Peer Review History

Original SubmissionSeptember 1, 2020
Decision Letter - Klaus Roemer, Editor

PONE-D-20-27371

Verification of the role of exosomal microRNA in tumorigenesis for colorectal cancer using human colorectal cancer cell lines

PLOS ONE

Dear Dr. Lee,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please respond to all critique, point-by-point. In particular:

- The manuscript would greatly profit from a language checkup

- page 14 and table 1: provide information on the sample size

- The literature is in part outdated. One may consider some of the newer literature suggested by referee 1.

Please submit your revised manuscript by Nov 16 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Klaus Roemer

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.  

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

  • The name of the colleague or the details of the professional service that edited your manuscript
  • A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)
  • A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

3. Thank you for submitting the above manuscript to PLOS ONE. During our internal evaluation of the manuscript, we found significant text overlap between your submission and the following previously published works, some of which you are an author.

https://onlinelibrary.wiley.com/doi/abs/10.1002/jcp.26481

https://dmm.biologists.org/content/dmm/11/4/dmm029447.full.pdf?rss=1

https://molecular-cancer.biomedcentral.com/articles/10.1186/s12943-018-0897-7

https://peerj.com/articles/4928.pdf

We would like to make you aware that copying extracts from previous publications, especially outside the methods section, word-for-word is unacceptable. In addition, the reproduction of text from published reports has implications for the copyright that may apply to the publications.

Please revise the manuscript to rephrase the duplicated text, cite your sources, and provide details as to how the current manuscript advances on previous work. Please note that further consideration is dependent on the submission of a manuscript that addresses these concerns about the overlap in text with published work.

We will carefully review your manuscript upon resubmission, so please ensure that your revision is thorough.

4. At this time, we ask that you please provide scale bars on the microscopy images presented in Figure 2 and refer to the scale bar in the corresponding Figure legend.

5. Please provide additional information about each of the cell lines used in this work, including any quality control testing procedures (authentication, characterisation, and mycoplasma testing).

For more information, please see http://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines

6. In your Methods section, please provide additional information about the tissue specimens used in this study, the method used to collect them, and the demographic details of the patients from which they were collected. Please ensure you have provided sufficient details to replicate the analyses such as:

a) the date range (month and year) during which you collected specimens, 

b) a description of how participants were recruited to provide samples, and

c) eligibility criteria for being included in this part of the study.

7. Thank you for including your ethics statement in the Manuscript methods:

'Tumor samples from patients undergoing surgery were obtained at Ewha University Medical Center (Seoul, Korea) in accordance with the ethical guidelines of the institutional review board (IRB No. SEUMC 2019-12-028). All patients provided their formal, informed, and written consent, agreeing to supply a biopsy for this study.

CAFs were isolated from the tumor samples of patients.'

a. Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study and confirm that your named institutional review board or ethics committee specifically approved this study.

b. Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research

8. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

9. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is very attractive work.

Some minor comments:

1- Needs some language corrections

2- Add size marker to WB gels

3-Add the below references:

For CRC:

a-Epigenomics. 2019 Nov;11(14):1627-1645.

b-Lancet Gastroenterol Hepatol. 2019 Dec;4(12):913-933.

c-Pharmacol Res. 2020 Aug 18;161:105133.

d-Crit Rev Oncol Hematol. 2020 Jan;145:102854

For Exosome and Exosomal microRNA

a-Cell Commun Signal. 2020 Sep 11;18(1):149.

b-Cell Commun Signal. 2020 Aug 3;18(1):120.

c-Mol Ther Nucleic Acids. 2020 Sep 4;21:51-74.

d-Epigenomics. 2020 Feb;12(4):353-370.

4- Check primers sequences

Reviewer #2: This manuscript mainly about analyze the effect of exosomal miRNA on the tumor microenvironment, monocytic cell line THP-1 migration was evaluated by Transwell migration assay with CAFs isolated from colon cancer patients.,which contribute to providing new insights colorectal cancer. This article has obvious clinical value and scientific significance.

This paper is written smoothly with clear thinking and detailed

experimental methods, but there are some minor problems:

1. Page12,the line10 and 12 of the “Introduction”, Tumor-derived and cancer-derived should be unified.

2. Page13, the last setence of the 2nd paragraph, “When cancer arises in the adult organ, the dominant niche likely includes the expansion of quiescent fibroblasts residing in the host tissue in response to the injury caused by the developing neoplasm.” The difference between cancer and neoplasm? It may better to unify the same noun in the whole article.

3. Page13, “Cancer-associated fibroblasts (CAFs) are vital constituents of the tumor microenvironment”(the line5) and “CAFs which are vital constituents of the tumor microenvironment.”(the line16) may repeat?

4. Page14, What is the sample size? It should be specified, and other relevant information of the sample should also be specified in the Table1.

5. The Figure can be clearer? Especially Figure 1C and Figure 2B.

6. Some of references are old, it is better to learn from the latest views.

Overall, I think this article has certain innovation, but there are also some problems. I think this article needs to be reviewed again after revision.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Revision 1

Response to reviewers

General statement

1. The manuscript would greatly profit from a language checkup

� This manuscript underwent language editing by a professional scientific editing service (Editage) according to your recommendation.

2. page 14 and table 1: provide information on the sample size

� The colorectal cancer cells used in the experiment were not collected from patients, but cell lines that had been used in various existing studies manufactured by accredited institutions were purchased and cultured. Therefore, we think that it is not important to specify the sample size.

3. The literature is in part outdated. One may consider some of the newer literature suggested by referee 1.

� In accordance with the recommendations, the introduction and discussion were revised by citing the latest references, including those suggested by the reviewer 1.

Journal requirement

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

� The article was revised according to the proposed format.

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

� This manuscript underwent language editing by a professional scientific editing service (Editage) according to your recommendation.

3. During our internal evaluation of the manuscript, we found significant text overlap between your submission and the following previously published works, some of which you are an author. Please revise the manuscript to rephrase the duplicated text, cite your sources, and provide details as to how the current manuscript advances on previous work.

� To avoid duplication, the text and references of the manuscript were extensively modified as recommended.

4. At this time, we ask that you please provide scale bars on the microscopy images presented in Figure 2 and refer to the scale bar in the corresponding Figure legend.

� As pointed out, scale bars were inserted in the figure and added to the figure legend.

5. Please provide additional information about each of the cell lines used in this work, including any quality control testing procedures (authentication, characterisation, and mycoplasma testing).

� The points pointed out are added to the text as follows.

“All the cell lines were regularly tested using quantitative PCR, MycoTOOL PCR Mycoplasma Detection Kit (Roche Custom Biotech, Mannheim, Germany). The passage number of HT-29 cells and SW480 cells at purchase were P130 (#lot 700190500 and P99 (#lot 70013709), respectively.”

6. In your Methods section, please provide additional information about the tissue specimens used in this study, the method used to collect them, and the demographic details of the patients from which they were collected. Please ensure you have provided sufficient details to replicate the analyses such as:

a) the date range (month and year) during which you collected specimens,

b) a description of how participants were recruited to provide samples, and

c) eligibility criteria for being included in this part of the study.

� As recommended, information on tissue specimen sampling was added as follows.

“Between June 2020 and August 2020, two patients underwent surgical resection for colon cancer were enrolled in this study. The eligibility criteria were a histologically confirmed colonic or rectal adenocarcinoma and major resection of primary lesion. Patients who underwent preoperative treatment such as chemotherapy, radiotherapy, and endoscopic resection were excluded. Before surgery, patients were given an explanation of the purpose and risk of this study and decided to consent to tissue collection. All patients provided their formal, informed, and written consent, agreeing to supply a biopsy for this study.”

7. Thank you for including your ethics statement in the Manuscript methods:

a. Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study and confirm that your named institutional review board or ethics committee specifically approved this study.

� The IRB information was added as follows.

“The study and informed consent were reviewed and approved by the institutional review board of Ewha Medical Center Seoul hospital. (IRB No. SEUMC 2019-12-028).”

b. Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

� The above contents were added to the submission form.

8. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available.

� We uploaded the original blot image data in Supporting Information according to the journal’s guideline and noted it in the cover letter.

9. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

� As pointed out, we deleted the ethics statement outside of the methods section.

Reviewer comments to the author

Reviewer #1

1. Needs some language corrections

� As pointed out, this manuscript underwent language editing by a professional scientific editing service (Editage) according to your recommendation.

2. Add size marker to WB gels

� The image in Figure 1c was obtained by capturing the original image and cannot display a size marker, but a description for this was added. The original blot image with size markers is attached.

3. Add the below references

� The introduction and discussion were revised by adding the suggested references.

4. Check primers sequences

� As pointed out, We added the sequence of miRNA PCR primers for qRT-PCR of exosomal miRNAs as follows.

“MystiCq universal PCR primers, miRNA primers gas-MiR-1246 (AAUGGAUUUUUGGAGCAGG), gas-MiR-367-3P (AAUUGCACUUUAGCAAUGGUGA), has-let-7D-5P (AGAGGUAGUAGGUUGCAUAGUU), and SNORD48 (human positive control primer, AGUGAUGAUGACCCCAGGUAACUCUGAGUGUGUCGCUGAUGCCAUCACCGCAGCGCUCUGACC) were purchased from Merck.”

Reviewer #2

1. Page12,the line10 and 12 of the “Introduction”, Tumor-derived and cancer-derived should be unified.

� As pointed out, the terms were unified and reflected in the text.

2. Page13, the last sentence of the 2nd paragraph, “When cancer arises in the adult organ, the dominant niche likely includes the expansion of quiescent fibroblasts residing in the host tissue in response to the injury caused by the developing neoplasm.” The difference between cancer and neoplasm? It may better to unify the same noun in the whole article.

� As pointed out, the terms were unified and reflected in the text.

3. Page13, “Cancer-associated fibroblasts (CAFs) are vital constituents of the tumor microenvironment” (the line5) and “CAFs which are vital constituents of the tumor microenvironment.” (the line16) may repeat?

� The revision of the item was reflected in the text.

4. Page14, What is the sample size? It should be specified, and other relevant information of the sample should also be specified in the Table1.

� Colorectal cancer cells used in the experiment were not collected from patients, but cell lines that had been used in various existing studies manufactured by accredited institutions were purchased and cultured. Therefore, we think that it is not considered important to specify the sample size.

5. The Figure can be clearer? Especially Figure 1C and Figure 2B.

� We replaced the Figure 1C (and provide raw data as well) and Figure 2B.

6. Some of references are old, it is better to learn from the latest views.

� As pointed out, the bibliography of the overall article was revised to the latest reference and reflected in the text.

Attachments
Attachment
Submitted filename: Response to reviewers.docx
Decision Letter - Klaus Roemer, Editor

Verification of the role of exosomal microRNA in colorectal tumorigenesis using human colorectal cancer cell lines

PONE-D-20-27371R1

Dear Dr. Lee,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Klaus Roemer

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Formally Accepted
Acceptance Letter - Klaus Roemer, Editor

PONE-D-20-27371R1

Verification of the role of exosomal microRNA in colorectal tumorigenesis using human colorectal cancer cell lines

Dear Dr. Lee:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Klaus Roemer

Academic Editor

PLOS ONE

Open letter on the publication of peer review reports

PLOS recognizes the benefits of transparency in the peer review process. Therefore, we enable the publication of all of the content of peer review and author responses alongside final, published articles. Reviewers remain anonymous, unless they choose to reveal their names.

We encourage other journals to join us in this initiative. We hope that our action inspires the community, including researchers, research funders, and research institutions, to recognize the benefits of published peer review reports for all parts of the research system.

Learn more at ASAPbio .