please be assured that, once you have provided your new statement, the assessment of your exemption will not hold up the peer review process. 6. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical. Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? Reviewer #1: Partly Reviewer #2: Partly ******** 2. Has the statistical analysis been performed appropriately and rigorously? -->?> Reviewer #1: No Reviewer #2: No ****** 3. Have the authors made all data underlying the findings in their manuscript fully available??> The PLOS Data policy Reviewer #1: Yes Reviewer #2: No ****** 4. Is the manuscript presented in an intelligible fashion and written in standard English??> Reviewer #1: Yes Reviewer #2: Yes ****** Reviewer #1: Thank you for the opportunity to review this interesting and relevant manuscript evaluating the effects of Skin Repair Plus Ointment (Remanco) on burn wound healing in a rat model. General Assessment: The manuscript explores a culturally significant topical agent using molecular, histological, and gross wound analysis. The integration of RT-PCR data with morphological healing assessment adds value. However, several methodological and interpretive limitations need to be addressed before the manuscript can be considered for publication. Major Comments: 1. Statistical Power and Interpretation: The sample size per time point (n = 3) is too small to draw statistically reliable conclusions. Please conduct a power analysis or justify the sample size used. Many outcome measures (wound area, histology scores) did not reach statistical significance. These non-significant findings must be more clearly acknowledged in the discussion to avoid overstating therapeutic benefit. Post-hoc comparisons and effect sizes should be included where appropriate. 2. Gene Expression Analysis: While increases in TGF-β and IGF-1 were statistically significant, the manuscript infers therapeutic efficacy from fold-changes in other genes that were not statistically supported. These trends should be presented cautiously. Consider adding protein-level validation (e.g., ELISA or Western blot) to confirm mRNA findings. 3. Histopathological Evaluation: The scoring system is appropriate, but inter-rater reliability or blinding of evaluators should be addressed. Were all histological assessments conducted blindly? 4. Data Presentation: Include summary tables/graphs that better illustrate wound area reduction over time. This would support visual comparisons in Figure 1. 5. Discussion and Claims: The claim of improved "cosmetic appearance" and hair regrowth should be supported with objective measures or removed. The manuscript should frame Remanco as a promising traditional formulation requiring further investigation, rather than as an established therapeutic. Minor Comments: Ensure all figure legends and axes are labeled clearly. Consider citing comparative studies using silver sulfadiazine in similar rat models to better contextualize your results. Conclusion: This study presents a valuable attempt to validate a traditional topical agent using scientific methods. With improved statistical rigor, clearer discussion of limitations, and refined conclusions, the manuscript has the potential to make a meaningful contribution to the field of wound healing research. Reviewer #2: REVIEWER COMMENTS Manuscript Title: Therapeutic Effects of Skin Repair Plus Ointment on Molecular and Morphological Changes in Burn Wounds: A Rat Model General Evaluation The authors present an in vivo study evaluating the effectiveness of a traditional Jordanian herbal ointment (Remanco) in a rat model of second-degree burn injury. They combine gross morphology, histopathological analysis, and molecular profiling using RT-PCR to provide a well-rounded assessment of wound healing results. The manuscript focuses on an essential topic in wound healing and ethnopharmacology, especially in validating traditional remedies through scientific methods. However, even though the experimental design is solid and the study shows promise, several issues need to be addressed before considering it for publication. Strengths of the Study Clear Objective: Using a controlled experimental model, the study evaluates the traditional "Remanco" cream. This adds scientific evidence to a traditional remedy. The comprehensive approach combines gross morphology, histopathology, and molecular markers (RT-PCR). The inclusion of negative (saline) and positive (1% silver sulfadiazine) controls in the animal model experiments strengthens the comparative interpretation. The methodology, such as the use of burn model, sample size, ethical approval, and analysis tools (e.g., ImageJ, RT-PCR), is well documented. The gene expression analysis, measuring TGF-β, IGF-1, PDGFs, FGF, and VEGF, adds a deeper understanding of the mechanisms. Major Concerns Lack of Statistical Significance in Key Outcomes Despite the thorough methodology, many comparisons, particularly histopathological scores and wound area reduction, did not show statistical significance. The data does not conclusively support the conclusion that Remanco is better than 1% silver sulfadiazine. There is a clear lack of recent literature citations. Adding current references would strengthen the scientific basis and show the study's relevance today (at least 5 years back). Incomplete Molecular Validation Only TGF-β and IGF-1 showed significant changes in gene expression. Other growth factors showed trends but lacked statistical support. Please show the reference of the primer used. I suggest that the authors describe more about the active compounds in Remanco, so that a discussion on the probable mechanism of wound healing gene expressions can be discussed clearly. Animal experiment A total of 30 animals per group is used for the experiments. How many are sacrificed each day? Justification for collecting samples/data on days 3, 6, 9, 12, 15, 18, 21, 24, 27, and 30 is not clearly stated. Please standardize the days for data collection: Figure 1 (days 3, 6, 9, 15, 21, and 30), Figure 2 (days 3, 6, 9, 12, 15, 18, 21, 24, and 30), and Table 2 (days 3, 6, 9, 12, 15, 18, 21, 24, and 30). My suggestion for Table 3 (days 3, 15, and 24) is that it should be represented as a graph for easy comparison. Missing Visual Data Figure 1 (wound healing progression) and Figure 2 (gene expression graphs) are either missing or poorly presented in the manuscript. Table 2 is best represented as a graph (line graph) to compare the progression of wound closure. The data can be put as supporting data. Please indicate how many samples are used; n = number of samples measured. For Table 3, no histological figures are used to prove the data for histological assessment, and please also indicate the number of samples and pictures used for this analysis. Please include all figures with proper legends, scale bars, and statistical annotations. Histopathological Data Presentation Although the scoring criteria are clearly described, no representative histological images are included for Table 3 results. Please add high-resolution images of stained tissue sections to support the scoring and show the healing phases, such as re-epithelialization and angiogenesis. Overinterpretation of Findings The discussion often overstates the effectiveness of Remanco, despite the mostly non-significant results. Please reframe conclusions to reflect the preliminary nature of the findings and highlight the need for further validation. Phytochemical Characterization The composition of Remanco cream is described, but no phytochemical profiling is provided. If this product is commercially available, please also list the active compound present in the content so the authors can relate to the healing effect provided by this ointment. Please include a fundamental chemical analysis to ensure reproducibility and support discussions of the mechanisms involved. Minor Comments Revise grammar and phrasing for clarity and simplicity throughout the manuscript. A diagram summarizing the study design would help readers understand the experimental workflow. Include a proper graphical abstract or image summary if possible. Recommendation Decision: Major Revision Required This study holds value and tackles an important issue in natural product research for burn healing. However, revisions are needed to improve the scientific quality, data presentation, and balance in interpretation before the manuscript can be deemed suitable for publication. ****** what does this mean? ). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy Reviewer #1: Yes: Abdulrahman Almalki Reviewer #2: No ******** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step. https://doi.org/10.1371/journal.pone.0338305.r001
Revision 1
12 Nov 2025 Author Response Dear Academic Editor and Reviewers, We would like to sincerely thank you for the valuable time and effort you have devoted to reviewing our manuscript entitled “Therapeutic Effects of Skin Repair Plus Ointment on Molecular and Morphological Changes in Burn Wounds: A Rat Model” (PONE-D-25-31940). We deeply appreciate the constructive feedback, which has greatly helped us to improve the quality and clarity of our work. Below, we provide a point-by-point response to each of the comments raised by the reviewers and the editor. * Editorial requirements: We have carefully addressed all editorial requirements, as detailed below: 1. PLOS ONE style requirements We have revised the manuscript to fully conform with PLOS ONE formatting guidelines, including file naming conventions, as per the provided templates. 2. Copyediting of the manuscript The manuscript has been thoroughly copyedited for grammar, spelling, and clarity by Professor Mustafa Ababneh (Professor of Molecular Virology/ Jordan university of Science and Technology). We believe this has improved the readability and presentation of the manuscript. 3. Role of funders We have amended the funding statement to include the following: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” 4. Data Availability Statement We confirm that the submission contains the complete minimal data set required to replicate the study findings. All relevant data, including values used for statistical analyses, graphs, and figures, have been provided within the manuscript and Supporting Information files. 5. Data sharing plan We have ensured that all data will be freely accessible at the time of acceptance, in accordance with PLOS ONE’s open data policy. The following statement was added in the availability of data and materials section: The supplementary for the real-time qPCR run files and raw data are available on GitHub at https://github.com/mbalzghoul/Burning-project. 6. Abstract consistency We have amended the abstract so that the version in the manuscript and the version in the online submission form are now identical. The abstract was corrected to be identical in both manuscript and online submission form. * Below, we provide a detailed, point-by-point response to each of the reviewers’ comments. Reviewers’ comments are presented in bold, followed by our responses in regular text: Reviewer #1 1. Statistical power and interpretation: The sample size per time point (n = 3) is too small. Please conduct a power analysis or justify the sample size. Many outcome measures did not reach significance. Acknowledge limitations. Include post-hoc comparisons/effect sizes. Response: The following statement was added (Despite our findings indicating substantial increases in TGF-β (on day 3) and IGF-1 (on day 9), other molecular and histopathological parameters did not attain statistical significance. The lack of significance should be interpreted with caution, as it may be partially attributable to the limited per-time point sample size (n = 3). A post hoc power analysis indicated that the present design was sufficiently powered to detect large effect sizes (Cohen’s d ≥ 1.2), but underpowered to detect small-to-moderate differences. Indeed, several outcomes, including VEGF (day 12) and PDGFb (day 3), showed moderate-to-large effect sizes despite not achieving statistical significance, suggesting possible biological relevance. These trends highlight the potential therapeutic effect of Remanco that warrants confirmation in larger, more adequately powered studies. These data demonstrate a substantial early response to Remanco cream, which may be pivotal in expediting the initial stages of wound healing. Transforming growth factor-beta (TGF-β), widely recognized for its role in regulating inflammation and facilitating tissue regeneration, exhibited a notable increase in expression levels during the early stages of the therapy course. On days 9 and 18, TGF-beta expression doubled and tripled, respectively (Fig 4-A). This increase is significant because TGF-beta is essential for orchestrating the deposition of extracellular matrix and the formation of granulation tissue, both of which are critical phases in the healing process [22].) A limitations section was added to describe all limitations of this study. This study has several limitations. The small number of animals sacrificed at each time point (n = 3) limited statistical power to detect subtle differences among treatment groups. Our post hoc power analysis confirmed that the study was only adequately powered to detect large effect sizes, so smaller but biologically meaningful effects may have gone undetected. Replication with larger sample sizes is essential to validate the observed trends. The molecular analysis was restricted to a selected panel of growth factors, so including additional markers like pro-inflammatory cytokines, angiogenic regulators, and extracellular matrix components could provide a more comprehensive understanding of Remanco’s effects. Animal models offer valuable mechanistic insights, but translation to human burn wound healing requires further clinical studies. 2. Gene expression analysis: Non-significant fold changes should be cautiously presented. Consider protein-level validation. Response: We thank the reviewer for this important point. We have revised the manuscript to present the non-significant fold changes with explicit caution, framing them as preliminary observations. We fully agree on the necessity of protein-level validation and have acknowledged this as a key limitation and a critical objective for future work to confirm the biological relevance of these transcriptional trends. 3. Histopathological evaluation: Was scoring blinded? Response: Yes, the histopathological evaluation was performed in a blinded manner 4. Data presentation: Include summary tables/graphs for wound reduction. Response: We have added summary graphs to visually depict wound area reduction over time (Figure 1,5). 5. Discussion and claims: The claim of “cosmetic appearance” and hair regrowth should be supported or removed. Response: We have removed the unsupported claims of cosmetic improvement and hair regrowth. The Discussion has been reframed to emphasize the preliminary nature of our findings and to present Remanco as a promising traditional formulation requiring further validation. 6. Minor comments: Clarify figure legends, cite comparative studies with silver sulfadiazine. Response: Thank you for these suggestions. We have revised the figure legends to be more comprehensive and have added citations to relevant comparative studies that utilize silver sulfadiazine as a benchmark for burn wound treatment ________________________________________ Reviewer #2 1. Lack of statistical significance in key outcomes. Please add recent literature citations. Response: We have reframed the Discussion to avoid overstating non-significant outcomes and to highlight the preliminary nature of our results. In addition, we have updated the literature review to include recent publications within the last five years. 2. Incomplete molecular validation: Only TGF-β and IGF-1 were significant. Provide primer references. Discuss active compounds in Remanco. Response: The following table was edited to provide the accession number. Gene Forward Primer (5′→3′) Reverse Primer (5′→3′) Accession number IGF-1 AAAGTCAGCTCGTTCCATCC GTTTCCTGCACTTCCTCTACTT X06043 M17714 PDGF-AA CACACGCCAGACTGTGTATAA CATGGTGATGCCTTTGTTTCTC L41623 PDGF-BB GAGCCAAGACACCTCAAACT ATCTCCTTCAGTGCCTTCTTG PQ117545.1 PDGF-DD CCATTCGCAGGAAGAGAAGTAT GCTCCGAGGTATCTCGTAAATG AB003156.1 TGF-β CTGAACCAAGGAGACGGAATAC GTTTGGGACTGATCCCATTGA M55431.1 Keratinocyte FGF AGCGACACACGAGAAGTTATG CCTTTCACTTTGCCTCGTTTG X56551 FGF7 AGCGACACACGAGAAGTTATG CCTTTCACTTTGCCTCGTTTG NM_002009.4 VEGF CAATGATGAAGCCCTGGAGT TCTCCTATGTGCTGGCTTTG AY378102.1 FGF2 GACCCACACGTCAAACTACA GCCGTCCATCTTCCTTCATAG NM_001077585.1 β-Actin ACAGGATGCAGAAGGAGATTAC ACAGTGAGGCCAGGATAGA EF156276.1 GAPDH ACTCCCATTCTTCCACCTTTG CCCTGTTGCTGTAGCCATATT AF106860.2 Response: Remanco is a commercially available preparation, and its phytochemical profile is described by the manufacturer. While a full chemical analysis was beyond the scope of this study, we have added available information. 3. Animal experiment design: Clarify number of animals sacrificed per day. Justify sample collection days. Standardize across figures and tables. Response: We thank the reviewer for this critical comment regarding the experimental design. We have now clarified these details in the revised Methods section. The sampling strategy was as follows: Three animals from each group were randomly selected and sacrificed at each predetermined time point (Days 3, 9, 15, 21, and 30 post-burn) for tissue collection. This resulted in a total sample size of n=3 for histological and molecular analyses at each time point for each group. The time points were selected to systematically capture key phases of the wound healing process: the early inflammatory phase (Day 3), the proliferative phase (Days 9-15), and the maturation/remodeling phase (Days 21-30). This standardized schedule ensured consistent and comparable sample collection across all groups and for all analyses, including histopathology and gene expression. We have verified that all figures and corresponding legends now explicitly reflect this consistent sample size (n=3 per group per time point) 4. Missing visual data: Include all figures, graphs, sample sizes, and histological images. Response: Thank you for highlighting this. We have now included all missing visual data in the revised manuscript. The submission now contains the complete set of figures and graphs. Furthermore, we have added the corresponding histological images to provide direct visual evidence supporting the scoring and conclusions. 5. Histopathological data presentation: Please provide representative images. Response: Representative stained histological sections illustrating re-epithelialization and angiogenesis have been added (Figure 2-4). 6. Overinterpretation of findings: Reframe conclusions. Response: We have revised the Discussion and Conclusion to avoid overinterpretation. The study is now framed as preliminary, highlighting the need for larger, more rigorous trials. 7. Phytochemical characterization: Provide chemical analysis of Remanco. Response: Remanco is a commercially available preparation, and its phytochemical profile is described by the manufacturer. While a full chemical analysis was beyond the scope of this study, we have added available information. 8. Minor comments (grammar, study design diagram, graphical abstract). Response: The manuscript has been thoroughly copyedited for grammar and style. We are grateful for the reviewers’ constructive critiques, which have helped us substantially improve our manuscript. We have strengthened the statistical analysis, improved data presentation, clarified methods, revised the discussion to avoid overstatement, and improved the overall readability and formatting. We respectfully submit the revised manuscript for your consideration. Sincerely, Dr. Foad Alzoughool On behalf of all co-authors Attachments Attachment Submitted filename: Dear Academic Editor and Reviewers.docx https://doi.org/10.1371/journal.pone.0338305.r002
20 Nov 2025 Decision Letter - Naveed Ahmed, Editor Therapeutic Effects of Skin Repair Plus Ointment on Molecular and Morphological Changes in Burn Wounds: A Rat Model PONE-D-25-31940R1 Dear Dr. Alzoughool, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support . If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Naveed Ahmed, Ph.D Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: https://doi.org/10.1371/journal.pone.0338305.r003
Formally Accepted
Acceptance Letter - Naveed Ahmed, Editor PONE-D-25-31940R1 PLOS One Dear Dr. Alzoughool, I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS One. Congratulations! Your manuscript is now being handed over to our production team. At this stage, our production department will prepare your paper for publication. This includes ensuring the following: * All references, tables, and figures are properly cited * All relevant supporting information is included in the manuscript submission, * There are no issues that prevent the paper from being properly typeset You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps. Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. You will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing. If we can help with anything else, please email us at customercare@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Naveed Ahmed Academic Editor PLOS One https://doi.org/10.1371/journal.pone.0338305.r004

Open letter on the publication of peer review reports

PLOS recognizes the benefits of transparency in the peer review process. Therefore, we enable the publication of all of the content of peer review and author responses alongside final, published articles. Reviewers remain anonymous, unless they choose to reveal their names.

We encourage other journals to join us in this initiative. We hope that our action inspires the community, including researchers, research funders, and research institutions, to recognize the benefits of published peer review reports for all parts of the research system.

Learn more at ASAPbio .