Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

< Back to Article

Table 1.

The strains used in this study.

More »

Table 1 Expand

Table 2.

The plasmids used in this study.

More »

Table 2 Expand

Table 3.

The oligonucleotides used in this study.

More »

Table 3 Expand

Fig 1.

Map of the amyE integration vector pDOW01 with BglBrick cloning site, EcoRI, BglII, BamHI and XhoI indicated in italics.

Indicated in bold are the RBS (AGGAGG), the TEV-protease recognition site (GAGAATTTGTATTTTCAGGGT; amino acid sequence ENLYFQG) and the two stopcodons (TAATAA).

More »

Fig 1 Expand

Table 4.

The eight images required for sensitized emission FRET.

More »

Table 4 Expand

Fig 2.

(A) The amyE integration vector pDOW23 with FRET-pair GFP-tagRFP.

(B) Schematic representation of two fluorescent proteins and the linker containing the TEV-protease recognition site (ENLYFQG). (C) A Western Blot to show the cleaving of coupled fluorophores by the TEV-protease. GFP protein was visualized by chemiluminescence with GFP-antibodies. The lanes contain cell free extract from the following strains: lane 1, DOW05 (thrC::Pxyl-tev amyE::gfp), lane 2, DOW13 (thrC::Pxyl-tev amyE::tagRFP), lane 3, DOW23 (thrC::Pxyl-tev amyE::gfp-tagRFP) from a culture without induction of the tev protease gene and lane 4, DOW23 (thrC::Pxyl-tev amyE::gfp-tagRFP) in which the tev protease gene was induced with 1% (w/v) xylose. Predicted sizes for GFP and tagRFP monomer are 27 kDa, and the complex 55 kDa.

More »

Fig 2 Expand

Fig 3.

Fluorescence intensities of single cells for the FRET-pair GFP-tagRFP.

Microscope excitation and emission filter settings are shown between brackets (d = donor, a = acceptor). For donor the filters (excitation, emission) were: GFP, GFP; for acceptor: mCherry, mCherry; and for FRET the filters were: GFP, mCherry. In all cases a GFP/mCherry polychroic mirror was used (400–470, 490–570, 580–630 and 640–730 nm range). A and B are cells where only donor fluorophore is present (GFP). C, D and D2 are cells where only acceptor fluorophore is present (tagRFP). E, F and G (upper panel) are cells where donor-acceptor fluorophore (GFP-tagRFP) are coupled and TEV-protease is not induced. E, F and G (lower panel) are cells where donor-acceptor (GFP-tagRFP) are uncoupled by induction of TEV-protease. The same signal scaling is used for all images. Note that the signals are false colored (GFP: green, tagRFP: red). Scale bar is 5 μm.

More »

Fig 3 Expand

Table 5.

The FRET efficiency Ea of the different FRET pairs, measured via Sensitized Emission.

More »

Table 5 Expand

Table 6.

Fluorescence intensities of B. subtilis cells with the various fluorescent proteins.

More »

Table 6 Expand

Fig 4.

The FRET efficiency, Ea, was determined over time with a fluorescence microscopy time-lapse experiment.

The covalently bound GFP-tagRFP, e.g. no TEV-protease, results in a high FRET efficiency (red line) and when the GFP-tagRFP is uncoupled by inducing the TEV-protease encoding gene, it results in a low FRET efficiency (black line). Error bars show the standard deviation of three replicate experiments. At least 50 single cells were analyzed at each time point.

More »

Fig 4 Expand

Table 7.

The FRET efficiency Ea of the different FRET pairs, measured with FLIM.

More »

Table 7 Expand

Fig 5.

Single cells FLIM measurements.

(A1) B. subtilis cells are shown where the GFP-tagRFP fluorophores are linked. (B1) B. subtilis cells are presented where the GFP and tagRFP fluorophores are cleaved apart. (C1) B. subtilis cells where GFP-tagRFP fluorophores are linked are mixed in a 1:1 ratio with B. subtilis cells where the GFP-tagRFP fluorophores are cleaved apart; resulting in a mix of cells with either short GFP fluorescence lifetime due to quenching by tagRFP or long GFP fluorescence lifetime. Visualization of cells in A1, B1, C1 was done with a Look-Up-Table from LI-FLIM. A2, B2 and C2 present the same cells, but now a Matlab script was used to categorize the cells into two categories: cells with short GFP lifetimes are shown in cyan and cells with long GFP lifetimes are shown in magenta. (D) fluorescence lifetime based histogram of the cells described in A2-C2, black, cyan, magenta and dotted lines present GFP_only, linked fluorophores, cleaved fluorophores and a mix of the two populations, respectively. Scale bar is 5 μm.

More »

Fig 5 Expand