Fig 1.
Two dimensional polyacrylamide gel electrophoresis (2D-PAGE) analysis of low molecular weight RNA from HIV-1.
(A) 2D-PAGE pattern. tRNALys3, tRNALys1,2, tRNAAsn are indicated. tRNAIle(UAU) with and without intron newly identified by RT-PCR and sequencing are also indicated. Sequences of two clones are listed in panel B. (B) Sequence alignment of tRNAIle(UAU). Con represents the consensus of tRNAIle(UAU). The intron sequences are in small letters. Dash “-” stands for the same sequence as the consensus. Dot “.” stands for the sequence deletion.
Fig 2.
Confocal microscopy and Northern blot analysis.
(A) Representative immunofluorescence images of cells. Human HEK293T cells were fixed after 48 hours transfection of HIV-1 and stained with a FITC-tagged probe complimentary to the intron of tRNAIle(UAU) (5’ Fluorescein-TGCTCACAGGTG CACTGTCT 3’, Invitrogen) in FISH as shown in the left panel (green). Nucleus (purple) was stained by DAPI in the left middle panel. HIV-1 Gag (red) was stained by anti-Gag antibody and fluorophore Alexa-Fluor-594 labeled secondary antibody (Invitrogen), as shown in the right middle panel. The pictures were merged in the right panel. (B) Northern blot analysis of cellular total RNA, cytoplasmic (cyto) RNA and nuclear (nuc) RNA with or without HIV-1 transfection. 5S RNA was used as a loading control (lower panel) and snoU38B was used as a nuclear marker (middle panel). The intron-containing tRNAIle(UAU) species are indicated by the arrows (upper panel). The probe is complementary to the intron, as following sequence 5' TGCTCACAGGTGCACTGTCT 3'.
Fig 3.
3’ rapid amplification of cDNA ends (RACE) and 5’ RACE analysis.
(A) Schematic diagram of strategy for 3’ RACE (left panel) and 5’ RACE (right panel). Red curve represents the intron of pre-tRNAIle(UAU). (B) Results of 3’ RACE and 5’ RACE of pre-tRNAIle(UAU), pre-tRNALys, pre-tRNAPro, pre-tRNATyr from the nucleus (nuc) and the cytoplasm (cyto). 5’ leaders or 3’ trailers are in small letters. (C) The secondary structure of the intron-containing tRNAIle(UAU) (Chr6-tRNA63) with the long 3’ trailer.
Fig 4.
Qualitative (A) and quantitative RT-PCR (B) analysis of the precursor tRNAIle(UAU).
(A) Primer name and design are illustrated in the upper panel, and the results of agarose gel electrophoresis are showed in the lower panel. The PCR products are indicated by arrows. Marker, DNA marker; toto, total cell RNA sample; cyto, cytoplasm; nuc, nucleus; total-RT, total RNA sample without reverse transcriptase in reverse transcription. (B) Quantitative RT-PCR results. Primer name and design are showed in the upper panel, and the corresponding results are showed in the lower panel. Statistical analysis was conducted between the cytoplasm and the nucleus using two-tail Student T test.
Fig 5.
Purification of RNase ZS (A) and in vitro 3’ processing of tRNAIle(UAU) (B) by RNase ZS (RNase Z short, or ELAC1) and RNase ZL (RNase Z long, or ELAC2).
(A) SDS-PAGE running and Coomassie blue stain of RNase ZS purified from human HEK293E cells. M, protein marker; 1, 2, 3 represents elution 1, 2 and 3. (B) In vitro 3’ processing with (+) or without (-) RNase ZS or RNase ZL. M, RNA marker. “full” represents full length of intron-containing tRNAIle(UAU) transcribed in vitro without any 5’ leader and 3’ trailer and incorporated radioisotope [32P]-UTP. “guuuu” represents the intron-containing tRNAIle(UAU) with short 3’ trailer until “5’ guuuu 3’”; “uucuu” stands for the intron-containing tRNAIle(UAU) with long 3’ trailer until “5’ uucuu 3’”.
Fig 6.
Model of maturation of intron-containing tRNAIle(UAU) in human cells.
The intron-containing pre-tRNAs with long 5’ leaders and 3’ trailers are transcribed in the nucleus and undergo incomplete 5’ processing. They are then exported to the cytoplasm for incomplete 3’ processing by RNase ZS (the solid line with arrows). Retrograde travel of the intron-containing pre-tRNAs with short 5’ leaders and short 3’ trailers is expected from the cytoplasm to the nucleus (the dotted line with an arrow).