Peer Review History

Original SubmissionFebruary 4, 2021
Decision Letter - Ben J Mans, Editor

PONE-D-21-03889

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

PLOS ONE

Dear Dr. Smagghe,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

One reviewer identify some minor editorial issues that would improve the grammar and presentation of the study and is worth addressing since this would improve the manuscript overall. The other reviewer identify a number of methodological issues, notably that some genes that was missing might be present in the genome. I suggest that the authors look at all of these methodological issues and address them since they will all improve the manuscript significantly and prevent unnecessary errors that might detract from the study.

Please submit your revised manuscript by May 28 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ben J Mans, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

  1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

  1. In your Methods, please state the source of all insect samples used in your study. If any were collected directly from the field, please include details of the geographical provenance and any permits obtained for these collections.

  1. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. 

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

●             The name of the colleague or the details of the professional service that edited your manuscript

●             A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

●             A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

  1. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files

  1. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In the manuscript titled 'Complete mitochondrial genomes of four species of praying mantises (Dictyoptera,

Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses' the author present the complete mitochondrial genome of four species of mantid. Overall the study is good and should be published but some revisions need to be addressed before publishing.

1) The authors need to have a native English speaker review the document for grammar. It is not unintelligible but there are many spots where it is difficult to follow or does not sound scientific.

2) Throughout the document, the species D. truncata and D. lobata are converted to truncate and lobate due to autcorrect from their word processor (it actually just did it now in this response portal). It is annoying but an easy fix.

3) I would like to see a table or tables that list the gene order and position for all ORFs for each species, this generally is a useful reference for other readers.

Reviewer #2: The authors sequence and annotate the mitogenomes of four mantises species and combine this new data with existing mantis data to estimate phylogenetic relationships in the group. They find a few missing genes in some of the four new mitogenomes, but tRNA secondary structure and codon usage was similar to other mantises. The phylogeny also tended to agree with current taxonomy.

I think the study is definitely a worthwhile addition to insect mitogenomics. I particularly appreciate that you discuss your findings in the context of insect and mantis mitogenomics. However, I do have several issues that should be addressed, some more major then others:

1. You need to re-work some of the structure in the Introduction. For example, the second paragraph introduced mitogenomes and then abruptly switches to introducing the taxonomy of mantises. I would separate these.

2. Because the Methods comes last, I would include some brief methodological details in the Results and Discussion section.

3. Please include more specific results. For example, you vaguely state that there is a high A+T% and list the most-used codons. Please provide specific values in the text.

4. You begin discussing the utility of using cox1 as a barcoding gene (starting line 151), but this discussion appears abruptly. Why is this relevant? Is it related to your nucleotide diversity results? Please explain.

5. I’m a little confused by your sampling strategy. Did you sample the 35 mantis species mentioned in lines 189-190? Or were these taken from GenBank?

6. I am not convinced you are actually missing the atp8 genes. In my experience, it can be difficult to annotate this gene, and you often have to look for it manually based on ORFs, etc. It also seems like there is a non-coding region on the 5’ end of your atp6 genes when a “missing” atp8 is reported. I would bet that is the atp8 gene. Also, were your missing genes confirmed with your PCR step? Finally, it looks like both atp6 and atp8 are missing from one species (bottom left in Fig 1), but I didn’t see any discussion of this. Please elaborate.

7. Did you confirm that these assembled mitogenomes are in fact complete and circular? I recommend doing this, especially since you report missing genes.

8. Please provide more methodological details. For example, how did you calculate Ka/KS? What were your PCR conditions? What GBlocks parameters did you use?

9. There are several portions of the manuscript that are difficult to read. I recommend going through the text and again and edit for grammar, awkward phrasing, etc.

Some minor comments:

Line 25: There is no context for referencing the “Schwarz and Roy (2019) taxonomic system.” Perhaps just say “the latest taxonomy.”

Line 31: No need to say “respectively.” Same in line 82.

Line 42: Be careful about using “bugs” when you mean “insects.” Entomologists will strongly object to this usage…

Lines 74-78 should be in the Introduction

Line 100: Why do you rule out this second possibility? Please elaborate.

Line 144: Please provide a brief overview of dN/dS ratio (i.e., dN/dS > 1 is evidence for positive selection, < 1 for purifying selection, and =1 for neutral).

Line 217: Confusing phrasing. Please re-write. It’s not clear what “miniscule to align means.”

Figure 1: It’s not clear which mitogenomes go with each species. Please add names to the figure.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Revision 1

4/5/2021

Dear Editor,

Thank you very much for your email message regarding our manuscript. We appreciated much the valuable comments from the reviewers for revising and improving our manuscript. Generally, we have incorporated all suggestions and comments of yours into this revision. More specifically, our corrections are as follows here under.

We hope you can now accept this revised version.

Most sincerely,

All authors

Reviewer #1: In the manuscript titled 'Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses' the author present the complete mitochondrial genome of four species of mantid. Overall the study is good and should be published but some revisions need to be addressed before publishing.

1) The authors need to have a native English speaker review the document for grammar. It is not unintelligible but there are many spots where it is difficult to follow or does not sound scientific.

Reply: We thank this referee for his/her suggestions. We have polished the full text and further revised the corresponding parts.

2) Throughout the document, the species D. truncata and D. lobata are converted to truncate and lobate due to autcorrect from their word processor (it actually just did it now in this response portal). It is annoying but an easy fix.

Reply: Thank you.

3) I would like to see a table or tables that list the gene order and position for all ORFs for each species, this generally is a useful reference for other readers.

Reply: We agree and have added the related information on the position of all ORFs. See Table S2. For the gene order, we refer to Figure 1 with the mitochondrial gene structure.

Reviewer #2: The authors sequence and annotate the mitogenomes of four mantises species and combine this new data with existing mantis data to estimate phylogenetic relationships in the group. They find a few missing genes in some of the four new mitogenomes, but tRNA secondary structure and codon usage was similar to other mantises. The phylogeny also tended to agree with current taxonomy.

I think the study is definitely a worthwhile addition to insect mitogenomics. I particularly appreciate that you discuss your findings in the context of insect and mantis mitogenomics. However, I do have several issues that should be addressed, some more major then others:

1. You need to re-work some of the structure in the Introduction. For example, the second paragraph introduced mitogenomes and then abruptly switches to introducing the taxonomy of mantises. I would separate these.

Reply: Agree. We have separated the two parts. Please check the line 53.

2. Because the Methods comes last, I would include some brief methodological details in the Results and Discussion section.

Reply: Thank you. We have added the brief methodological details in the Results and Discussion section. Please check lines 78-83.

3. Please include more specific results. For example, you vaguely state that there is a high A+T% and list the most-used codons. Please provide specific values in the text.

Reply: Agree. We have added the whole genome, A+T-rich region and PCGs specific values of four mitochondrial genomes. Please check Table S2.

4. You begin discussing the utility of using cox1 as a barcoding gene (starting line 151), but this discussion appears abruptly. Why is this relevant? Is it related to your nucleotide diversity results? Please explain.

Reply: Thank you. The dN/dS pairwise analysis showed that cox1 is undergoing a robust purifying selection (0.028). That is why cox1 can be used as a molecular marker of barcoding entire Mantidae. We also reorganized the writing of this part. Please check lines 152-153.

5. I’m a little confused by your sampling strategy. Did you sample the 35 mantis species mentioned in lines 189-190? Or were these taken from GenBank?

Reply: We have reorganized the writing of this part. Please check lines 189-193 and Table 1.

6. I am not convinced you are actually missing the atp8 genes. In my experience, it can be difficult to annotate this gene, and you often have to look for it manually based on ORFs, etc. It also seems like there is a non-coding region on the 5’ end of your atp6 genes when a “missing” atp8 is reported. I would bet that is the atp8 gene. Also, were your missing genes confirmed with your PCR step? Finally, it looks like both atp6 and atp8 are missing from one species (bottom left in Fig 1), but I didn’t see any discussion of this. Please elaborate.

Reply: Thank you for this advice. We know ATP8 which is difficult to annotate. We repeated to analysis the sequence for annotation of ATP8, and in addition we ran the PCR to amplify the corresponding part of about 1000bp to confirm the sequence. Unfortunately, we could not annotate the relevant homologous sequences. For the ATP6 of Macromantis sp. species, we have added this annotation name in Figure 1 (bottom left in Fig 1) and the Table S2. Please check Figure 1 and Table S2.

7. Did you confirm that these assembled mitogenomes are in fact complete and circular? I recommend doing this, especially since you report missing genes.

Reply: We thank this referee for his/her comment. We received the assembled mitogenomes sequence and this was confirmed by PCR technology. The starting and the ending of sequence overlapped with 184bp, so we are sure that this is a complete and circular structure. We redesigned the primers for PCR and sequenced the PCR product to confirm the sequencing results. The primers are listed in Table S1. We also used ORF Finder and BLAST search engines against the GenBank database to identify protein-coding and rRNA genes. Please check the lines 206-208.

8. Please provide more methodological details. For example, how did you calculate Ka/KS? What were your PCR conditions? What GBlocks parameters did you use?

Reply: We agree and have added the methods of calculating Ka/KS. Please check lines 219-221. We also added the conditions of long PCR reactions. Please check lines 213-217. Also the GBlocks parameters were added in lines 237-239.

9. There are several portions of the manuscript that are difficult to read. I recommend going through the text and again and edit for grammar, awkward phrasing, etc.

Reply: Thanks for your suggestion. We polished the text and revised the corresponding parts.

Some minor comments:

Line 25: There is no context for referencing the “Schwarz and Roy (2019) taxonomic system.” Perhaps just say “the latest taxonomy.”

Reply: Done; please check lines 26-27

Line 31: No need to say “respectively.” Same in line 82.

Reply: Done; please check lines 31, 84

Line 42: Be careful about using “bugs” when you mean “insects.” Entomologists will strongly object to this usage…

Reply: Done, please check line 42.

Lines 74-78 should be in the Introduction

Reply: Agree. We have moved this text to the Introduction. Please check line 64-68.

Line 100: Why do you rule out this second possibility? Please elaborate.

Reply: We apologize for this. Indeed the second possibility is also very likely. So, we have reorganized this text part. We have deleted our conclusion: “We concluded that a lack of the atp8 gene in D. truncate and D. lobate is most likely because of the former or the later reason.” Please check lines 112-113. Thank you.

Line 144: Please provide a brief overview of dN/dS ratio (i.e., dN/dS > 1 is evidence for positive selection, < 1 for purifying selection, and =1 for neutral).

Reply: Agree. Please check lines 151-152.

Line 217: Confusing phrasing. Please re-write. It’s not clear what “miniscule to align means.”

Reply: We thank this referee and have rephrased this part text, which means Nad4L is too short to align among the Mantodea species. ATP8 was not identified in D. truncate and D. lobate. So nad4L and atp8 were excluded in the phylogenetic analysis. Please check lines 238-241.

Figure 1: It’s not clear which mitogenomes go with each species. Please add names to the figure.

Reply: Thanks and done.

Attachments
Attachment
Submitted filename: R1-rebuttal letter-final.docx
Decision Letter - Ben J Mans, Editor

PONE-D-21-03889R1

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

PLOS ONE

Dear Dr. Smagghe,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Minor issues were raised which can be considered since they will improve the manuscript somewhat.

Please submit your revised manuscript by Aug 09 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ben J Mans, PhD

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: Thank you for your thorough responses and edits to your manuscript based on my comments. I think the manuscript has been improved. I do have a few comments that still should be addressed, based on my first round of comments:

1. I still think the paragraphs in the Introduction are a little disconnected. Perhaps switch paragraph #2 (on the utility of mitogenomes for mantid phylogenetics) and paragraph #3 (on mantid taxonomy).

2. I think you should add the AT% to the main text, not just in a supplement.

3. I’m still somewhat skeptical that the atp8 gene is actually missing, but your combination of NGS and PCR results are more convincing. It is difficult for me to fully evaluate this claim without access to the sequence data; but as is stated in the manuscript, atp8 and other genes are missing from other taxa. Is this the first case of missing mt genes in mantises?

4. I recommend one more round of editing for writing clarity. For example, Lines 50-51 are a little confusing, and should probably be split up into two sentences.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Revision 2

26/06/2021

Dear Editor,

Thank you very much for your email message regarding our manuscript entitled “Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses”.

We appreciated the valuable comments from the reviewers and editor to revise and improving our manuscript. Generally, we have incorporated all suggestions and comments into this revision. More specifically, our adjustments are stated below in a point-by-point manner.

We hope that this revised version can be accepted for publication.

Most sincerely,

All authors

Reviewer #2:

Thank you for your thorough responses and edits to your manuscript based on my comments. I think the manuscript has been improved. I do have a few comments that still should be addressed, based on my first round of comments:

1. I still think the paragraphs in the Introduction are a little disconnected. Perhaps switch paragraph #2 (on the utility of mitogenomes for mantid phylogenetics) and paragraph #3 (on mantid taxonomy).

Reply: We agree and have switched the paragraph #2 and paragraph #3. See lines 46-68.

2. I think you should add the AT% to the main text, not just in a supplement.

Reply: Indeed, we have added the AT% information to the main text; see in Table 2.

3. I’m still somewhat skeptical that the atp8 gene is actually missing, but your combination of NGS and PCR results are more convincing. It is difficult for me to fully evaluate this claim without access to the sequence data; but as is stated in the manuscript, atp8 and other genes are missing from other taxa. Is this the first case of missing mt genes in mantises?

Reply: Thanks for your suggestion. Here we attach mitochondrial sequencing results for D. truncate species, and we really did not identify the atp8 gene. So, we imply that atp8 gene may have been lost. Yes, from our sequence of D. truncate and D. lobata, we can confirm the atp8 is lost. This is the first case of missing Mt gene in mantises.

TAATTATCCCATGAAAGATTAGTATTAAACCAATAACTCTAAATTTATTTTAAATAATAGAGTAAAATGCCTGATTTAAAAGGAATATCATGATAGGATAAAATATGTAAATTAATTACTTTTACTAATATTATCATTACACATAACAGAGTTAAACTGTTTCCTAAAATATCAAAAATTTTTGTGCATCCTACACTAAAATATAGAAAAGTAAGCTAAATTTAAGCTAATGGGTTCATACCCCATATATAGAGTTTACACTCTCTTTTCTAGTGCCCAACAATTCGATAAAAATCCTCTTTTTAATAACTTTAATTAGAGGTGTGTTAATTTCATTATGTGCTAATTCATGAATAGGAGCATGAATAGGATTAGAAATTAACTTACTCTCCTTCATTCCTTTACTTTCTTCCAGAAAAAACTTGTTCTCAACTGAAGCTTCACTTAAATATTTTCTTATTCAAGCTATTTCATCATCTACATTTCTATTTCTAATTATGATAAAAATTAATATCCAAGAAATGTTTTATCTAATAAAATTTAATAATTGAAACACCTTAATTACAATTCCTATTCTAATGAAAATTGCATCTGCACCTTTTCATTGATGATTACCTTCCGTGATAGAAGGTTTATCTTGAATAAATTGTTTTATTATTCTGTCAATTCAAAAAGTAGCCCCATTAATATTCATTTCCTACTTAATCACTAATAACTTCTTTATTCAAATCATCATTACAATTTCTGCAATTATAGGAGCTATTGGAGGTCTCAATCAAATTTCTCTACGAAAAATTTTATCATTTTCATCTATCAACCATATTGGATGAATATTAACAACCATAATTATAGGTTCTAACTTTTGAATAACATACTTTATCATTTATACGGTAAATATTATCCCTATTATTTTTATGGTAAACAAAATAAACCTATCTTTTATTCCTCAGACCTTTAATTCCTTCAATAACAAAAAAATTATTAAATTCATTCTATTTATCTCCCTCCTTTCTTTAGGGGGCCTCCCTCCTTTTATTGGTTTTTTCCCAAAATGAATTATCATTCAAATTATAATCCAAAATTTAATAATTCTTACATCAATAACCCTAATTATATCCTCCCTTTTAACCCTTTATTATTATCTACGAATTATTTACACAACATTAATAATCACAAATTCAGAAATAACTTGAATAGCAATCTACTCAAATAACAACTTAGGAAAAAGAACATTTCTTTTCTTATTCATTCTTATTTTTGGTTTATCAATCTGTACACTTATCTTAACAATCTATTAAGATTTTAAGTTAACCAAACTAATATCCTTCAAAGTTATAAATAAAGTGATTCATCTTTAAGTCTTAGTATTACTTACACCTTTAGAATTGCATTCTAATATCATCTCCATGAATATAAAACTTTAGTAAAAGAGATAATAATCTCATTAATAAATTTACAATTTATTACCTAATATCAGCCATTTTACTTTTTTTTTTGCAACGATGATTATTCTCAACAAATCATAAGGATATTGGAACATTATATTTTATTTTTGGTGCATGGGCAAGTATATTAGGAACATCTTTAAGAATTTTAATTCGAACAGAGTTAAGACAACCCGGATCTTTAATTGGAGATGATCAAATTTATAATGTCATTGTAACAGCTCACGCTTTTATTATAATCTTCTTTATAGTTATACCCATTATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATACTTGGAGCTCCAGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTATTCTATTTCTTATTATCGGAAGAGTTGTAGAAAGAGGAGCTGGTACAGGATGAACAGTCTATCCCCCTCTTTCAGCCAGAATTGCTCACGCCGGCCCCGCAATTGATTTAACCATTTTTTCCTTACACTTAGCTGGAATATCAAGAATTATAGGAGCTGTAAATTTTATCACAACTATAATTAACATAAAATCAATTCATATAAATCATACTCAAATTCCTTTATTTGTTTGATCTGTAGGAATTACAGCAATTCTTCTTCTTTTATCTCTCCCTGTACTTGCTGGGGCAATCACTATACTTCTAACTGATCGAAACTTAAATACATCCTTTTTCGACCCTGCTGGAGGGGGGGATCCTATTCTCTATCAACATCTATTTTGATTTTTTGGACATCCTGAAGTATATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATGTCATTTCTCATGAAAGAGGAAAAAAAGAAGCTTTTGGAAATTATGGAATAATTTGAGCTATATCAGCCATTGGTTTTCTGGGGTTTATTGTATGAGCTCATCATATATTTACAGTAGGAATAGATGTAGATACACGAGCCTACTTTACAGGAGCTACTATAATTATTGCTGTTCCTACGGGTATTAAAATTTTTAGTTGACTCACAACTATATACGGAACAAAAATAATTTATAGTGTAGTATCTTTATGAGCATTAGGATTTATTTTTTTATTTACAGTTGGAGGTCTTACAGGAGTAATTTTAGCCAATTCAGCTATTGATATTATTCTTCATGACACTTATTATGTAGTAGCCCATTTTCACTATGTACTTTCAATAGGAGCCGTTTTTGCTATTATAGCAGGGTTCATTCATTGATATCCCTTATTCACTGGATTATCATTAAATCCTAATTGATTAAAAAGTCAATTTTTCACAATATTTGTAGGAGTTAATTTAACATTTTTTCCACAACATTTCTTAGGATTAGCTGGAATACCTCGACGCTATTCAGATTACCCTGACGCCTATAGATCATGAAACTTCTTATCATCTGTAGGAGCAATAATTTCTTTCGCTGCTGTTATCATATTCATTCTTATCTTATGAGAAAGAATTACCTTAAATCGATTTATATTATTTTCATCTCAAATAAATAGATCAATTGAATGAATTCATAATTTTCCCCCAGCTGAACACACCTACAATGAACTAACTCTAATTACAAATTAAAACCTAAATTGTTGATAATTTTCCTCATTTCTAATGTGGCAGAATAGTGCACTGGGTTTAAGCTCCAAAAATAAAGATAAACTTTTTTTAGAAGTTATTTTAATGGCTACAAATGCAAATTTAGGATTTCAAGATAGAGCCTCCCCCTTAATAGAACAACTCATGTATTTTCATGATCATTCCATATTTATTATTACTATAATTGTAATTACAGTAAGTTATATAATTATAGCTTTAATAGTAAATAAATTTTCTGATCGTCATGTTATAGATGGTCAATATTTAGAAATTTTTTGAACAGTTCTTCCAGCCATAGTTCTAGTCTTCATCGCTCTACCTTCTCTACGGATTTTATACCTAATTGATGAAAATACAAATCCAACATTAACCTTAAAAACAATTGGTCATCAATGGTATTGAAGTTACGAATATTCAGATTTTACCAATATTGAATTTAACTCTTACATAATTCCACAAAATGATTTAAATCTATTTAACATGCGTTCACTTGAAGTTGACAATCGAACATCATTACCCATAAATACCTTAACACGAATTTTAATCACCTCAGATGATGTTATTCATTCTTGAACAATTCCGAGAATTGGAGTAAAAGCTGATGCTACTCCGGGACGATTAAATCAAGCAACATTTTGATTTAATCGTCCCGGAGTATTTTATGGTCAATGTTCAGAAATTTGTGGAGCAAATCACAGATTTATACCTATTGTAATTGAAAGAACTTTGATTAATAATTTTCTTAGTTGAATCTTAAATTATATTGAATCACTAGATGACTGAAAATAAGTGATGGTCTCTTAAACCATATCATAGTAACATAATAACTACTTCTAGTGATTGACTAACAATTTATCAAGAAGTTAGTTAAAAAATAACATTAGTATGTCAAACTAAAGTCATTATCATTTAATACATCTTTATACCCCAAATAATACCCCTAAATTGGCTAATCCTATTTTACATTGTTTCTACTAGATTAATTTTTTTTAATGTAATAAATTTTTTTATATTTTCCCACAAAATCCCATTAACTTCAAATAAAATTTTACTAAAAACCCTAATTTGAAAATGATAACCAACCTATTTTCAATTTTTGATCCCTCTTCAAATTTTATAAACCTATCAATAAATTGACTTAGAATTTGAATCGGATTATTATTATTTCCTTCCTCGATATGGTTAATTTCATCACGAAATAAAACCCTTTGAAGTTTTATTTTAAGTAAACTTCATGAAGAATTTAAATTATTAATTGGTAAAAAAAAAATTAACAAAGGATCAACATTCATATTTATTTCAACATTTTTACTTATTATATATAATAATTGTATAGGATTATTTCCATATATTTTTACTGGGACAAGTCATATAGCTATAACTCTATCTTTTGCTTTACCTTTATGACTAAGATTTATACTCTTTGGTTGAATTAATAACTCTAATCACATATTTATTCATTTAGTTCCTCAAGGAACTCCAAATATATTAATACCTCTTATAGTTTGTATTGAAACAATTAGAAATTTAATTCGTCCCGGAACTTTAGCTATTCGACTCGCAGCAAATATAATTGCAGGACATTTATTAATAACCCTCCTAGGAAATTCTGGGAGAAACATTATAGATTCATTTTTACCCCTATTAATTTTAGTTCAAATTATACTTTTAACTCTAGAATCCGCAGTTGCTATTATCCAATCATATGTTTTTGCAGTATTAAGTACTTTATACTCTAGAGAAGTAAATTAATAATGATAATACACACTAATCACCCCTACCATTTAGTTACTTATAGTCCCTGACCTATTATAACTACTTTAAGAATCATAATCATAATATTAGGTTTTATTAAATTTTCTTATGAGTTTAGTGAAAAATTTATGCTATTAGGAACTTTAATTTTAATTTTAATTACTACTCAATGATGACGTGACGTTGTACGAGAAAGTACATATCAAGGATTACACACTAAAAAAGTAATCTTTGGACTACGATGAGGAATAATTTTATTTATTATTTCAGAAATTTTTTTCTTTGTATCTTTTTTTTGAACTTTTTATCATAGAAGCTTAACTCCTACTATTGAATTAGGGTCCTTTTGACCACCTCAAGGAATCTGACCCTTTAATGCTCTTCATGTTCCTCTTCTTAATACAACGGTACTTTTAGCATCAGGCATCACTATTACATGAAGTCACCATGGACTATTAATAAATAATTATAATCAAGCCACCCAAGGATTAATATTTACCATTATCCTTGGGATTTATTTTACCATCTTACAACTCTATGAATATTATGAAGCTCCGTTTACAATTGCGGATTCAGTTTTTGGGTCAATCTTTTTTATAGCAACTGGATTTCATGGACTTCATGTAATTATTGGAACTACATTCTTAGTTACATGCTTATTTCGAATAATTTATAAACATTTTACATCTATTCACCACTTTGGTTTCGAGGCAGCAGCCTGATATTGACATTTTGTGGACGTAGTATGATTATTCCTGTACATTTCTATTTATTGATGAGGGAGATAAATCCAATTTATTTAGTATAAAAGTACAATTGATTTCCAATCAAAAAGTCTATATTTAATTAGAATAAATAATTAAAATTTTAATTTTTATCTCATTCATTACTATATCAATTACCTTAACAATCATATTACTAACAAATTTCTTGTCAAAGAAAAAAATTGAAGACCGAGAAAAAAATTCACCTTTTGAATGTGGATTTGATCCGATTAGATCCTCGCGCCTTCCCTTTTCTTTACGTTTCTTTTTGATTGGAGTAATCTTTTTAATTTTTGATGTAGAAATCGCCTTTATCTTACCAATAATTATCATTCCTCTTACATCAAAAATAACATCTTGAATATCTACTAGAATTATATTCTTATTGATCTTAACAACTGGTTTATTTCATGAATGAAATCAAGGTTCTCTCGACTGAGCAACTTAACTTTATAAGGGTTATAGTTAAAAATAACATTTGACTTGCACTCAAAAAGTATTGAAATATCAATTTTCCTTATTATAAGTAAGAAGCAAATTCATTGTAATCAGTTTCGACCTGATAGTAAGATATTCATATCCTTATTTGTTGATTAATTGAAACCAAATAGAGGTATATCACTGTTAATGGTAAAATTGAAATTAATGCTTTCCAATTAAGAAAATGTGTAGATCGAATATAAGTTGCTAATTTATTATTCAAGTGGTTTAATCCCATTTACATTTTAATTTATATAGTTTAAATAAAACATTACATTTTCATTGTAAAAATAAATTTTTCAATTTTATTAATAGTAAGTACTCTATTTAAAGATAAATTAGTTATCTCAATAACAGCTTCAATGTTATACTCTCTATAAGATATTTAAATAAATACAAAATATTATTATAAGTAAAATACTAAAAAAAATCATTAAATAAGATTTTAAATCATTATATTGAAATCATTGATTAAAACATCTTAATTTTATCAAAATATAATATAAATTTTGTGCTCCAAAATATTCTCTTCAGCCTAAATCAATATATATCATTGAATTTAAACTAATAATTAAAGGTATTTTTCTTACTCCTTTAGTAAAAATTAAAGGTATATATCATATTGAAGCAAAAAAAATTGTCATTTTATAATACTTAAATGTTGAAAAATAATAATTTATTCTATACTTAAATATAATTCTTCCTAATCATAAACCTACAAATCTACCTAATAAAGGTATTATTTTCATTATTAATGTCATATAAATTATATAGGGAGTAAGAAAAATAATCCAATTTAATATCCCACCTCCAATAATTGCAAATAATATTAAACCTAATATTCCATATACTATTATTCAACTTTCATTTAATTTACATATTGATATTATATTAAAATCTCCTCATAATACATAATAGGATAAACGAAAAGAATAACTTACTGTTAAACCTGTTGAAAAAAAAAATAAAACATATATAAAGATATTTAAATTTCTTAAAGATAATATTTCTAAAATTATATCTTTTGAATAAAATCCTGCTAAAAAAGGTATACCACATAAAGCAAAATTTGATACTATAAAACAAGATGAAGTAAAAGGCATAAATATTACTAAATTTCCTATAAAACGAATATCCTGTAAATTTTTTATTCTATGGATTATTATTCCTGTACACATAAATAACAATGCCTTGAATAAAGCATGAGTTAATAAATGAAAAAAAGCCAAATCTGAAAAACCTAATGATAAAATTCTTATTATTAATCCTAATTGACTTAAAGTTGATAAAGCAACAATCTTTTTTAAATCATATTCAAAATTTGCTCCTAACCCTGATATAAACATTGTTAAAACAGATATTACTAGTAAAAACTTTAATAATCAATCCGGAAAAACCTTACAAAATCGGATTAATAAATAAACCCCAGCCGCAACCAAAGTTGATGAATGAACTAGGGCTGAGACAGGAGTTGGAGCAGCTATTGCTGCAGGCAATCAAGCTGAAAAGGGAATTTGTGCACTTTTTGTTATTCCTGCTAAAAGTACTAAAAATGAAATTAAATATATTTCAATTTCATTTAATGTACAATCTAAATAAAAAATATAATTTCATCTTCCAAAATTTAATATTCATGAAATTGCTATTAATAAAGCAACGTCCCCTACTCGATTAGATAAAGCTGTCAATATTCCAGCATTATAAGACTTAGTATTTTGATAATAAATTACAAGACAATAAGAAATTAAACCTAACCCATCTCAACCTAATAAAATTCTAATCAAATTTGGACTAATAATTAAAAACATTATAGACAATACAAATATTAATACTAAAAAAATAAACCGATTTAGTGATGAATCTCCAGTTATATAATCTTCTCTATATAAAATTACTAAGGATGAAATTAATAAAACAAAACTCATAAATATGAGAGACATTCAATCCAACAATATTGTTATAACAACTGAAGAAGTACTTAATCTAACAATTTCTCATTCAATAAAAATAATTAAATCATTTAAAATAAAAACCATTCTAGAAATAAATATTATTAAAGAAAATAATGCTAATAAAAAAAATCTAATAAAACATAATGATAAATAAACCATAACTTAAAATAACTATTCATTATATCCATGATACCACAAATCATAATTTTATGATAAACTATTTAAGTAAATTAACTTTTATTTAAAATCAAATTAAAACATAATCTCTCTTTAAAATTAATAAATTTAAGGGTAATCAATGAAGTATTATTAATAAATATTCACGTCTATACCCTCCAACTCTTCTATAAATGCCTGAATAATAAAATCCATGTTGACTATATGAATATAAATATAAAGTATAAGCAGCTCTAAAAAATGAAATTAATATAAGAAAAAATATAGATATTCATACCCAACTTACTATACTATTGAATAATCCAATTTCTCCTAATAAATTTAAAGTAGGGGGAGCAGCTATATTGCTAGATGAAAGTAAAAATCATCATAATGTTAAACTTGGCATCAAATTTAATAAACCCTTATTAATTAACAATCTTCGTCTTCCCAGACGCTCATAACTAATATTAGCTAAACAAAATAAACCAGATGAACATAAACCATGAGCAATTATTATTACAAAAGTTATATAAAACCCTCAAATATTTAATGTTATTAAGCCCCCAATAATTAAACCTATATGAACCACAGACGAATAGGCAATTAATGCTTTTACGTCTATTTGACGTAAACACATTAAACTAACTATAACCCCACCGATTAATCTAGTAGAAAATCAAAATACATTAACTAATATCCCAACTCTCTTCAAGAATTCATATACTCGTAATAAACCATAACCTCCTAACTTTAATAAAACTCCAGCTAAAATCATTGAACCTGAAACTGGAGCTTCAACATGAGCCTTAGGTAATCATAAATGCACTAAAAATATAGGCATCTTAATCAAAAAAGCTAAAATTATTCTAAAATATAAATATCAATTCAATAAATTATTTTTATAAACTAACGAAAAAACTAAATAGCCCATGTTGTTATAAAAATATATAATACCCATCAATAATGGTAATGAAGCTAAAAGAGTGTATAATAATAAATAAATACCAGCTTGCAATCGCTCAGGTTGATATCCTCACCCAAAAATTAAAAATAAAGTTGGAATCAAACTACCCTCAAAAAAAAAATAAAATGAAATGAAATTTATTCTACAAAAAGTACAAATTAATATCAATAACAATATTAAAATTATAAATATAAATAAATTATTATAAAATTTATATCGAATAACAGAATAACTAGCTAAGATTATTAAAACACAAATTCAAAATCTTAGCACAATAAGACCATATGATAAGTAATCATATCCAAATATATAACTCATTCTTATTCAATAAAAAAAATCCACTCCAATAAAAAATTTAAAAGATATAAAAAATAATAAATTCTGAATTAATAATCAATTTTTATTCATTAAACATAATGGAATCAAAAACATTAAACTTAAAATATATCTTAACATTGCAATAAGCTAAACGAATTAAAATAATCATTTCCATGAGTTCGAATTATAGAAACCAAAATTGATAATCCTAATACACCTTCACAAACTGCAAATGAAAGAAAAATTATAGTCATATATAACTCTCCTCTTATTATTAAATAAAAATACAAAATAATGAACAAAACTAAAACAATAAATTCTAAACTTAATAAAGTTACTAATAAATGTTTACGTCCAGAAGAAAAAACTCACAAACCACATAAAAATATAAAACAGAATATTATTAACATTTTTTAGTTTTAATAGTTTACTAAAAACACTGGTCTTGTAAACCAAAATTAAGAATAATTACTTTTAAAACTTCAAAGGAAAGAAACTCATCATTAATTCCCAAAATTAATATTTTATTATTAAACTACCCTTTGATATTTTATACTCATTATTAACTATAAGTTTAATTTTAAGAATTACTTTGATATTTTTAAATCATCCAATATCTATAGGTTTTATCCTTTTTATTCAAACGTTATGCTTATGTTTTATTAGAGGTTTTATATCACTAAGATTTTGATTCTCCTATGTATTATTATTAATTTATTTAGGAGGAATATTAATTTTATTTATATACATTACCAGATTAGCCTCAAACGAATTATTTTCTTATTCAAATAAAATCTTATTAATTATTTTTTTAGTACCCCTTATCTTAAGACTTATCCATTATACAAGTTTTTATCATCAAACAAACTTATATGAAAATATAGAAAATAGAATAAATTTCATCTTTATACCAAACAACTTTTTATTAAAGATATATAATTATCCTAATAACATTATTACAATCTTAATTGCCTGTTATTTATTTTTAGCTTTAATTGCAGTTGTTAAGATAACAAATATTTTCAAAGGACCCCTACGACAAATAAATTAATAATGTTTAAACCCTTACGAAAAACTCACCCTATCATCAAAATTTCCAATAATGCCTTAGCAGATTTACCTTCACCATCAAATATTAGATCATGATGAAATTTTGGTTCCCTTCTAGGCTTATGTTTAATTCTTCAAGTAATTACAGGACTATTTTTAGCTATACACTATTCAGCTCATATTGATTTAGCCTTCTCAAGAGTGATTCACATTTGTCGAGATGTAAATTATGGGTGACTTTTGCGAATTCTTCATGCTAATGGTGCTTCAATATTTTTTATTTGTATTTATCTCCATATTGGACGGGGGATATATTACGGATCATATAAATTTTATTATACATGAATAATTGGAGTAATAATTCTATTTTTATTAATAGCGACAGCATTTATAGGTTATGTATTACCATGAGGTCAAATATCATTTTGAGGTGCCACAGTAATTACTAATTTATTATCTACTATTCCCGGATTTGGAAATGAATTAGTTCAATGAGTTTGAGGGGGTTTTGCAGTAGATAATGCTACCCTAAACCGATTTTTCACATTTCATTTTATTTTACCATTTATTATTGTAGCAATAATTGCAACCCACTTATTATTTCTTCACCAAACTGGATCAAATAATCCCTTAGGTACTGATAGTAATATTGATAAAATTCCGTTTCACCCTTATTTCACATTTAAAGATATCTTAGGATTCATTATATTATTAACACTTCTATCCCTCTTATCTCTTAAAGAACCCTATATCCTAGGAGATCCTGATAATTTTATTCCTGCTAACCCTCTTGTTACTCCAGTCCACATTCAACCAGAATGATACTTTTTATTTGCTTATGCTATTTTACGCTCTATCCCTAACAAGCTAGGAGGGGTGATTGCTCTAGTAATATCTATTATAATTCTAATTATTATACCTTTCATAGATACTAACTTACGAAGATTTCAGTATCATCCTATTAATCAATTCATATTTTGATTTATAATTATAACTATTACACTTTTAACATGAATTGGAGCACGCCCTGTTGAAGACCCTTTTATCCTAGTAGGACAAATTCTCACCATTATATACTTCCTTTTCTATATCATAAACATTTTAATTATCAAGGTATGAGACCATATTATACAATAATAAATAAGTTATAAACTTAATGTTAAGATTATGTCTTGAAATCATAATAAAGGGGTTAAATTCCCTTATTAACTTTACTTCATCCAACCCTTAAAATAAAATTTTTAACCCTAAATAAAAAAACAAAAAATTTAAAGATAAAGGTAAAAAGCTTTTTCACGCTAAATATATTAATTTATCATATCGATATCGAGGAAGAGTTCCACGAACTCAAATATATATAAAAGCAATAAAAATCAACTTCAAATAAAATACAAATGAATCCAAATTAGAACCCAAAAAAATTACACATATTAACATTCTTATAAATAAAATTCTTGAATATTCTCCTAAGAATATTAATGCAAAGCCTCCCCCTCCATACTCAATATTAAAACCTGAAACTAATTCTGACTCTCCTTCAGCAAAATCAAAAGGTCTACGATTTGTTTCTGCTAAACATGACACTATTCACACATTACACAATGGTAAGTATAAAAATAAAAATCAAATATTCATCTGATAATAAAAAAAATCCATTAATGAATAACTTCCAATTAAAAAAACAAAAGATAATAAAATTAAGGCTAATCTTACCTCATAAGAAATTGTCTGAGCAATTGCTCGTAAACTCCCTAATAAAGCATAATTAGAATTTGAAGATCATCCAGCTAACATAACTGCATAAACACCTAAACTTGTACATACTAAAAAAAACAACAAACCCAAATTAAAAGTAAATAAACCTCTTATATAAGGAAATAATATTCATAAGATTAAAGATAAAAATAAAGTAAATATTGGACATACATAATATAATGAATAATTCGAAACTAAAGGATTTATATATTCCCTACAAAACAACTTTACAGCATCACTGAATGGTTGTAAAATACCAATAAATCCAATCTTATTAGGACCCTTACGAATATGAATGTATCCTAAAACCCTACGTTCTAATAAAGTAAAAAAAGCTACCCCAACTATAACAAAAATAACTAAAATTAACCCTACTAATATTATTAAAAGTACTTCACTAATTAACATTTACTATCTATAATTCAATTTATCTATTTAGGTTCTAAACCTATTACACTTTACTCTGCCAAAATAGTTTTATTAATAATATTCTTTTTCCTTCATAAAAATTATTTCAAATATTTGGTCCTTTCGTACTAAAATATTCTAATTAATTAAAGATAGAAACCAACCTGGCTCACGCCGGTTTAAACTCAGATCATGTAAGAATTTTAAGGTCGAACAGACCTAGTTATTAAACATCTACATTCAAAACTAATCTTAATCCAACATCGAGGTCATAATCTTTTTTTTCAATATGAACTTTCAAAAAAAATTATGCTGTTATCCCTAAGGTAATTTAATCTTCAAATCATTAACCATGGATCTTAAAACTTAATATAATATTAAACTCAAAAAAGAGTTCATTTTATCTTTTAATCACCCCAATTAAATATATTTCACATAGATAATAAATTCATTATTTTAACTTTATTAAATTCAAATATATATTAAACTCTATAGGGTCTTCTCGTCCCTTAATTTTATTTAAGTATTTTTACTTAAAATCTAAGTTAAATTAAATTATTATAAAATAGTCTTTACTTCATCCAACCCTTCATACTAGCCCTCAATTAAAAGACTAATGATTACGCTACCTTTGCACAGTCAATATACTGCGGCCCTTTAAACCACATTCAGTGGGCAGGTTAAATCTCTTATTTCCCCAAGAAACCATGTTTTTAATAAACAGGTGAGTAAATTATTTGCCTAATTCCTCATATTAACATTACATTTCATTCACAAAATAATCCAGACTTTACTAATTAAATCATACTTACTCACTTTTTTTTATTTAACTTAACATTTTAATATACATACTAAATAATAACTAAAAATTTTAAACAAAATAAGAATTAAATTTCAACATCCTTAAATTAATAACAAATTCTAAATTTATACAATTCTTCATTAATAAATTATTATAAATATTCTTCAAAAAGATTTTCCCTTTTAAAGTCAAGAAAACAAAATATTTAAATATTTAAATATTTAATAAATTATATTCTCTAAATTAAATCTATTTATTAAAAAACTAGATATTATTGAAAACGATTAACATTTCACTACTAATTAATAATTCTTAATATTTATAATACAATAATTAAAACTATTAATTAAATCTTTCAAATTCAAGAAAAAAAAAATTAATTATTAATTTCGATATACTCTGAAACACAAGATACAATAAAAAAAATCAACTTAAATTAATTATATAATATTAAACTTCTTTTACAATACTAATTTACTATAGTATTAATTATTATCTCAATTGATAATACAATAACAAAATTTTAATTAATTTATATTCTAAATAATATCAAATCAAAAACAATCTTATGAATTTCAAATTATATTGAATTGCACAATAATAATTTTCAATGTAAATGAAAATCCTTACCTTTAAGTTTAATTTGTTCAAGTGACTTTCTAGGCACACCTTCCGGTACGCCTACTTTGTTACGACTTATCTCATCTTAATATGAGAGTGACGGGCGATGTGTACATATTATAGAGCTATTAATCATTTTAACAAACTTCATAAAATTACAATTAAATCCACCTTTAAATTACTTTCCAATAATTATCCATAATAAATACAATTTATTGTAGTCCATCATCAAACTTACTTATTACTGCACCTTGACTTGAAATATTATATATTTTTATGCTCAGAAAATTATCTAAAAAAATATTCTCAAACAGCGGTATACAAAAATATAAAGTAAGTAAGGTCCAACGCGGATTATCAATTAAATAATAGACTCCTCTAAATAGGTTATAATACCGTCAAATTCTTTAAGTTTCAAGATCATATCTGCTAATACTTTAGTTTATTAATTTACCATAAAAATAATAGGGTATCTAATCCTAGTTTACCTTTTTAATCTCATAATCCATCATACTAACTAATAATTAATTAAAATATTTTAAAAACATTTCACCTTAAAATACTTTAATCATCATTTAACATTAATTAACATTAATTATTTAAAAACCAATATTATTTATTTAATTTCACTGTATCACCGCGGATGCTGGCACAATTTTTACCAAACTTTTATAACATTCACTAAATCTAAAATAATTTAATATCAATAAAATTACCTACTGCACAATTAACTTTATAAACCTCATTGAGAAAACTATAATATACACACATTCACATTCAGAATAACATTAAAACAAATAATCAAAGCAAGAATAAAACTAAATATTTTTTCCAAAAATCGAAGACCTGACATTGGAACACCTAACTTTTTTAATGATTTTTGTATACCTACAAATATTTGATTAAATTAATCATTGCTTCAATATATAAACTTTCAAAAAAAAAATCCACTTTACCCAAAAAATAAGTATGCTTTTTTTAAAACGTTTTCCTCCCTAGAAGTAGGAATTAAGTGCCCAATTCAATTCGATTTAATGTTTTTTTTTAAACATTGGTCTACTAAAGTATATTTAGTATATAATAAATTTAATTATATATATGTCTTATCAAAGATTAATAAAAAAAATATTCTCAAACAGCGGTATACAAAAATATAAAGTAAGTAAGGTCCAACGCGGATTATCAATTAAATAATAGACTCCTCTAAATA

4. I recommend one more round of editing for writing clarity. For example, Lines 50-51 are a little confusing, and should probably be split up into two sentences.

Reply: Thanks for your suggestion. Lines 50-51 have been split up into two sentences. Please check lines 56-57.

Attachments
Attachment
Submitted filename: R2-Reply letter-GS2.docx
Decision Letter - Ben J Mans, Editor

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

PONE-D-21-03889R2

Dear Dr. Smagghe,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ben J Mans, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Formally Accepted
Acceptance Letter - Ben J Mans, Editor

PONE-D-21-03889R2

Complete mitochondrial genomes of four species of praying mantises (Dictyoptera, Mantidae) with ribosomal second structure, evolutionary and phylogenetic analyses

Dear Dr. Smagghe:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ben J Mans

Academic Editor

PLOS ONE

Open letter on the publication of peer review reports

PLOS recognizes the benefits of transparency in the peer review process. Therefore, we enable the publication of all of the content of peer review and author responses alongside final, published articles. Reviewers remain anonymous, unless they choose to reveal their names.

We encourage other journals to join us in this initiative. We hope that our action inspires the community, including researchers, research funders, and research institutions, to recognize the benefits of published peer review reports for all parts of the research system.

Learn more at ASAPbio .