Figure 1.
RNA Aptamer Isolation via Dual-cycles (RAPID).
(A) Diagram of the RAPID process. The starting library or the enriched pool from the previous selection step can either go through the (inner) Non-Amplification Cycle and be used immediately in the next selection or go through the regular (outer) Amplification Cycle. (B) An example of processing times for SELEX and RAPID to complete two full selection cycles. Each selection is indicated with black blocks and arrowheads (▾) on top. (C) The total time required to complete six cycles of SELEX under optimal enrichment conditions, and six cycles of RAPID performed by alternating between Non-Amplification and Amplification Cycles; each colored block represents the total processing time between amplification steps. Asterisks (*) indicate the enriched and amplified pools that were analyzed via high-throughput sequencing.
Figure 2.
Binding of RNA after each selection cycle.
(A) Percent RNA recovery for SELEX cycles for Empty (orange circles), UBLCP1 (red squares), and CHK2 (blue triangles) microcolumns. In this mode, there is a clear distinction between the protein-bound and the Empty microcolumns. (B) Percent RNA recovery for RAPID cycles for the same targets. In this mode, there are significant increases in the percent aptamer recoveries following selections with non-amplified pools at Cycles 2, 4, and 6, followed by a concentration induced drop with the amplified pools at Cycles 3 and 5. (C) Test of enriched pool binding to CHK2 protein preparation. F-EMSA shows the progression of bulk binding affinity increase for both SELEX and RAPID enriched pools with the RAPID Cycle 6 pool showing higher bulk binding than the SELEX Cycle 6 pool.
Figure 3.
Sequence multiplicity distributions for various cycles of SELEX and RAPID.
(A) Distributions of the top 10,000 Empty, UBLCP1 and CHK2 sequences for SELEX Cycles 3 to 6. (B) The same Sequence multiplicity distributions of RAPID Cycles 2, 4 and 6 for the same targets.
Figure 4.
The relationship between sequence multiplicity and enrichment.
(A and B) Scatter plots of sequences’ multiplicity and enrichment within the top 10,000 highest multiplicity sequences from Cycle 6 of SELEX and RAPID for the Empty microcolumns. Multiplicity values have been normalized to counts per 107 and enrichment is calculated as the ratio of Cycle 6 multiplicities to Cycle 4 multiplicities for any sequence found in both pools. Some data points are obscured due to overlapping values. (C and D) Scatter plots of sequences’ multiplicity and Cycle 4-to-Cycle 6 enrichment within the top 10,000 highest multiplicity sequences from Cycle 6 of UBLCP1 SELEX and RAPID. (E and F) Scatter plots of sequences’ multiplicity and enrichment within the top 10,000 highest multiplicity sequences from Cycle 6 of CHK2 SELEX and RAPID. RAPID sequences show significantly higher multiplicities at lower enrichments than SELEX.
Figure 5.
Relationship of the SELEX and RAPID selected sequences in Cycle 6 pools.
(A and B) The first 40 random bases of the top 5 UBLCP1 and CHK2 sequences from Cycle 6 in RAPID (top) and SELEX (bottom). Identical sequences between both methods are highlighted with matching colors. The ranks of each sequence at earlier cycles (4, 5 and 6) are also shown. (C) A scatter plot of the 687 common sequences for UBLCP1 in SELEX and RAPID Cycle 6 pools; the dashed line represents a 1∶1 correlation between multiplicities in the two pools. (D) The same analysis for CHK2 yielded 1317 common sequences. On average, RAPID pools were enriched above SELEX pools.
Figure 6.
Binding test of the CHK2 protein prep’s highest multiplicity Cycle 6 aptamer candidate C6M1.
The sequence is given by the two flanking constant regions, and the random region: GATCGGTTCCAACGCTCTGTCGCCTAAGTGAACAGATGAAGAAAAAATAGCCCAATAAGAGGCAACAATCT. (A) Gel image of F-EMSA for C6M1 aptamer incubated with no protein or the CHK2 protein prep ranging from 1.4 nM to 2000 nM, in 1.5-fold increments. (B) Binding curves for C6M1 using F-EMSA and FP. The left axis shows the calculated fraction bound from F-EMSA (solid line, black circles), while the right axis shows the fluorescence polarization from C6M1 (dotted line, white circles). The fitted Kd for the two curves are 180±13 nM and 299±53 nM, respectively.