A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) variants of concern

Randi Jessen; Line Nielsen; Nicolai Balle Larsen; Arieh Sierra Cohen; Vithiagaran Gunalan; Ellinor Marving; Alonzo Alfaro-Núñez; Charlotta Polacek; The Danish COVID-19 Genome Consortium (DCGC); Anders Fomsgaard; Katja Spiess

doi:10.1371/journal.pone.0274889

Peer Review History

Original SubmissionJuly 12, 2022
12 Aug 2022 Decision Letter - Ruslan Kalendar, Editor PONE-D-22-19692A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) Variants of ConcernPLOS ONE Dear Dr. Spiess, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Sep 26 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Ruslan Kalendar Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information. If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information. 3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. 4. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ 5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ******** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A Reviewer #2: N/A ****** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ****** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ****** 5. Review Comments to the Author Reviewer #1: 1.Titles of X and Y axis in figure 3 and figure4 are the same probe L452, please check carefully. 2.No source information of BA.4 and BA.5 in material and method (Samples and controls), author should support this information. 3.Is there any founding in this study? Reviewer #2: Two separate tests targeting the ΔH69/V70 deletion and the L452R point mutation in the S-gene were developed and used with a previously developed assay (E-gene) for detecting and differentiating SARS-CoV-2 Alpha variant, Delta variant, and BA.1/2/4/5 sub-variants of the Omicron strains. The assay was validated with 745 positive clinical samples, and genotypes were confirmed by WGS. Most strains in Denmark, as well as in most part of the globe, are Omicron variants now, and BA.4 and BA.5 are the most dominant subtypes, with trace number of BA.2 strains. It looks like the L452R wild-type/Mutant assay will provide sufficient information for detection, as it can differentiate BA.1/BA.2 from the most prevalent strains of BA.4/BA.5. The differentiation of BA.2 from BA.1/4/5 using ΔH69/V70 deletion assay does not seems to be necessary. Additionally, the ΔH69/V70 assay, L452R assay and the E-gene assay are separate individual reactions. Taking one out will reduce the number of reactions for a given sample. The assays were well-validated with clinical samples, and compared to WGS results. Yet, there was no standard curve generated to determine PCR efficiencies, dynamic range of detection, and limit of detection. Table 2 provided data of 5 dilutions, but there was no mentioning of the original concentration, thus limit of detection in terms of copy-number cannot be assessed. PCR efficiency and correlation coefficient were not calculated either (By the way, “Concentration” in the table may have been mislabeled, and should be “Dilution factor”). There are many multiplex qPCR developed for SARS-CoV-2 detection and differentiation (J Clin Microbiol. 2021 Jul 19;59(8):e0085921; PLoS One. 2022 Mar 21;17(3):e0265748; Transbound Emerg Dis. 2022 Feb 26. https://doi.org/10.1111/tbed.14497; etc.). If authors can add the E-gene (E-Sarbeco) target into the L452R assay will further reduce the number of reactions, and thus detection cost. Authors have mentioned E848K assay (lines 142-144), but this assay was not mentioned in the rest of the manuscript, and no primer/probe information were given. In Supplementary Fig. 1, the original probe and the degenerate probe may have been mislabeled/switched. ****** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Jianfa Bai ******** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. https://doi.org/10.1371/journal.pone.0274889.r001
Revision 1
5 Sep 2022 Author Response Response to the reviewers We thank the reviewers for their enthusiasm for our study and replied in a step-by-step response below: Reviewer #1: 1.Titles of X- and Y axis in figure 3 and figure 4 are the same probe L452, please check carefully. Response: We thank the reviewer for pointing it out and corrected the y-axis in Figs 3A and 4A, accordingly. 2. No source information of BA.4 and BA.5 in material and method (Samples and controls), author should support this information. Response: We submitted the GISAID accessions IDs corresponding to the WGS-confirmed SARS-CoV Delta and Omicron patient samples included in this study for a better overview of the sequence information including the one for BA.4 and BA.5. During this process, we noticed that a total of nine sequences (four BA.4 and five BA.5) were not uploaded to GISAID for unknown reasons. These samples were used in our sequence alignments only and not in the RT-qPCRs, hence their exclusion from our study had no effect on our conclusions. We have corrected the manuscript as follows (line 269 -279): WGS data obtained from Danish BA.4 and BA.5 sequences revealed that 92.3% of BA.4 consensus sequences (180/195) and 97.6% of BA.5 consensus sequences (323/331) carried the ∆H69/V70 mutation. The prevalence of the mutation 452R is 93% and 98.8% in BA.4 and BA.5, respectively, which confirmed that nearly all BA.4 and BA.5 carry both signature mutations. Based on alignment of unique sequences, 84 BA.4 and 51 BA.5, respectively, the primers and probes in our L452R RT-qPCR had a complete match with all BA.4 sequences. Of the 51 analyzed BA.5 sequences, one showed an A-to-T substitution in the middle of the L452R probe-binding region, whereas the primer-binding regions were conserved. The BA.5 genomes had a perfect match to the primers and probe in the degenerate ∆H69/V70 RT-qPCR whereas a single nucleotide mismatch, an A-to-G substitution, located in the middle of the ∆H69/V70 forward primer (ACATTCAACTCGGGACTTGTTCT), was observed in 10 of the 84 investigated BA.4 sequences (12%). This mutation did however not abolish the detection of the ∆H69/V70 mutation (Fig 4A). At the time point of this study, BA.4 and BA.5 were up-coming variants in Denmark, and not yet dominant, hence no cultivated BA.4 or BA.5 virus isolates for use as positive control were available. Instead, virus isolates of Alpha variant B.1.1.7 and Delta variant B.1.617.2 were used as positive controls for the ∆H69/V70 and L452R key mutations, respectively. We tried to clarify it in the material and method part (line 108-115). 3. Is there any founding in this study? Response: The study was performed at the Statens Serum Institut, in collaboration with Test Center Denmark, which are part of the Danish National Surveillance System for SARS-CoV-2. Therefore, no external funding was received for this study. Reviewer #2: Two separate tests targeting the ΔH69/V70 deletion and the L452R point mutation in the S-gene were developed and used with a previously developed assay (E-gene) for detecting and differentiating SARS-CoV-2 Alpha variant, Delta variant, and BA.1/2/4/5 sub-variants of the Omicron strains. The assay was validated with 745 positive clinical samples, and genotypes were confirmed by WGS. Most strains in Denmark, as well as in most part of the globe, are Omicron variants now, and BA.4 and BA.5 are the most dominant subtypes, with trace number of BA.2 strains. It looks like the L452R wild-type/Mutant assay will provide sufficient information for detection, as it can differentiate BA.1/BA.2 from the most prevalent strains of BA.4/BA.5. The differentiation of BA.2 from BA.1/4/5 using ΔH69/V70 deletion assay does not seems to be necessary. Additionally, the ΔH69/V70 assay, L452R assay and the E-gene assay are separate individual reactions. Taking one out will reduce the number of reactions for a given sample. Response: The major aim of this study was to show that a degenerate probe can be incorporated into existing RT-qPCRs to rescue the PCR after a change of a SARS-CoV-2 variant and a potential primer and probe mismatch. However, we agree that a single PCR target could be enough to differentiate BA.1/BA.2 and BA.4/5, but we think that including an additional PCR target is of advantage as the 452R mutation has been detected in BA.1 and BA.2 variants. Thus, including ΔH69/V70 RT-qPCR into the screening helps to minimize false positive results. The assays were well-validated with clinical samples, and compared to WGS results. Yet, there was no standard curve generated to determine PCR efficiencies, dynamic range of detection, and limit of detection. Table 2 provided data of 5 dilutions, but there was no mentioning of the original concentration, thus limit of detection in terms of copy-number cannot be assessed. PCR efficiency and correlation coefficient were not calculated either (By the way, “Concentration” in the table may have been mislabeled, and should be “Dilution factor”). Response: We appreciated the input from the reviewer and changed it to dilution factor in the table. The ΔH69/V70 PCR efficiency has been determined in a previously study for the original ΔH69/V70 primers and probe (https://doi.org/10.1101/2021.10.25.2126548). We made this point more clear in the manuscript and wrote (line 206-211): Moreover, the fluorescence intensity was moderately reduced for the degenerate probe compared to the original probe targeting the ∆H69/V70 present in the SARS-CoV-2 Alpha variant (TWIST control) (S1-A Fig). However, the sensitivity of the ∆H69/V70 RT-qPCR was unchanged including the degenerate ∆H69/V70 probe instead of the original probe, as shown by a dilution row of the TWIST standard (Alpha variant) (S1-B Fig). The sensitivity of the original primer and probe of the ∆H69/V70 RT-qPCR was determined in a previous study (https://doi.org/10.1101/2021.10.25.2126548). There are many multiplex qPCR developed for SARS-CoV-2 detection and differentiation (J Clin Microbiol. 2021 Jul 19;59(8):e0085921; PLoS One. 2022 Mar 21;17(3):e0265748; Transbound Emerg Dis. 2022 Feb 26. https://doi.org/10.1111/tbed.14497; etc.). If authors can add the E-gene (E-Sarbeco) target into the L452R assay will further reduce the number of reactions, and thus detection cost. Response: In our large-scale screening setup, primary diagnosis of SARS-CoV-2 is performed in parallel with an E-Sarbeco singleplex assay. Positive samples are re-analyzed for variant typing in 384-well format (https://doi.org/10.1101/2021.10.25.2126548). In this setup we have chosen to repeat the original E-Sarbeco assay in singleplex as a quality control for the original diagnostic assay. A multiplex PCR of L452R and E-Sarbeco targets would require extensive, time-consuming validation, since even small differences in sensitivity, could affect diagnostics, given the large numbers of sample processed in the Danish testing system. However, in small-scale we think it would be a good idea to run these PCRs as multiplex PCR with the L452R and E-Sarbeco PCR in one run, but this was out of the aim of this study. Authors have mentioned E848K assay (lines 142-144), but this assay was not mentioned in the rest of the manuscript, and no primer/probe information were given. Response: We apologize and deleted this information from the method part, as this assay was not included into this study. In Supplementary Fig. 1, the original probe and the degenerate probe may have been mislabeled/switched. Response: We thank the reviewer for pointing this mistake out, but we checked the Supplementary Fig. 1 carefully and we could not find the mistake. In the Supplementary Fig. 1A, the degenerate ∆H69/V70 probe shows a reduced fluorescence intensity on the TWIST Alpha variant standard (10-3 copies/µl) compared to the original ∆H69/V70 probe. In contrast, the degenerate probe shows a better fluorescence intensity detecting SARS-CoV-2 BA.1 variants from patient samples than the original probe as shown in Fig. 1 and Fig.2. Attachments Attachment Submitted filename: Response to the reviewers_KS_VG_NIBL_RAJE_20220823_final.docx https://doi.org/10.1371/journal.pone.0274889.r002
7 Sep 2022 Decision Letter - Ruslan Kalendar, Editor A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) Variants of Concern PONE-D-22-19692R1 Dear Dr. Spiess, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Ruslan Kalendar Academic Editor PLOS ONE https://doi.org/10.1371/journal.pone.0274889.r003
Formally Accepted
12 Sep 2022 Acceptance Letter - Ruslan Kalendar, Editor PONE-D-22-19692R1 A RT-qPCR system using a degenerate probe for specific identification and differentiation of SARS-CoV-2 Omicron (B.1.1.529) Variants of Concern Dear Dr. Spiess: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Professor Ruslan Kalendar Academic Editor PLOS ONE https://doi.org/10.1371/journal.pone.0274889.r004

Open letter on the publication of peer review reports

PLOS recognizes the benefits of transparency in the peer review process. Therefore, we enable the publication of all of the content of peer review and author responses alongside final, published articles. Reviewers remain anonymous, unless they choose to reveal their names.

We encourage other journals to join us in this initiative. We hope that our action inspires the community, including researchers, research funders, and research institutions, to recognize the benefits of published peer review reports for all parts of the research system.

Learn more at ASAPbio .