Fig 1.
Impact of primer tailing on the panFMDV-5UTR RT-qPCR assay.
A 5-fold dilution series of viral genomic RNA of isolate SAT2/ZIM/3/97 was tested in triplicate with the panFMDV-5UTR RT-qPCR assay using either non-tailed or tailed primers. Non-linear regression models were fitted to the raw fluorescence data of each replicate and the resulting models were amalgamated into a single replicate model using the replist function from the qpcR package [38] (S4 File). The figure shows the replicate model of 5 dilutions with error bars representing 1 standard deviation (nt: non-tailed, t: tailed).
Table 1.
Effect of primer tailing on Cq values of the panFMDV-3D RT-qPCR assay.
Viral genomic RNA was tested with the panFMDV-3D RT-qPCR assay using either non-tailed or tailed primers. Five isolates of the FMDV reference panel (n = 50) showed markedly lower Cq values when both primers were tailed. The table lists the difference (average ± standard deviation) between reactions containing non-tailed or tailed primers of the 5 aberrant isolates.
Fig 2.
Impact of primer tailing on the panFMDV-5UTR RT-qPCR assay using normal or hot-start dNTPs.
Viral genomic RNA of FMDV isolate SAT3/MAL/3/76 was tested with the panFMDV-5UTR RT-qPCR assay using different primer combinations in the presence of either normal dNTPs (panel A) or hot-start dNTPs (panel B). Non-linear regression models were fitted to the raw fluorescence data of each replicate and the resulting models were amalgamated into a single replicate model using the replist function from the qpcR package [38] (S4 File). The figures show the replicate model of each primer combination with error bars representing 1 standard deviation (nt: non-tailed, t: tailed).
Table 2.
Distribution of the different categories of artefacts found in the panFMDV-5UTR PCR reactions using normal or hot-start dNTPs.
RNA samples from different FMDV isolates (n = 12) were amplified with non-tailed or tailed primers using either normal or hot-start dNTPs. RT-qPCR products were analysed by high-throughput sequencing to study the contribution of each primer to the formation of PCR artefacts. Artefacts were classified into 4 categories based on the primer sequences present on both ends (FWD: forward, REV: reverse). The table lists the mean proportion and 95% confidence interval of each artefact category.
Fig 3.
Primer utilisation patterns of the FMDV-5UTR forward primer using hot-start dNTPs.
Heat map of forward primer utilisation patterns using non-tailed (A and C) or tailed (B and D) primers. The heat map indicates the abundance of each primer variant for each FMDV isolate, with primers ordered by decreasing synthesis bias (A and B) or decreasing binding affinity (C and D). Primer variants are named according to the nucleotide bases present at the degenerate positions (e.g. primer variant TTGTG corresponds to the primer 5’- CACTTTAAGGTGACATTGGTACTGGTAC -3’).
Fig 4.
Sequence alignment of a 367 bp fragment of the 3D gene from the control isolate (row 1) and the 5 aberrant isolates (rows 2–6).
The region contains the entire panFMDV-3D target region as well as part of the upstream and downstream regions. Primer binding sites are shown in black, dashed boxes whereas the region involved in the hairpin formation is shown in the red box.
Fig 5.
Primer/target and primer/probe/target interactions as predicted by Visual OMP.
Interactions between the panFMDV-3D forward primer/probe and target regions from FMDV isolates SAT2/NYE/29/90 (A, C) and Asia 1/CAM/2/91 (B, D). Figures A and B show the predicted interactions between the primer pf_FMDV-3D and the target DNA. Figures C and D show the same interactions in the presence of the probe tp_FMDV-3D.
Fig 6.
Effect of stabilisation of the forward primer on the performance of the panFMDV-3D RT-qPCR assay.
FMDV isolate O/TUR/2/92 was tested with the panFMDV-3D RT-qPCR assay using different primer combinations. Non-linear regression models were fitted to the raw fluorescence data of each replicate and the resulting models were amalgamated into a single replicate model using the replist function from the qpcR package [38] (S4 File). The figure shows the replicate model of each primer combination with error bars representing 1 standard deviation. (nt: non-tailed, t: tailed, zna: zipped nucleic acid).