PONE-D-24-47896Identification of the co-regulatory siRNAs of “miRNA→Target” in Oryza sativaPLOS ONE

Dear Dr. yang,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jan 31 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
• A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
• An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Keqiang Wu, Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure: [This work was supported by the National Natural Sciences Foundation of China[31771457]].

Please state what role the funders took in the study. If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.""

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

3. Thank you for uploading your study's underlying data set. Unfortunately, the repository you have noted in your Data Availability statement does not qualify as an acceptable data repository according to PLOS's standards.

At this time, please upload the minimal data set necessary to replicate your study's findings to a stable, public repository (such as figshare or Dryad) and provide us with the relevant URLs, DOIs, or accession numbers that may be used to access these data. For a list of recommended repositories and additional information on PLOS standards for data deposition, please see https://journals.plos.org/plosone/s/recommended-repositories .

4. In the online submission form, you indicated that [The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request].

All PLOS journals now require all data underlying the findings described in their manuscript to be freely available to other researchers, either 1. In a public repository, 2. Within the manuscript itself, or 3. Uploaded as supplementary information.

This policy applies to all data except where public deposition would breach compliance with the protocol approved by your research ethics board. If your data cannot be made publicly available for ethical or legal reasons (e.g., public availability would compromise patient privacy), please explain your reasons on resubmission and your exemption request will be escalated for approval.

5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information .

6. We notice that your figures are uploaded with the file type Supplementary. Please amend the file type to 'Supporting Information'. Please ensure that each Supporting Information file has a legend listed in the manuscript after the references list.

7. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Thank you for submitting your manuscript to PLOS ONE. We have now received reports from two reviewers. Please address the comments from both reviewers.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In the manuscript entitled " Identification of the co-regulatory siRNAs of “miRNA→Target” in Oryza sativa”, Yang et al. described the use of their previously developed sRNATargetDigger tool and public databases to re-mine the reported rice "miRNA→Target" database, and search for missing co-regulatory siRNAs information. As a result, they found 86.2% of the target genes were co-regulated by one or more miRNAs\siRNAs and some errors in the rice "miRNA→Target" database were also be corrected by authors.

MicroRNAs are the key factors in post-transcriptional expression regulation of genes and are widely involved in the regulation of important agronomic traits in rice. This study improves the rice "miRNA→target" database which is significance for basic research and molecular breeding of rice . So, I recommend Plos one can accept this paper.

However, I have a few comments that I think need to be address.

Comments:

1. The co-regulatory siRNA_2 (“UUUGGAUUGAAGGGAGCUCUGA”) shown in Supplementary Table S2 has one more “A” at the 3' end than the osa-miR159a.1 (“UUUGGAUUGAAGGGAGCUCUG”), which may be due to 3' addition events in miRNA maturation processes and should theoretically be classified as an isomiR of osa-miR159a.1. Authors need to rename all these co-regulatory siRNAs and revise the relevant content in the manuscript.

2. Many miRNA target genes in the manuscript only have id numbers. It would be better to provide gene annotation information to facilitate readers' reading and understanding of miRNA functions.

3. In order to compare different samples, the author normalized the high-throughput sequencing data. However, I found that in Fig. 3, the two degradome(GSM4113551 and GSM434596) detected the same target gene(LOC_Os02g36924.1), but the difference in cleavage signal intensity was several dozen times. Does this difference have an impact on the results?

Reviewer #2: In the manuscript “Identification of the co-regulatory siRNAs of ‘miRNA→Target’ in Oryza sativa”, Yang et al. have made a significant contribution by re-mining the rice "miRNA→Target" database using the sRNATargetDigger tool. Approximately 86.2% of rice target genes were discovered to be co-regulated by more than one miRNA/siRNA. Additionally, 23 isomiRNA and 19 siRNA were identified, some of which are expressed at even higher levels than miRNAs and may be involved in various aspects of biological processes. This work represents an update to the understanding of rice small RNA society and provides a more comprehensive and reliable "miRNA→Target" regulatory information for rice research. The text is well-written and easy to understand. However, some minor revisions are recommended before publication.

1. By utilizing sRNATargetDigger and public data, the authors have uncovered many miRNA-Target pairs that were previously overlooked in the rice "miRNA-Target" database. As far as I am aware, in addition to the TarDB database mentioned in the paper, there are numerous other research papers on the mining of miRNA target genes in rice. It is suggested that the authors explore relevant literature to determine if their results (or partial results) can be supported by other research, which would enhance the reliability of their findings.

2. Many abbreviations lack full name information when they first appear. It is recommended to provide the full names, such as trans-acting small interfering RNA (ta-siRNA), etc.

3. In rice, the authors found that the expression of many isomiRs exceeds that of miRNAs. Is this a sequencing artifact or an annotation error of miRNA? Does this phenomenon also occur in other species?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

Identification of the co-regulatory siRNAs of “miRNA→Target” in Oryza sativa

PONE-D-24-47896R1

Dear Dr. Shao,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager®  and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Keqiang Wu, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #2: Yes:  Ming Chen

**********