PONE-D-19-25413

Draft Genome of Multiple Resistance Donor Plant Sinapis alba: An insight into SSRs, Annotations and Phylogenetics

PLOS ONE

Dear Dr. Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we have decided that your manuscript does not meet our criteria for publication and must therefore be rejected.

In this work, the authors have used alredy published at 2006 (Zhang X et al., "De novo Transcriptome Analysis of Sinapis alba in Revealing the Glucosinolate and Phytochelatin Pathways", Front Plant Sci, 2016 Mar 4;7:259) publicly available Illumina NGS sequence data of S. alba genome (SRR3490913, SRR3490914, SRR1799170, SRR1799171) for de-novo assembly, gene prediction with annotation and identification of SSR markers.

The main result of the work is genes annotation, SSR detection, primer design and validation.

Unfortunately, the virtual detection of potential SSR loci in NGS data is not of practical importance. The authors needed to check all potential SSR pairs of primers on different Sinapis alba varieties or lines and publish only real and useful SSR pairs.

Authors wrote:

“For validation of randomly selected 51 SSR markers, the young leaves of field-grown S. alba plants were used for extraction and purification of genomic DNA as reported earlier [20].” However, there is no variety information or specific information.

I see that part of the SSR primers from supplemental table 3 are themselves part of the microsatellite sequence. Therefore, such primers cannot be used for SSR analysis:

cactctcactctctctctctctctc

ttcctctccctctccctctc

ttctctctctctctctctctcactc

ggcgcaaagagagagagaaa

cgtcatctctctctctcgcaat

accgacaaacaaactcgaca

gagacggagaaccagacgac

tgtgtgttggggatagatgg

taaggaagcaagaggcagga

tttcgaactccctctctctcc

I am sorry that we cannot be more positive on this occasion, but hope that you appreciate the reasons for this decision.

Yours sincerely,

Ruslan Kalendar, PhD

Academic Editor

PLOS ONE

- - - - -

For journal use only: PONEDEC3

PONE-D-19-25413R1

Draft Genome of Multiple Resistance Donor Plant Sinapis alba: An insight into SSRs, Annotations and Phylogenetics

PLOS ONE

Dear Dr. Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Mar 07 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
• A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
• An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Evangelia V. Avramidou, PhD

Sujan Mamidi, Ph.D.

Academic Editors

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

• The name of the colleague or the details of the professional service that edited your manuscript

• A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

• A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

4. Please include a copy of Tables 1 and 2 which you refer to in your text on line 159 and 285.

Additional Editor Comments (if provided):

The manuscript provides the annotation of whole genome of S. alba and the production of SSRs which will be useful for further analysis, due to the fact that S. alba present resistance in abiotic and biotic stress.

Some major point for the authors:

1. Did you get the sequences from NCBI portal or did you produce the sequences with the help of JGI as they write in assembly preparation (this part needs to be clear for the readers). I suppose that you produce the sequences but (as also other editor refers) there is no information of how was the DNA generated, leaf or root and the procedures. Also did you perform 4 different experiments or 4 different runs (this is also mentioned from the other editor's review).

2. This is not a whole genome research but contig generation (this is also mentioned from the other editor review)

3. Authors did only validation in one strain of S. alba, and they do not write how many plants of this strain have been used.

4. You have to specify the ploidy of the crop as also other editor mentioned and furthermore to do a synteny analysis because you found so many SSRs but without a previous genetic map further validation of the SSRs must be performed.

5. Furthermore whole Abstract should be rewritten especially in the part of background and in the conclusion section. Also abstract has more than 300 words (PlOs One requires that abstract should not exceed 300 words).

6. My concern is also according to the published article from Zhang X et al., 2006"De novo Transcriptome Analysis of Sinapis alba in Revealing the Glucosinolate and Phytochelatin Pathways", Front Plant Sci, 2016 Mar 4;7:259 authors also produced 14,727 SSRs and there is no discussion about advantages & disadvantages for use of SSR primers produced in current manuscript instead of using SSR primers from Zang et al 2016.I can understand that you used different material but I would expect better explanation about this point.

Finally, the manuscript needs further analysis and English editing before can be published in PlOS ONE.

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Draft Genome of Multiple Resistance Donor Plant Sinapis alba: An insight into SSRs, Annotations and Phylogenetics

PONE-D-19-25413R2

Dear Dr. Singh,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Evangelia V. Avramidou, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Dear authors,

the manuscript entitled "Draft Genome of Multiple Resistance Donor Plant Sinapis alba: An insight into SSRs, Annotations and Phylogenetics"

was significantly imroved after our suggestions and comments.

Therefore I thnik that it suitable for publication on the journal.

With kind regards

Reviewers' comments: