Figure 1.
The pshOK-basic plasmid map for generation of shRNAs.
The modified H1 promoter containing an AAA terminus followed by 2 Sap I restriction sites and 7 polyTs was used to introduce and express shRNAs. Upstream of the H1 promoter, the CMV-emGFP unit was used to tract shRNA expression. The isoaudamers Bam HI and Bgl II restriction sites were inserted as a means of generating linked shRNAs.
Figure 2.
The effects of various loop sequences on shRNA silencing activity.
(A) An shRNA scaffold targeted to the HBV conserved sequence “GGUAUGUUGCCCGUUUGUCCU” reported previously was selected and designed as an antisense-loop-sense structure (AS). (B) (C) The two best loops were selected and compared with two well-known loops TTCAAGAGA (used in pSuper) and CTCGAG (used in pLKO.1-puro) for two irrelevant target depression. The HBV target sequence “GGUAUGUUGCCCGUUUGUCCU” and the Gluc target sequence “UCUGUUUGCCCUGAUCUGCAU” were used in (B) and (C) respectively. Statistical significance was determined respectively by comparing shRNAs groups with that containing “TTCTAGAA” loop. Means and standard deviations were generated from 3 independent experiments. The “blank” group represents cells treated with pshOK-basic instead of the shRNA plasmid. The value in the blank group was set at 1.0.
Figure 3.
Comparison of the two shRNA construction methods.
(A) The shRNA clone method based on one long oligonucleotide (MO). The oligo underlined was synthesized and annealed to its self to form double strands. (B) The shRNA clone method based on two short oligonucleotides (MT). Two short oligonucleotides (underlined) were synthesized and the 5'-end of the oligo containing the loop sequence (TTCTAGAA) phosphorylated by the T4 polynucleotide kinase in the presence of ATP. Then, the two short oligonucleotides were annealed to form double strands. (C) The shRNA cloning efficiency of the two methods was compared. The vector pshOK-basic was digested with Sap I and ligated with the annealed double strand oligos as described above. The “control” group represents the linearized pshOK-basic ligated in the absence of oligos. Means and standard deviations were generated from 3 independent experiments.
Figure 4.
Suppression of two reporter genes by the shRNAs cloned with our methods.
(A) HepG2 cells were seeded in 24-well plates and cotransfected with 200 ng of pAAV-LacZ, 200 ng shRNA plasmid and 100 ng pSEAP2-Control (used as a normalization control). LacZ was stained and photographed 48 h after cotransfection of HepG2 cells. Magnification ×200. The scale bar represents 1 µm. (B) The same procedure described above was carried out using pCMV-Gluc in place of pAAV-LacZ. After 48 h, Gluc activity was determined. An shRNA scaffold (targeted to GUCUCCACGCGCAGUACAUUU) irrelevant to any known human or mouse gene sequence was designed as the negative control (“neg”) [23], [24]. Means and standard deviations were generated from 3 independent experiments.
Table 1.
Target sequences of the shRNAs.
Figure 5.
Screening of shRNAs for significant suppression of HBsAg and HBeAg.
(A) shRNAs targeting to the conserved regions of HBV genome were designed and illustrated. The numbers represent nucleotide (nt) coordinates relative to the HBV (genotype B) pgRNA start site. (B) HepG2 cells were seeded in 24-well plates and cotransfected with 200 ng of pHBV1.31, 200 ng shRNA plasmid and 100 ng pSEAP2-Control per well. The HBsAg and HBeAg concentrations in cell supernatants were detected 48 h post transfection. Means and standard deviations were generated from 3 independent experiments.
Figure 6.
Efficient down regulation of HBsAg and HBeAg expression using linked shRNAs concatemers both in vitro and in vivo.
(A) The diagram illustrates the principle of chaining two shRNAs derived from two different shRNA vectors into one vector. (B) HepG2 cells were seeded in 24-well plates and cotransfected with 200 ng of pHBV1.31, 200 ng shRNA plasmid and 100 ng pSEAP2-Control (as a normalization control) per well. After 48 h, the HBsAg and HBeAg concentrations were determined. Means and standard deviations were generated from 3 independent experiments. (C) Serum HBsAg and (D) HBeAg were measured by quantitative ELISA at the indicated days after plasmids delivery. Groups of male C57/BL6 mice (n = 6) were intravenously injected with 6 µg pHBV1.18, 3 µg shRNA plasmids and 3 µg pSEAP2-Control (as an internal control). NCU is the abbreviation of “National Clinical Unit”. Statistical significance was determined respectively by comparing shRNAs groups with AS139-1819-3172. Due to limited serum resources, each sample was diluted 20-fold.