Figure 1.
Genome-wide binding of sgp53/dmCas9.
A. Schematic representation of retroviral vector design expressing sgp53-1 or sgp53-3, dmCas9, and GFP. B. Genomic tracks displaying ChIP-seq and WCE-seq data from sgp53-1/dmCas9-, sgp53-3/dmCas9-, and dmCas9-infected cells across a ∼12 kbp region spanning p53. The RefSeq gene track for Trp53 is shown below the profiles. C. Identification of enriched motifs in sgp53-1/dmCas9 and sgp53-3/dmCas9 ChIP samples. The p53 exon target site and flanking PAM (red) are indicated. The sequence logo depicts the nucleotide distributions of overrepresented binding sites found by MEME-ChIP analysis in segments targeted specifically by sgp53-1/dmCas9 (25 sites, p-value 1.4×10−20) and sgp53-3/dmCas9 (24 sites, p value 3.2×10−15). D. Top: ChIP-enriched sequence read density. Bottom: Distribution of seed motif adjacent to a PAM within ∼500 bp of peak summits. E. Location and mutation frequency across 48 nucleotides centered from the 3rd nucleotide of the seed sequence upstream of the PAM (set at 0) for sgp53-1, OT#7, and sgp53-3 target sites. Blue indicates deletion and red indicates insertions. The percentage of read counts harboring mutations is indicated below the panel.
Table 1.
Number and Percentage of Total, Aligned, Duplicate, and Processed Reads Obtained from Chromatin Immunoprecipitates or Whole Cell Extracts (WCE) of Arf−/− MEFs infected with pQdmCiG, pQdmCiG/sgp53-1, or pQdmCiG/sgp53-3.
Figure 2.
In vitro DNA binding and cleavage properties of recombinant Cas9 and dmCas9 to the p53-1 target site.
A. Nucleotide sequence of oligonucleotide probes harboring the p53 exon 7-target site. The PAM motif is highlighted in yellow. The 20 nucleotide guide target is underlined by a dash line. B. Coomassie-stained SDS-PAGE of purified recombinant Cas9 and dmCas9 protein. C. In vitro binding to, and cleavage of, p53 [Exon 7] by Cas9. The presence or absence of Cas9, dmCas9, tracrRNA, and crRNA (harboring a guide sequence to Trp53 exon 7; cr20: 5′GUGUAAUAGCUCCUGCAUGG3′) is indicated above the panels. Left panel: EMSA resolved on a 5% native polyacrylamide gel. Right panel: Visualization of p53 [Exon 7] cleavage products by Cas9/tracr/crRNA resolved on a 10% polyacrylamide/8M urea gel. crRNA, CRISPR RNA; tracrRNA, trans-activating crRNA. D. Specificity of binding to, and cleavage of p53 [Exon 7]. EMSA and cleavage assays were performed with a crRNA targeting Trp53 exon 7 (p53-1) or a neutral control (TLR: 5′GAGCAGCGUCUUCGAGAGUG3′). E. Cleavage of p53 [Exon 7] by the indicated concentrations of Cas9. The “-RNA” lane indicates the absence of both crRNA and tracrRNA. Quantification is shown below the panel in the reaction mix. -, below limit of detection. n = 3±SD. F. EMSA with the indicated concentrations of Cas9 or dmCas9 to p53 [Exon 7]. The “-RNA” lane indicates the absence of both p53-1crRNA and tracrRNA. G. Quantification of EMSA of Cas9 and dmCas9 binding to p53 [Exon 7] in the presence of tracrRNA and crRNA (cr20). Quantitations were performed on a Typhoon Trio Variable Mode Imager with a Fuji imaging screen. n = 3±SD.
Table 2.
Binding Data for Cas9, dmCas9, and crRNA Substrates.
Figure 3.
Assessment of DNA binding and cleavage by Cas9 to sites identified by ChIP-Seq or in silico prediction.
A. Sequence of DNA probes harboring the wt p53 target (underlined) and adjacent PAM (highlighted in yellow) sequence or target sequences (from ChIP-seq or in silico prediction) harboring an 11 nt seed+PAM. Nucleotide differences relative to the wt p53 target site are highlighted in red with an overhead dot. The complete sequence of the 5′ and 3′ regions (not highlighted) of the oligonucleotides were maintained constant in all probes and originate from the p53 locus. Note that probes for C and E do not have an associated peak number since they are bioinformatically predicted and were not identified by ChIP-Seq. B. Left Panel. Assessment of Cas9 binding to oligonucleotide probes shown in Panel A. Reactions were resolved on a 5% native polyacrylamide gel. Right Panel. Cleavage reactions with DNA probes shown in Panel A. Reactions were resolved on a 10% polyacrylamide/8 M urea gel. Quantifications were performed on a Typhoon Trio Variable Mode Imager with a Fuji imaging screen. n = 3±SD. All samples were analyzed on the same gel - controls are juxtaposed adjacent to the experimentals for clarity.
Figure 4.
Base Complementarity of the PAM distal target region and the 5′ crRNA end affects engagement of Cas9 nuclease activity.
A. Sequence comparison of oligonucleotides harboring the wt p53 [Exon 7] target motif (underlined) and mutants harboring mismatches at nucleotides 16–20 of the crRNA guide target. Flanking 5′ and 3′ regions indicated by dots were maintained constant and are the same as in Figure 2A. B. Left panel: Assessment of Cas9 binding to oligonucleotides shown in Panel A by EMSA. Right panel: Cleavage reactions of oligonucleotides shown in Panel A. The “-RNA” lanes indicate the absence of crRNA and tracrRNA. Quantifications were performed on a Typhoon Trio Variable Mode Imager with a Fuji imaging screen. n = 3±SD.
Figure 5.
A minimum crRNA guide length of 17 nucleotides is necessary to engage Cas9 target cleavage.
A. Sequence of crRNA guides of variable length used in the current study. B. EMSA (left) and cleavage assay (right) of Cas9/tracrRNA/crRNA combinations using p53 [Exon 7] as probe and resolved on a 5% native polyacrylamide gel and 10% polyacrylamide/8M Urea gel, respectively. The “-RNA” lanes indicate the absence of crRNA and tracrRNA. C. EMSA (top) and cleavage assay (bottom) by Cas9 in the presence of p53[Exon 7] target and cr15 or cr20. D. Quantitation of Cas9:tracrRNA:cr20:DNA or Cas9:tracrRNA:cr15:DNA complex formation from EMSAs. Quantifications were performed on a Typhoon Trio Variable Mode Imager with a Fuji imaging screen. n = 3±SD.
Figure 6.
Multiplexed All-in-One vector to Direct Off-set nicking eliminates off-target cleavage.
A. Schematic representation of retroviral vectors expressing individual or pairs of sgRNAs in the presence of Cas9 or Cas9 (D10A). B. Quantitation of GFP+ Arf−/−MEFs transduced with the indicated vectors expressing Cas9 (pQCiG) or Cas9 (D10A) (pQDiG) with individual or pairs of p53 exon 7-targeting sgRNAs (sgp53-1, -860, and -904). The MLS-p53.1224 retrovirus expressing an shRNA to p53 was used as a positive control. Four days after transduction, cells were exposed to vehicle or Nutlin-3a for the indicated period and analyzed on a GUAVA EasyCyte HT flow cytometer (Millipore). n = 3±SD. C. Colony formation assay of infected Arf−/−MEFs with the indicated retroviral vectors. 5000 cells were seeded, exposed to Nutlin-3a for 12 days at which point they were stained with methylene blue. D. SURVEYOR assay of p53 [Exon7] and OT#7 from DNA isolated from pQCiG/sgp53-1 and pQDiG/sgp53-1/sg-860 infected cells selected with Nutlin-3a for 12 days. Relative band intensities were quantified using ImageJ (National Institutes of Health). n = 3±SD. E. Location and frequency of each sequenced mutation across 60 nucleotides centered around the genomic nucleotide that aligns to 3rd nucleotide of the seed sequence upstream of the PAM of the sgp53-1 guide RNA (the predicted site of Cas9-mediated cleavage), for both Trp53 (exon 7) and OT#7 loci. Arf−/−MEFs were transduced with the viruses indicated above the panel. The locus analyzed is indicated on the top right. Blue indicates deletion and red indicates insertions.
Figure 7.
Model Illustrating Target Sequence Dependency for Cas9 Target Binding and Cleavage.
Following PAM sampling by the Cas9:sgRNA complex, only PAM-proximal sequences are required for Cas9:sgRNA:target nucleation and are sufficient for complex formation [11]. Our study indicates that PAM-distal complementarity with the sgRNA (and a minimum sgRNA guide length of 17 nucleotides) is required to engage Cas9 target cleavage.