Assessment of RNA extraction protocols from cladocerans

Muhammad Raznisyafiq Razak; Ahmad Zaharin Aris; Fatimah Md Yusoff; Zetty Norhana Balia Yusof; Sang Don Kim; Kyoung Woong Kim

doi:10.1371/journal.pone.0264989

Peer Review History

Original SubmissionSeptember 3, 2021
11 Nov 2021 Decision Letter - SSS Sarma, Editor PONE-D-21-28380Assessment of RNA extraction protocols from CladoceransPLOS ONE Dear Dr. Aris, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Dec 26 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, SSS Sarma Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. Additional Editor Comments (if provided): I am sorry to provide you the reviewer's observations very late. This is not the case for Plos One which has a reputation of rapid and objective evaluation of every manuscript. One reviewer, after having agreed to review, did not respond even after 2 weeks passing the deadline. Anyhow, based on one reviewer, I noticed that your methods are flawed. I agree with her/him. Anyhow, I would like to give an opportunity to re-submit a revised version, by taking into account of all observations of the reviewer. To be fair to the authors, the revised version will be sent out to completely new set of reviewers. Sincerely Handling Editor [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ******** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ****** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ****** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ****** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript entitled “Assessment of RNA extraction protocols from Cladocerans” (PONE-D-21-28380) is well written and carefully designed, the results were treated appropriately, and the conclusions are supported by the experimental results. However the exprimental design focuses only on the standardization of two RNA extraction methods (the phenol-chloroform extraction method and a column-based kit) using a biological model (Moina micrura) that is of interest in ecological and toxicology studies. The authors, based on qualitative and quantitative indicators, concluded that the genetic material obtained could be used in downstream gene expression essays. The standardization of existing protocols is the first phase of the experimental work that aims to test the molecular response of an organism to a specific condition. Therefore, I do not consider that this report in its current state deserves its publication in PLOS ONE journal. In my opinion, the authors could subject to Moina micrura to controlled conditions to prove that the extraction protocol produces useful genetic material to for testing hypotheses involving genetic expression essays. ****** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review?** For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. https://doi.org/10.1371/journal.pone.0264989.r001
Revision 1
2 Jan 2022 Author Response Department of Environment Faculty of Forestry and Environment Universiti Putra Malaysia (UPM) 43400 UPM Serdang, Selangor, Malaysia 4th December 2021 SSS Sarma Academic Editor PLOS ONE Dear Editor, Title: Assessment of RNA extraction protocols from Cladocerans (PONE-D-21-28380). We would like to express our gratitude for the useful comments suggested by the reviewers. The authors have made the necessary amendments to the manuscript accordingly. Hereby, we have provided the “Response to Reviewers” as follows: EDITOR: General Comment I am sorry to provide you the reviewer's observations very late. This is not the case for Plos One which has a reputation of rapid and objective evaluation of every manuscript. One reviewer, after having agreed to review, did not respond even after 2 weeks passing the deadline. Anyhow, based on one reviewer, I noticed that your methods are flawed. I agree with her/him. Anyhow, I would like to give an opportunity to re-submit a revised version, by taking into account of all observations of the reviewer. To be fair to the authors, the revised version will be sent out to completely new set of reviewers. Answer to the editor comment: We would like to thank the Editor for the comment and for the opportunity to re-submit a revised version. The authors would like to sincerely appreciate all valuable comments and suggestions, which helped us to improve the quality of the article. The authors have added several improvements as suggested by the editor and reviewers in the manuscripts. The authors have amended material and methods section such as the addition of “M. micrura Culture Specifications”, “M. micrura Controlled Samples Collection” and “First-Strand Complementary DNA (cDNA) Synthesis and Reverse-Transcription Polymerase Chain Reaction (RT-PCR)” sub-sections. Moreover, authors added RT-PCR analysis for two (2) genes to prove current optimised extraction method (method C) produces useful genetic material for testing the hypotheses involving genetic expression assays (S1 Fig.). The additional discussion can be seen in the section below (general comments by reviewer #1). Reviewer #1: General Comment Reviewer #1: The manuscript entitled “Assessment of RNA extraction protocols from Cladocerans” (PONE-D-21-28380) is well written and carefully designed, the results were treated appropriately, and the conclusions are supported by the experimental results. However, the experimental design focuses only on the standardization of two RNA extraction methods (the phenol-chloroform extraction method and a column-based kit) using a biological model (Moina micrura) that is of interest in ecological and toxicology studies. The authors, based on qualitative and quantitative indicators, concluded that the genetic material obtained could be used in downstream gene expression essays. The standardization of existing protocols is the first phase of the experimental work that aims to test the molecular response of an organism to a specific condition. Therefore, I do not consider that this report in its current state deserves its publication in PLOS ONE journal. In my opinion, the authors could subject to Moina micrura to controlled conditions to prove that the extraction protocol produces useful genetic material to for testing hypotheses involving genetic expression essays. Answer to the Reviewers comment: The experimental design was focuses on both standardisation of two RNA extraction methods and standardisation subject of Moina micrura to controlled conditions. Based on the suggestion by the reviewers, the authors have revised the information by adding “M. micrura Culture Specifications”, “M. micrura Controlled Samples Collection” and “First-Strand Complementary DNA (cDNA) Synthesis and Reverse-Transcription Polymerase Chain Reaction (RT-PCR)” sub-sections in the material and methods section. Moreover, authors added RT-PCR analysis for two (2) genes to prove current optimised extraction method (method C) produces useful genetic material for testing the hypotheses involving genetic expression assays (S1 Fig.). The authors have added several explanations regarding the subject of Moina micrura to controlled conditions in the revised manuscript as follow: (Material and Methods Section) M. micrura Culture Specifications Live samples of Cladocerans M. micrura were obtained from the culture in the Aquatic Animal Health and Therapeutics Laboratory (AquaHealth), Institute of Bioscience, Universiti Putra Malaysia. The culture was cultivated based on the International Organization for Standardization (ISO) method (ISO 6341:2012). The culture specifications were regulated to the light/dark cycle of 12: 12 h and 27 ± 1°C. The media was changed every two days with the daily supplementation of a green microalga species, Chlorella vulgaris (1.0 × 106~8 cells/ ml, 1 ml/day), as the food supply. M. micrura Controlled Samples Collection The standardization of sample collection to ensure the M. micrura in controlled condition throughout the RNA extraction process. Live M. micrura females were sorted from the culture sample under a Zeiss Axioskop 2 microscope (Zeiss, Germany). Females of M. micrura were collected similarly from the controlled culture prior to the RNA extraction. All experiments were performed in accordance with UK legislation under the Animals (Scientific Procedures) Act 1986 Amendment Regulations (SI 2012/3039). First-Strand Complementary DNA (cDNA) Synthesis and Reverse-Transcription Polymerase Chain Reaction (RT-PCR). Two (2) replicate of RNA extraction samples from the best extraction method were used for cDNA synthesis and subsequent RT-PCR using primers based on previous literature [35]. Tetro cDNA Synthesis Kit (Bioline, USA) was utilised to synthesis complementary DNA (cDNA) by mixing 2 µg/µl of total RNA, 8 µl of Reverse Transcriptase Buffer, 2 µl of 10 mM dNTP mix, 2 µl of Oligo (dT)18 Primer, 2 µl of Ribosafe RNase Inhibitor, 2 µl of Tetro Reverse Transcriptase and RNase free Water to make up to 40 µl. The reaction mixture was homogenised by pipetting gently and incubated inside T100™ thermal cycler (Bio-Rad, USA) at 45°C for 30 minutes. This was followed by an incubation at 85°C for 5 minutes to stop the reverse transcriptase reaction and the holding temperature was finally held at 4°C. The cDNA was kept at -20°C before RT-PCR analysis. Two (2) genes (Table 1) will be validated using SensiFAST™ SYBR No-ROX Kit (Bioline, USA). 0.3 µg of cDNA template will be mixed with 0.4 µl of 10 µM forward qPCR primer, 0.4 µl of 10 µM reverse qPCRprimer, 10 µl of 2 x SensiFast SYBR No-ROX Mix (containing 10 µM of dNTP mixture, 3 mM of MgCl2, SYBR® Green I dye, Taq Polymerase buffer, Taq DNA Polymerase, stabilisers and enhancers) and 8.2 µl of PCR grade distilled water. Each mixture will be pipetted into a 0.2 ml PCR tube, vortexed and centrifuged for a short spin prior to placing it into the Rotor-Gene Q thermocycler (QIAGEN, Germany). Two step RT-PCR will be performed with the cycling conditions consisting of an initial denaturation step at 95°C for 2 minutes, 40 cycles of denaturation (95°C for 5 seconds) and 65°C of annealing reaction. Table 1. Genes and primers used in the present study for Moina micrura [35]. Gene Function Sequences Alpha Tubulin, aTub Make up the cell's structural framework Forward: TGGAGGTGGTGACGACT Reverse: CCAAGTCGACAAAGACAGCA Actin, Act Makes up the structural framework inside cells. Forward: CCACACTGTCCCCATTTATGAA Reverse: CGCGACCAGCCAAATCC (Results and Discussion) In this study, The Qiagen Micro Kit (Method C) was the most optimised method and surpassed the minimum requirement of RNA quality control. Thus, the RNA extracted from this method was used for cDNA synthesis and subsequent RT-PCR analysis. The RT-PCR amplification cycle graphs showed that for both genes in all samples, the exponential increase started at 33–35 cycles (i.e. Ct = 32.64 to 33.48) (S1 Fig.). The result indicates current extraction method produces useful genetic material for testing the hypotheses involving genetic expression assays. (Supporting information) Figure S1: Real time PCR amplification cycle graphs of the amplicons of two M. micrura genes. Two (2) replicate of RNA extraction samples from the best extraction method (Method C) were used for cDNA synthesis. a) Alpha tubulin; b) Actin. Attachments Attachment Submitted filename: Response to Reviewers_PLOS One.docx https://doi.org/10.1371/journal.pone.0264989.r002
21 Feb 2022 Decision Letter - SSS Sarma, Editor Assessment of RNA extraction protocols from Cladocerans PONE-D-21-28380R1 Dear Dr. Aris, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, SSS Sarma Academic Editor PLOS ONE Additional Editor Comments (optional): One reviewer has asked for some minor corrections. These can be done at proof stage. The manuscript has been recommended for publication. However, the editor in chief has the final decision. Sincerely Handling Editor Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: (No Response) ******** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ****** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ****** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ****** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ****** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: Dear Authors I highly appreciate the research concept and your hard efforts. I think outcomes could be more concrete and understandable to readers, especially the discussion parts. The research is focused on two RNA extraction methods, which I think it's acceptable. However, please reconstruct the abstract and discussion section then it will be more convincing to readers. I cordially suggest accumulating some more literature for supporting your methods and discussion. ****** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review?** For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No https://doi.org/10.1371/journal.pone.0264989.r003
Formally Accepted
18 Apr 2022 Acceptance Letter - SSS Sarma, Editor PONE-D-21-28380R1 Assessment of RNA extraction protocols from Cladocerans Dear Dr. Aris: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Professor SSS Sarma Academic Editor PLOS ONE https://doi.org/10.1371/journal.pone.0264989.r004

Open letter on the publication of peer review reports

PLOS recognizes the benefits of transparency in the peer review process. Therefore, we enable the publication of all of the content of peer review and author responses alongside final, published articles. Reviewers remain anonymous, unless they choose to reveal their names.

We encourage other journals to join us in this initiative. We hope that our action inspires the community, including researchers, research funders, and research institutions, to recognize the benefits of published peer review reports for all parts of the research system.

Learn more at ASAPbio .