Fig 1.
Proposed structural model of NgoPhi6.
Panel A depicts the structural organization of the phagemid pBSKS::Φ6fm(ST) as described by Piekarowicz et al [12]. The numbers in the inner circle indicate the open reading frames. The colors correspond to their proposed location in the mature phage particle. Panel B indicates the predicted size of each protein. The inset show the DNA sequence and coding sequence between Orf4 and Orf5. The arrow in red indicated the potential size of a fusion protein between Orf4 and Orf5.
Fig 2.
Modeling of proteins was carried out using an online service provided by Protein Structure Bioinformatics Group, Swiss Institute of Bioinformatics, Biozentrum, University of Basel as described in the materials and methods.
Fig 3.
Proteins contained in phage/phagemids isolated from various bacterial strains.
Filamentous phage NgoΦ6 of N. gonorrhoeae or its phagemid derivatives were purified by various methods: (Panel A) Purification by PEG/NaCl precipitation and two rounds of centrifugation at 38 000 g; (Panel B) centrifugation in CsCl gradients; (Panel C), purification on Sephacryl 4B column and (Panel D) S. enterica cells not carrying any phagemid genome where phagemid particles were isolated in parallel from S. enterica ser.Thyphimurium carrying pBSKS::Phi6fm (lane 1 and not carrying phagemid genome (lane 2). Proteins were separated on a 5% to 16% SDS-PAGE gel, and then stained with Coomassie Brilliant Blue. Panel A; lane 1: Phage NgoΦ6: lane 2, phagemid pMPMT6::Φ6fm isolated from E. coli strain DH5 alfa mcr); lane 3, phagemid pMPMT6::Φ6fm isolated from S. enterica sv. Typhimurium; and lane 4, phagemid pBSKS::Φ6fm isolated from H. influenzae. This figure is part of a previously published supplemental figure [30]. Panel B; lane 1, phagemid pBSKS::Φfm(ST) without induction with mitomycin C, lane 2, phagemidΦ pBSKS::Φ6fm(EC) without induction with mitomycin C, lane 3, phagemid pBSKS::Φ6fm(EC) after induction with mitomycin purified on Sephacryl 4B, Panel D, lane 1, phagemid pBSKS::Φ6fm(EC), lane 2, protein extract from E. coli cells not carrying any phagemid genome. Black dots on the right side of protein bands in Panel A identify protein used for their identification by Mass Spec; 35 kDa, 29 kDa, 26 kDa. 25 kDa from NgoΦ6; 38 kDa, 37 kDa and 29 kDa from pMPMT6::Φ6:fm(EC); 52 kDa and 51 kDa from pPMPMT6::Φ6fm (ST); 39 kDa from pBSKS::Φ6fm(HI).
Fig 4.
Impact of host strain on antibody reactivity.
Phage NgoΦ6 and its phagemid derivatives were isolated and extracts separated on a 16% SDS-PAGE gel and subjected to Western blot analysis with antibodies that were elicited by immunization of rabbits with S. enterica sv. Typhimurium containing pBSKSΦ6fm (panel A) or with purified NgoΦ6 (Panel B The lanes in Panel A represent: 1) pBSKSΦ6::fm isolated from H. influenzae, 2) pBSKSΦ6::fm: isolated from E.coli; lane 3 pMPMT6Φ6::fm isolated from Salmonella, and lane 4) NgoΦ6. The lanes in Panel B represent: 1) NgoΦ6 2) pBSKSΦ6::fm isolated from E. coli; lane 3 pMPMT6Φ6::fm isolated from S. enterica; and lane 4) pBSKSΦ6::fm isolated from H. influenzae. Equal amounts (10 μg) of phage proteins were loaded on the gel.
Fig 5.
Identification of protein glycosylation.
Proteins extracted from phage or phagemid particles were separated on a 5% to 15% SDS-PAGE gel and stained with Pro-Q Emerald 480 Glycoprotein Detection kit and then visualized with UV illumination. The lanes represent: MW, BioRad Dual Extra Molecular weight standards; Lane 1; phagemid pBSKS::Φ6fm isolated from E. Top10, lane 2; pBSKSΦ6::fm from S. enterica; lane 3 and 4; phage NgoΦ6; lane 5, pBSKS::Φ6fm isolated from H. influenzae. Equal amounts (10 μg) of phage proteins were loaded on the gel. The lanes M represent two proteins of molecular size 18 kDa and 42 kDa of CandyCane Glycoprotein Molecular Weight Standards stained by Emerald 488.
Fig 6.
Phage do not contain host DNA.
Lane 1 used DNA from NgoΦ6 phage particles purified after propagation in N. gonorrhoeae FA1090 cells. Lane 2; confirmation that NgoΦ6 DNA from NgoΦ6 phage particles contains phage genomic DNA; primers O4HisNF ATCATCACAAATTTATTAACACCTGCCG and O4HisNR GATGATGATGCATGATATTTTCCTTTACG were used to detect the presence of orf4 in phage particles purified after propagation in N. gonorrhoeae FA1090 cells. Lane 3 used DNA from phagemid particles pMPMT6::Φ6fm(EC) obtained from E. coli Top10 cells containing pET28::Por. Lane 4 used genomic N. gonorrhoeae FA1090 DNA as the source of DNA for PCR reaction. M;DNA ladder. Amplicons were obtained with primers PORFor CTAGCCTCTAGAATGAAAAAATCCCTGATTGCCCTG PORRev GATCCCGGGTTAGAATTTGTGGCGCAGAACGAC.
Table 1.
Identification of cell proteins in phage/phagemid particles.
Fig 7.
Detection of non-phage structural proteins in phage filaments.
Phage/phagemid particles purified by PEG/NaCl precipitation followed by two cycle of centrifugation at 38 000 g and 4000 g were separated on 15% SDS-PAGE gels and subjected to Western blot analysis with commercial Abs. Panel A, lane 1, Reactivity of NgoΦ6 proteins with anti MPOM Abs, Panel B, lane 1, reactivity of pBSKSΦ6::fm: (ST) proteins with anti-flagella ABs. The presence of the TEM-2 β-lactamase in pBSKSΦ6::fm(ST) was demonstrated by preparing a phage suspension (20mg/ml protein) in 50 mM Tris buffer pH. 7.5 and spotting 10 μl on nitrocefin disc. Color was allowed to develop for 15 minutes and a change of color to pink or red was indicative of a positive reaction. In Panel C. the lanes represent: Disc 1, control containing buffer only; Disc 2, pBSKSΦ6:fm(EC); Disc 3, pMPMT6:Φ6fm(ST); and Disc 4, NgoΦ6 phage from N. gonorrhoeae. Panel D demonstrates the presence of ß-lactamase in phage particle. Phagemid particles were separated on SDS-PAGE gels and subjected to Western blot analysis Lane 1 is Molecular Weight Standards and Lane 2 is a western blot using monoclonal anti β-lactamase Abs.