Fig 1.
Schematic representation of the exon map of mammalian PPP1R12A, PPP1R12B and PPP1R12C leucine zipper positive (LZ+) isovariants.
A-C. The NCBI accession numbers, nucleotide sequence identity and exon map of known MYPT LZ positive isovariants are shown. Nucleotide and amino acid sequences depicting the 4-heptad leucine repeat within the carboxyl-terminal exons are also displayed above.
Table 1.
Details of donors used in this study.
Fig 2.
Bioinformatic inference of putative human PPP1R12A, PPP1R12B and PPP1R12C LZ- isovariant sequences.
The publicly available sequence information for chicken and mouse PPP1R12ALZ- isovariants are shown to display the 31 nucleotide exonic insert ‘GTGTCCGGCAAGAGTCAGTATCTACTGGGCG’. This generates a shift in the reading frame and a LZ negative read is located at the start of the black lettered exon. Cross-alignment with the human published PPP1R12A, PPP1R12B and PPP1R12C sequences enabled identification of the region to theoretically insert the 31 nucleotides. Doing so resulted in the translated LZ negative protein sequence ‘V[X]GKSQYLLGG’ of the chicken and mouse sequences also appearing in the predicted human LZ- sequences.
Fig 3.
Exon map of ‘predicted’ human PPP1R12A, PPP1R12B and PPP1R12C LZ negative (LZ-) isovariants.
The inferred LZ- exon maps, predicted amino acid and nucleotide sequences of the terminal exons of PPP1R12A, PPP1R12B and PPP1R12C (A-C) are displayed above.
Fig 4.
Optimisation of primers directed against PPP1R12A, PPP1R12B, PPP1R12C, PPP1R16A and PPP1R16B isovariants.
Panels above show PCR amplification and dissociation curves obtained for PPP1R12ALZ+, PPP1R12ALZ-, PPP1R12BLZ+, PPP1R12BLZ-, PPP1R12CLZ+, PPP1R12CLZ-, PPP1R16A and PPP1R16B Curves labelled A-E are representative of specific product formation obtained from human smooth muscle reference cDNA and human uterine cDNA samples. Similar curves were obtained for other positive controls including human skeletal and cardiac muscle samples. No specific products were obtained in reactions where the RT enzyme was excluded (RT-) or in water no template control (NTC) reactions. No specific products were obtained with PPP1R12BLZ- or PPP1R12CLZ- primer sets.
Table 2.
Details of Primers used for quantitative PCR.
The primers were based in the human cDNA sequences. The HUGO/GeneBank accession numbers, oligonucleotide sequences, position and amplicon size are outlined below and in S1 Table.
Fig 5.
Human uterine PPP1R12ALZ+, PPP1R12CLZ+ and PPP1R12ALZ- mRNA expression is decreased during in labor.
PPP1R12ALZ+, PPP1R12BLZ+, PPP1R12CLZ+ and PPP1R12ALZ- mRNA expression was determined using quantitative PCR and expressed as mean fold change relative to an internal calibrator. PCR amplification curves confirmed specific product formation for the four genes above. Quantitative PCR analyses demonstrate a significant decrease in PPP1R12ALZ+, PPP1R12ALZ- and PPP1R12CLZ+ mRNA expression in in-labor myometrium (IL) relative to pregnant not in labor (NIL) and non-pregnant (NP) myometrium. PPP1R12BLZ+ mRNA expression was lower in the IL and NIL groups relative to NP group. PPP1R12CLZ+ levels were similar NP and NIL groups. Bars represent means, *p<0.05, n = 10.
Fig 6.
Human uterine PPP1R16A and PPP1R16B mRNA expression is decreased during pregnancy and in labor.
PPP1R16A and PPP1R16B mRNA expression in non-pregnant (NP), pregnant not in labor (NIL) and in-labor (IL) myometrium were assessed using quantitative RT-PCR. The amount of individual MYPT mRNA in each sample was determined from human reference smooth muscle standard curve and quantified as mean fold change relative to an internal calibrator. PPP1R16A and PPP1R16B expression was significantly less in NIL and IL myometrium than in NP myometrium. PPP1R16A and PPP1R16B mRNA expression was similar in the NIL and IL groups. The bars represent mean, *p<0.05.